Antimicrobial Resistance, SCCmec, Virulence and Genotypes of MRSA in Southern China for 7 Years: Filling the Gap of Molecular Epidemiology
by
, ,
Junyan Liu
1,2,†
,
Tengyi Huang
3,†, 
Thanapop Soteyome
4,
Jian Miao
5,
Guangchao Yu
6,
Dingqiang Chen
7, 
Congxiu Ye
8,
Ling Yang
9 and
Zhenbo Xu
3,*
1
College of Light Industry and Food Science, Guangdong Provincial Key Laboratory of Lingnan Specialty Food Science and Technology, Academy of Contemporary Agricultural Engineering Innovations, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China
2
Key Laboratory of Green Processing and Intelligent Manufacturing of Lingnan Specialty Food, Ministry of Agriculture, Guangzhou 510225, China
3
Department of Laboratory Medicine, The Second Affiliated Hospital of Shantou University Medical College, Shantou 515063, China
4
Home Economics Technology, Rajamangala University of Technology Phra Nakhon, Bangkok 10300, Thailand
5
Graduate Program in Pharmaceutical Sciences, College of Graduate Health Sciences, University of Tennessee Health Science Center, Memphis, TN 38163, USA
6
Center of Clinical Laboratory Medicine, First Affiliated Hospital of Jinan University, Guangzhou 510620, China
7
Department of Laboratory Medicine, Zhujiang Hospital, Southern Medical University, Guangzhou 510282, China
8
Department of Dermato-Venereology, Third Affiliated Hospital of Sun Yan-Sen University, Guangzhou 510630, China
9
Department of Laboratory Medicine, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University, Guangzhou 510120, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antibiotics 2023, 12(2), 368; https://doi.org/10.3390/antibiotics12020368
Submission received: 5 November 2022
/
Revised: 6 December 2022
/
Accepted: 16 January 2023
/
Published: 10 February 2023
(This article belongs to the Special Issue Antimicrobial Resistance Mechanisms and Antimicrobial Resistance Genes of Pathogens)
Abstract
:As the prevalence of Staphylococcus aureus infections is of worldwide concern, phenotype and genotype in prevalent MRSA strains require longitudinal investigation. In this study, the antibiotic resistance, virulence gene acquisition, and molecular type were determined on a large scale of nosocomial S. aureus strains in Southern China during 2009–2015. Bacterial identification and antimicrobial susceptibility to 10 antibiotics were tested by Vitek-2. Virulence genes encoding staphylococcal enterotoxins (SEA, SEB, SEC, SED, and SEE), exfoliative toxins (ETA and ETB), Panton–Valentine leukocidin (PVL), and toxic shock syndrome toxin (TSST) were detected by PCR, with SCCmec typing also conducted by multiplex PCR strategy. Genotypes were discriminated by MLST and spaA typing. MLST was performed by amplification of the internal region of seven housekeeping genes. PCR amplification targeting the spa gene was performed for spa typing. No resistance to vancomycin, linezolid, or quinupristin and increase in the resistance to trimethoprim/sulfamethoxazole (55.5%) were identified. A total of nine SCCmec types and subtypes, thirteen STs clustered into thirteen spa types were identified, with ST239-SCCmec III-t037 presenting the predominant methicillin-resistant S. aureus (MRSA) clone. Typically, SCCmec type IX and ST546 were emergent types in China. Isolates positive for both pvl and tsst genes and for both eta and etb genes were also identified. Important findings in this study include: firstly, we have provided comprehensive knowledge on the molecular epidemiology of MRSA in Southern China which fills the gap since 2006 or 2010 from previous studies. Secondly, we have presented the correlation between virulence factors (four major groups) and genotypes (SCCmec, ST and spa types). Thirdly, we have shown evidence for earliest emergence of type I SCCmec from 2012, type VI from 2009 and type XI from 2012 in MRSA from Southern China.
1. Introduction
As a major human pathogen and important “superbug”, methicillin-resistant Staphylococcus aureus (MRSA) is responsible for a wide range of infections and diseases due to possession of numerous virulence factors and toxins [1,2,3,4]. Currently, indiscriminate use of existing antibiotics which lead to the spread of antibiotic resistance, poses a dilemma for the treatment of bacterial infections [5,6,7,8,9]. Despite a variety of novel therapy and drug discovery, antibiotic resistance in microbes remains a major public health concern for the treatment of infectious diseases [10,11,12,13,14]. MRSA is one of such infectious bacteria that has become resistant to β-lactam antibiotics [15,16,17,18]. As China remains one of the worst areas for antibiotic abuse [19], it is necessary to raise general concerns regarding the surveillance and investigation of antibiotic resistance mechanism involved in clinical MRSA in China. To better understand the molecular evolution and epidemiological characterization of S. aureus, the analysis of SCCmec and genetic backgrounds mainly involved in randomly amplified polymorphic DNA (RAPD) types, sequence types (STs), clone complexes (CCs), and spa types is necessary [20,21,22].
In China, the first evidence of molecular types in MRSA dates back to 2003. However, this study had been primarily conducted using a large number of samples (118) from a hospital in Taiwan with a much smaller number of samples (14) from a hospital in Nanjing in mainland China [23]. In 2007, we reported on ST239-MRSA and strains carrying class 1 integrons isolated in 2005. Ref. [5], for which we had further provided the SCCmec (type III), spa, and coa types in a subsequent study [24]. In 2008, we reported on the presence of the SCCmec of four different types of methicillin-resistant coagulase-negative staphylococci (MRCNS) [25]. In 2011, we conducted a molecular epidemiology study on MRSA isolates from 2001–2006, including SCCmec, RAPD, MLST, spa, and coa typing, as well as carriage of class 1 integrons [26]. In a subsequent study, we had provided evidence on the molecular epidemiology of MRSA during 2001–2010 [27]. As found from all above studies conducted in Guangzhou representative of Southern China, ST239-MRSA-III was highly prevalent, with only a few exceptions carrying type II SCCmec and none of other ST than ST239. Only one distinct coa type HIJKL and 2 spaA types (WGKAOMQ-t037 and WGKAQQ-t030 were identified during the study period of 2001–2010.
However, since the types of SCCmec has increased from six types (I to VI) in 2006 to fourteen (I to XIV) to date, the concern about the evolution of SCCmec and molecular epidemiology in MRSA since 2006 or 2010 in Southern China remains unclear but important [28,29]. Consequently, in this study, numerous S. aureus strains isolated in Southern China during 2009–2015, were subjected to antimicrobial resistance, virulence genes identification, SCCmec, MLST, and spa typing.
2. Results
2.1. Antimicrobial Susceptibility Profile
For 524 S. aureus strains isolated from various departments, infection sites, and patients covering different age groups (Table 1), 490 (93.5%) MRSA and 34 methicillin-susceptible S. aureus (MSSA) were identified, respectively (Table 2). No resistance to vancomycin, linezolid, or quinupristin was detected, yet a percentage of the strains investigated demonstrated resistance to oxacillin (93.9%), erythromycin (83.9%), ciprofloxacin (80.0%), levofloxacin (79.5%), moxifloxacin (73.4%), clindamycin (73.1%), trimethoprim/sulfamethoxazole (55.5%) and rifampin (34.7%), totaling the multi-drug resistance rate as 88.7% (465/524).
2.2. Carriage of Virulence Genes
According to the results, SEs genes were commonly detected, with the identification rate of sea, seb, sec, sed, and see found to be 67.8% (352/519), 33.0% (171/519), 42.6% (221/519), 1.9% (10/519), 35.8% (186/519), respectively. For exfoliative toxins genes, 12.4% (61/493) and 9.6% (49/511) of the strains were positive for eta and etb. In addition, tsst and pvl were detected in 28.6% (146/511) and 14.9% (76/511) of strains.
2.3. SCCmec Types
As shown by the results of SCCmec typing, a total of 7 types and 2 subtypes were identified within 490 MRSA isolates (Table 2), including types I/IA, II, III/IIIA, IV, V, VI, and IX. The most prevalent SCCmec was type III (48.0%, 235/490, with 9.2% for subtype IIIA), followed by type II (18.6%, 91/490), IV (13.9%, 68/490), VI (6.3%, 31/490), V (3.7%, 18/490) and I (3.3%, 16/490, with 3.3% for subtype IA).
2.4. MLST
Clonal relatedness of 508 S. aureus strains was investigated by DNA fingerprinting by RAPD-PCR. A total of 112 distinctive RAPD types were identified, 71 RAPD types were at least represented by 2 strains, 41 RAPD types were only represented by one strain. The 71 RAPD types with at least 2 strains were further clustered into 13 STs by MLST (Table 3). The occurrence of ST239, ST5, ST45, ST59, and ST1 was found to be 65.5% (306/467), 9.0% (42/467), 7.5% (35/467), 5.4% (25/467), and 2.1% (10/467).
2.5. Spa Type
A total of 13 spa types were identified by spa typing (Table 3). Amongst these, t037 was the most prevalent type (38.5%, 180/467), followed by t030 (26.6%, 124/467), t1081 (14.6%, 68/467), t437 (5.8%, 27/467), and t002 (5.8%, 27/467).
3. Discussion
A remarkably high multi-drug resistance rate (88.7%) was obtained in the tested strains, with the majority as MRSA. Noteworthily, increase in trimethoprim/sulfamethoxazole resistance (from 20.3% during 2009–2012 to 82.7% during 2013–2015, particularly 100% in 2014 and 2015) and a decrease in ciprofloxacin resistance (from 92.0% in 2009 to 70.8% in 2015) were obtained (Table 2). An increase in trimethoprim/sulfamethoxazole resistance within S. aureus isolates had also been reported in our previous study and other reports [30,31,32,33]. A decrease in ciprofloxacin in this study was also in accordance with the previous surveillance, whereas the resistance rate of ciprofloxacin was found to be 69.2% during 2006–2010 and 44.0% in 2011–2015. Concerning the correlation between antibiotic resistance and SCCmec types, isolate type II SCCmec showed significantly lower resistance to erythromycin (8.3%) than other types (average 81.5%). Type V SCCmec (23.5%) was the least resistant to trimethoprim/sulfamethoxazole, followed by type II (42.9%) and type III (44.4%). Low resistance to rifampin was also identified in type II SCCmec (18.3%)
As a major human pathogen, MRSA has a number of virulence genes in its genome, which contributes to its pathogenicity. However, very few studies had touched upon the relevance between its molecular epidemiology and virulome (virulence genes profile). In S. aureus, extracellular protein toxins are major toxins that could significantly enhance its pathogenicity, including Staphylococcal enterotoxins (SEs), toxic shock syndrome toxin 1 (TSST-1), exfoliative toxins (ETs) and Panton–Valentine leukocidin (PVL) [34,35]. In addition, there are a few subtypes of such toxins, especially SEs. In this study, four types of such toxins with a total of nine targets were investigated, followed by a comprehensive analysis of the relatedness. For the occurrence of virulence genes, high diversity was found in different years and subtypes. For SEs, sea, seb, and sec had been commonly detected during 2009–2015, with sea being the most prevalent type. In comparison, the identification rate of see had decreased in 2011 and 2013, but with the highest rate in 2012. While sed had only been detected in 2011 and 2012. Change in the detection of sec (rise from 8.0% in 2009 to 62.8% in 2015) and see (drop from 73.0% in 2009 to 13.2% in 2015) was also observed (Table 2). The other four virulence genes were also commonly detected during the studied period. Importantly, first emerging in 2010, the carriage of eta changed from 7.0% during 2009–2012 to 29.4% in 2015 [36]. In this study, we further performed a comprehensive analysis of the relatedness between virulence genes and other microbial traits, including antibiotic susceptibility, SCCmec, MLST, and spa types. However, no significant correlation was identified between virulence gene carriage and antibiotic susceptibility. Table 4 had comprehensively shown the relatedness between the carriage of each specific virulence gene, with SCCmec, ST types, and spa types separately. For SEs, a higher relatedness rate with type I SCCmec was found, compared with a much lower rate with hospital-associated MRSA (type II and III SCCmec), especially for seb and sed. In addition, it was found that sea showed a higher prevalence in ST239 than other SEs. For tsst and pvl, the higher occurrence was found in CA-MRSA.
Previously in Southern China, type III SCCmec was the dominant with only a few strains carrying type II SCCmec or untypeable [26,27]. However, in this study, diversity in SCCmec was obtained, with type I/IA, II, III/IIIA, IV, V, VI and IX SCCmec totaling 7 types and 2 subtypes within 490 MRSA isolates (Table 2). Despite the high occurrence of type III SCCmec, declination in hospital associated types (70.4% with 345/490 for I, II and III), increase in community-associated types (17.6% with 86/490 for IV and V), as well as diversity in detected SCCmec, had been shown in the present study. Remarkably, the five types (I, IV, V, VI and IX) and one subtype (IA) newly found in this study, had represented the first evidence of type I (mainly in Japan and Korea) and IX (the second identification after Thailand) in China. In addition, prevalence of type III had dropped from higher than 90% to 48.0%, with an increase in type II to 18.6%. Further analysis was conducted in regards with the correlation between virulence factor and SCCmec. Frequently identified in community-associated MRSA (CA-MRSA) strains [37], pvl was detected in only 14.9% of tested strains, of which type II (35.5%) and III (34.2% including 7.9% IIIA) SCCmec were predominant followed by type IV (19.7%), VI (3.9%) and I (2.6%). Remarkably, 24 and 12 S. aureus isolates were pvl+tsst+ and eta+etb+, respectively.
As genotyping was concerned, the strategy we used was to combine MLST and spa typing. In comparison with previous reports, higher diversity was found in this study, with 7 types and 2 subtypes of SCCmec, 13 STs, and 13 spa types identified from 490 MRSA strains within a study period of 7 years and 2 medical centers. Within STs and spa types, despite ST239 remaining as the dominant type, common SCCmec types such as ST5, ST45, and ST59 had also been frequently detected. Significantly, ST546 (2.1%, 10/467) has been first identified in Asia during 2010–2012, and the carriage rate of ST239 dropped from 76.9% in 2011 to 58.5% in 2015. For clonal complex (CC) as shown in Table 4, ST239-SCCmec II/III/IV, ST5/45-SCCmec III, ST59-SCCmec II, ST546-SCCmec II/III/IV were the prevalent types. In Southern China, ST239-SCCmec III was the only predominant MRSA clone during 2001–2006 (93.8%) and had changed to 37.7% during 2009–2015. Diversity of both SCCmec and ST were also found, with ST239-SCCmec IV, ST5-SCCmec III, ST45-SCCmec III, ST59-SCCmec II, ST1-SCCmec III, ST546-SCCmec II, III and ST546-SCCmec IV identified for the first time. In combination with SCCmec ST and spa types, ST239-SCCmec II/III-t037/t030/t1080 was the predominant MRSA clone accounting for 30% of all tested MRSA strains (Table 3).
4. Materials and Methods
4.1. Clinical Samples and Bacterial Strains
From 2009 to 2015, a total of 524 S. aureus isolates collected from First Affiliated Hospital of Guangzhou Medical University (FAHGMU) and First Affiliated Hospital of Jinan University (FAHJU) were evaluated. FAHGMU is a grade A tertiary hospital combining medical, teaching, scientific research, health care, rehabilitation, and pre-hospital emergency. It is one of the first 13 national clinical medical research centers in China. FAHJU is a tertiary-level teaching hospital with a large-scale patient population and two 2000-bed medical centers in Southern China. With the advantage of location (in the central city of Southern China) and medical capacity, patients in different areas in Southern China have therapy and treatment in FAHGMU and FAHJU. Thus, the data collected in the current study present the epidemiology of S. aureus during the contemporary period in the whole Southern China area. S. aureus isolates were maintained as glycerol stock stored at −80 °C. A small amount of S. aureus stock was spread onto tryptic soy agar (TSA) and incubated at 37 °C for 24 h to obtain single colonies. A single colony of S. aureus was transferred to 2 mL of tryptic soy broth (TSB) and incubated at 37 °C with shaking at 200 rpm overnight prior to further experiments.
4.2. Bacterial Identification and Antimicrobial Susceptibility Testing (AST)
For the clinical sample, blood agar plate (Huankai Biotech, Guangzhou, China) was used to specifically identify S. aureus strains. After acquisition of yellow/golden yellow colonies, bacterial identification on all S. aureus strains was performed to the species level according to standard procedures [38], including colony morphology, Gram staining, catalase test, Vitek-2 automated system, and PCR amplification on 16S rRNA (Staphylococcus specific) and femA (S. aureus specific) genes. Methicillin resistance was determined by PCR on mecA using primers M1 and M2. S. aureus strain ATCC29212 carrying 16S rRNA, mecA, and femA genes served as positive control. AST was conducted by Vitek-2 [39] with 10 studied antibiotics including ciprofloxacin, clindamycin, erythromycin, levofloxacin, linezolid, moxifloxacin, oxacillin, quinupristin, rifampin, trimethoprim/sulfamethoxazole, and vancomycin. All results were interpreted according to criteria of Clinical and Laboratory Standards Institute (CLSI 2021). Strain resistance to >2 drugs was considered to be multi-drug resistance [40].
4.3. Detection of Virulence Genes
A total of 9 virulence genes were selected to test in this study (Table 2), including 5 SEs genes (sea, seb, sec, sed and see), 2 exfoliative toxins genes (eta and etb), 1 panton-valentine leukocidin gene (pvl) and 1 toxic shock syndrome toxin gene (tsst). Genomic DNA from S. aureus strains for PCR amplification was prepared from overnight cultures according to the instruction of DNA extraction kit (Dongsheng Biotech Co., Ltd., Guangzhou, China). Briefly, harvested cells were orderly treated with lysozyme and proteinase K to obtain lysates. Suspension was purified after the removal of proteins and salts etc. The highly purified DNA was strictly stored at −20 °C. A total of 9 virulence genes were detected by PCR in all S. aureus strains, with tested genes encoding staphylococcal enterotoxins (SEA, SEB, SEC, SED and SEE), exfoliative toxins (ETA and ETB), Panton-Valentine leukocidin (PVL) and toxic shock syndrome toxin (TSST) [36,41]. All PCR assays were performed in triplicate using the primers listed in Table 5 as described previously [42,43,44]. PCR amplification was performed in a volume of 50 µL with 2× PCR Master Mix (Dongsheng Biotech Co., Ltd., Guangzhou, China). The DNA Thermal Cycler EDC-810 (Eastwin Biotech Co., Ltd., Beijing, China) was programmed as follows: the first denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at respective temperature listed in Table 5 for 30 s, and an extension at 72 °C for 90 s for 30 cycles and at last the final extension at 72 °C for 7 min. Three positive strains for each virulence gene were adapted to Sanger sequencing to confirm the accuracy of the amplicons. Strains with correct amplicons were subsequently used as positive controls.
4.4. SCCmec Typing
A multiplex PCR strategy is the most available method for SCCmec typing, and it can be used to study the evolution of MRSA [45]. Different SCCmec types were determined by specific primers listed in Table 5. PCR amplification was performed in a volume of 50 µL with 2× PCR Master Mix (Dongsheng Biotech Co., Ltd., Guangzhou, China). The DNA Thermal Cycler EDC-810 (Eastwin Biotech Co., Ltd., Beijing, China) was programmed as follows: the first denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at respective temperature listed in Table 5 for 30 s, and an extension at 72 °C for 90 s for 30 cycles and at last the final extension at 72 °C for 7 min. PCR products were analyzed by electrophoresis on 1.5% agarose gel. S. aureus strains 10442 (carrying ccr1 and IS1272-mecA), N315 (carrying ccr2 and mecI-mecR1), JP25 (carrying ccr3), and WIS (carrying IS431-mecI-mecA) were served as positive controls.
4.5. DNA Fingerprinting Analysis by RAPD-PCR
Random primers AP1, AP7 and ERIC2 (Table 5) [46,47] were applied for RAPD-PCR assay [48]. PCR amplification was performed in a volume of 50 µL with 2× Taq PCR Master Mix (Dongsheng Biotech Co., Ltd., Guangzhou, China). Components for RAPD-PCR including 2× Taq PCR Master Mix 25 µL, primer 3 µL, DNA template 1 µL and ddH2O 21 µL. RAPD-PCR program was as follows: 94 °C for 5 min; followed by 94 °C 1 min, 38 °C 1 min, 72 °C 2 min for 8 cycles, and 94 °C 1 min, 38 °C 1 min, 72 °C 2 min for 25 cycles; 72 °C 7 min. PCR products were analyzed by electrophoresis on 1.5% agarose gel.
4.6. MLST
Strains adapted for MLST and spa typing [20,49,50,51]. MLST was performed by amplification of the internal region of seven housekeeping genes, including arc, aroE, glpF, gmk, pta, tpi, and yqiL. The amplicons were 456, 456, 465, 417, 474, 402, and 516 bp, respectively. The PCR products were sequenced with ABI Prism 377 DNA Sequencer (PE Applied Biosystems, USA) and compared with the existing sequences available in the MLST website (http://www.pubmlst.org, accessed on 1 November 2022) for S. aureus, and the allelic number was determined for each sequence. The sequence type (ST) was determined according to the pattern of the combination of the seven alleles, and the clonal complex (CC) was defined by the BURST (based upon related sequence types) program v3.0 by accessing the MLST website.
4.7. Spa Typing
Protein A, which is encoded by spa gene, is a surface protein originally found in the cell wall of S. aureus and it has been used in biochemical research because of its ability to bind immunoglobulins. According to the number, characteristics, and arrangement of repeated sequences in X region, which is a highly repeated sequence in protein A, the spa typing can reliably and accurately present the polymorphism of S. aureus [52]. PCR amplification targeting spa gene with primers spa-Up and spa-Dn (Table 5) was performed for spa typing. The PCR was programmed as follows: the first denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 45 s, and an extension at 72 °C for 90 s for 30 cycles, and at last the final extension at 72 °C for 10 min. PCR products were analyzed by electrophoresis on 1.5% agarose gel. Purified amplicons were sequenced with ABI Prism 377 DNA Sequencer (PE Applied Biosystems, Foster City, CA, USA) and repetitive sequences were collected to align to Ridom spa-server (https://spaserver.ridom.de/) (accessed on 4 October 2017) in which 16150 spa types, 709 repeats, and 350761 strains are available.
4.8. Statistical Analysis
In this study, antimicrobial susceptibility results and organization were managed in WHONET (version 5.6) (Boston, MA, USA). The chi-square test or Fisher’s exact test was applied in the correlation analyses, if appropriate. A p value < 0.05 was defined as statistically significant.
5. Conclusions
In conclusion, this study has provided comprehensive knowledge on the correlation among antimicrobial resistance, SCCmec, ST, and spa types from a large scale of clinical S. aureus during a lengthy period. An increase in the resistance to trimethoprim/sulfamethoxazole was identified. A total of nine SCCmec types and subtypes, thirteen STs clustered into thirteen spa types were identified, with ST239-SCCmec III-t037 presenting the predominant MRSA clone. Typically, SCCmec type IX and ST546 were emergent types in China. Isolates positive for both pvl and tsst genes and for both eta and etb genes were also identified. The results yielded from this study will aid in further surveillance of molecular epidemiology and evolutionary discrepancy on MRSA.
Author Contributions
Conceptualization, Z.X.; methodology, J.L. and T.H.; validation, T.S. and J.M.; formal analysis, D.C.; investigation, C.Y.; resources, G.Y. and L.Y.; writing—original draft preparation, J.L.; writing—review and editing, J.L.; supervision, Z.X.; funding acquisition, Z.X. and J.L. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the National Natural Science Foundation of China (32202199), Guangdong Major Project of Basic and Applied Basic Research (2020B0301030005), Guangdong International S&T Cooperation Programme (2022A0505070001), Guangdong Basic and Applied Basic Research Foundation Natural Science Foundation (Zhenbo Xu), Young S&T Talent Training Program of Guangdong Provincial Association for S&T, China (SKXRC202207), Young Talent Support Project of Guangzhou Association for Science and Technology (QT20220101076), Guangdong Province Key Construction Discipline Research Ability Improvement Project (2021ZDJS005), Guangdong Provincial Agricultural Science and Technology Innovation and Extension Project in 2021 (No. 2021KJ101), Collaborative grant with AEIC (KEO-2019-0624-001-1).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Tong, S.Y.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G., Jr. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin. Microbiol. Rev. 2015, 28, 603–661. [Google Scholar] [CrossRef] [PubMed]
- Lakhundi, S.; Zhang, K. Methicillin-resistant Staphylococcus aureus: Molecular characterization, evolution, and epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.S.; De Lencastre, H.; Garau, J.; Kluytmans, J.; Malhotra-Kumar, S.; Peschel, A.; Harbarth, S. Methicillin-resistant Staphylococcus aureus. Nat. Rev. Dis. Prim. 2018, 4, 18033. [Google Scholar] [CrossRef] [PubMed]
- Lim, D.; Strynadka, N.C. Structural basis for the β lactam resistance of PBP2a from methicillin-resistant Staphylococcus aureus. Nat. Struct. Biol. 2002, 9, 870–876. [Google Scholar] [CrossRef]
- Xu, Z.; Shi, L.; Zhang, C.; Zhang, L.; Li, X.; Cao, Y.; Li, L.; Yamasaki, S. Nosocomial infection caused by class 1 integron-carrying Staphylococcus aureus in a hospital in South China. Clin. Microbiol. Infect. 2007, 13, 980–984. [Google Scholar] [CrossRef]
- Parsonnet, J.; Goering, R.V.; Hansmann, M.A.; Jones, M.B.; Ohtagaki, K.; Davis, C.C.; Totsuka, K. Prevalence of toxic shock syndrome toxin 1 (TSST-1)-producing strains of Staphylococcus aureus and antibody to TSST-1 among healthy Japanese women. J. Clin. Microbiol. 2008, 46, 2731–2738. [Google Scholar] [CrossRef]
- Peacock, S.J.; Paterson, G.K. Mechanisms of methicillin resistance in Staphylococcus aureus. Annu. Rev. Biochem. 2015, 84, 577–601. [Google Scholar] [CrossRef]
- Stefani, S.; Goglio, A. Methicillin-resistant Staphylococcus aureus: Related infections and antibiotic resistance. Int. J. Infect. Dis. 2010, 14, S19–S22. [Google Scholar] [CrossRef]
- Vestergaard, M.; Frees, D.; Ingmer, H. Antibiotic resistance and the MRSA problem. Microbiol. Spectr. 2019, 7, 2. [Google Scholar] [CrossRef]
- Cheung, G.Y.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef]
- David, M.Z.; Daum, R.S. Treatment of Staphylococcus aureus infections. In Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2017; pp. 325–383. [Google Scholar]
- Nataraj, B.H.; Mallappa, R.H. Antibiotic resistance crisis: An update on antagonistic interactions between probiotics and methicillin-resistant Staphylococcus aureus (MRSA). Curr. Microbiol. 2021, 78, 2194–2211. [Google Scholar] [CrossRef]
- Pérez, C.; Zúñiga, T.; Palavecino, C.E. Photodynamic therapy for treatment of Staphylococcus aureus infections. Photodiagnosis Photodyn. Ther. 2021, 34, 102285. [Google Scholar] [CrossRef]
- Zhou, K.; Li, C.; Chen, D.; Pan, Y.; Tao, Y.; Qu, W.; Liu, Z.; Wang, X.; Xie, S. A review on nanosystems as an effective approach against infections of Staphylococcus aureus. Int. J. Nanomed. 2018, 13, 7333. [Google Scholar] [CrossRef]
- Nada, T.; Ichiyama, S.; Osada, Y.; Ohta, M.; Shimokata, K.; Kato, N.; Nakashima, N. Comparison of DNA fingerprinting by PFGE and PCR-RFLP of the coagulase gene to distinguish MRSA isolates. J. Hosp. Infect. 1996, 32, 305–317. [Google Scholar] [CrossRef]
- Jorgensen, S.C.; Zasowski, E.J.; Trinh, T.D.; Lagnf, A.M.; Bhatia, S.; Sabagha, N.; Abdul-Mutakabbir, J.C.; Alosaimy, S.; Mynatt, R.P.; Davis, S.L. Daptomycin plus β-lactam combination therapy for methicillin-resistant Staphylococcus aureus bloodstream infections: A retrospective, comparative cohort study. Clin. Infect. Dis. 2020, 71, 1–10. [Google Scholar] [CrossRef]
- Lenhard, J.R.; Bulman, Z.P. Inoculum effect of β-lactam antibiotics. J. Antimicrob. Chemother. 2019, 74, 2825–2843. [Google Scholar] [CrossRef]
- Li, J.; Echevarria, K.L.; Traugott, K.A. β-Lactam Therapy for Methicillin-Susceptible Staphylococcus aureus Bacteremia: A Comparative Review of Cefazolin versus Antistaphylococcal Penicillins. Pharmacother. J. Hum. Pharmacol. Drug Ther. 2017, 37, 346–360. [Google Scholar] [CrossRef]
- Xu, Z.; Li, L.; Chu, J.; Peters, B.M.; Harris, M.L.; Li, B.; Shi, L.; Shirtliff, M.E. Development and application of loop-mediated isothermal amplification assays on rapid detection of various types of staphylococci strains. Food Res. Int. 2012, 47, 166–173. [Google Scholar] [CrossRef]
- Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef]
- McGuinness, S.L.; Holt, D.C.; Harris, T.M.; Wright, C.; Baird, R.; Giffard, P.M.; Bowen, A.C.; Tong, S.Y. Clinical and molecular epidemiology of an emerging Panton-Valentine leukocidin-positive ST5 methicillin-resistant Staphylococcus aureus clone in Northern Australia. Msphere 2021, 6, e00651-20. [Google Scholar] [CrossRef]
- Van Leeuwen, W.; Sijmons, M.; Sluijs, J.; Verbrugh, H.; Van Belkum, A. On the nature and use of randomly amplified DNA from Staphylococcus aureus. J. Clin. Microbiol. 1996, 34, 2770–2777. [Google Scholar] [CrossRef] [PubMed]
- Aires de Sousa, M.; Crisostomo, M.; Santos Sanches, I.; Wu, J.; Fuzhong, J.; Tomasz, A.; De Lencastre, H. Frequent recovery of a single clonal type of multidrug-resistant Staphylococcus aureus from patients in two hospitals in Taiwan and China. J. Clin. Microbiol. 2003, 41, 159–163. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Shi, L.; Alam, M.J.; Li, L.; Yamasaki, S. Integron-bearing methicillin-resistant coagulase-negative staphylococci in South China, 2001–2004. FEMS Microbiol. Lett. 2008, 278, 223–230. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Li, L.; Alam, M.; Zhang, L.; Yamasaki, S.; Shi, L. First confirmation of integron-bearing methicillin-resistant Staphylococcus aureus. Curr. Microbiol. 2008, 57, 264–268. [Google Scholar] [CrossRef]
- Xu, Z.; Li, L.; Shirtliff, M.; Peters, B.; Li, B.; Peng, Y.; Alam, M.J.; Yamasaki, S.; Shi, L. Resistance Class 1 integron in clinical methicillin-resistant Staphylococcus aureus strains in southern China, 2001–2006. Clin. Microbiol. Infect. 2011, 17, 714–718. [Google Scholar] [CrossRef]
- Deng, Y.; Liu, J.; Peters, B.M.; Chen, L.; Miao, J.; Li, B.; Li, L.; Chen, D.; Yu, G.; Xu, Z. Antimicrobial resistance investigation on Staphylococcus strains in a local hospital in Guangzhou, China, 2001–2010. Microb. Drug Resist. 2015, 21, 102–104. [Google Scholar] [CrossRef]
- Chongtrakool, P.; Ito, T.; Ma, X.X.; Kondo, Y.; Trakulsomboon, S.; Tiensasitorn, C.; Jamklang, M.; Chavalit, T.; Song, J.-H.; Hiramatsu, K. Staphylococcal cassette chromosome mec (SCC mec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: A proposal for a new nomenclature for SCC mec elements. Antimicrob. Agents Chemother. 2006, 50, 1001–1012. [Google Scholar] [CrossRef]
- Uehara, Y. Current Status of Staphylococcal Cassette Chromosome mec (SCCmec). Antibiotics 2022, 11, 86. [Google Scholar] [CrossRef]
- Khamash, D.F.; Voskertchian, A.; Tamma, P.D.; Akinboyo, I.C.; Carroll, K.C.; Milstone, A.M. Increasing clindamycin and trimethoprim-sulfamethoxazole resistance in pediatric Staphylococcus aureus infections. J. Pediatr. Infect. Dis. Soc. 2019, 8, 351–353. [Google Scholar] [CrossRef]
- Ham, D.C.; Fike, L.; Wolford, H.; Lastinger, L.; Soe, M.; Baggs, J.; Walters, M.S. Trimethoprim-sulfamethoxazole resistance patterns among Staphylococcus aureus in the United States, 2012–2018. Infect. Control Hosp. Epidemiol. 2022, 1–4. [Google Scholar] [CrossRef]
- Xu, Z.; Xie, J.; Peters, B.M.; Li, B.; Li, L.; Yu, G.; Shirtliff, M.E. Longitudinal surveillance on antibiogram of important Gram-positive pathogens in Southern China, 2001 to 2015. Microb. Pathog. 2017, 103, 80–86. [Google Scholar] [CrossRef]
- Qiao, M.; Ying, G.G.; Singer, A.C.; Zhu, Y.G. Review of antibiotic resistance in China and its environment. Environ. Int. 2018, 110, 160–172. [Google Scholar] [CrossRef]
- Ahmad-Mansour, N.; Loubet, P.; Pouget, C.; Dunyach-Remy, C.; Sotto, A.; Lavigne, J.-P.; Molle, V. Staphylococcus aureus toxins: An update on their pathogenic properties and potential treatments. Toxins 2021, 13, 677. [Google Scholar] [CrossRef]
- Oliveira, D.; Borges, A.; Simões, M. Staphylococcus aureus toxins and their molecular activity in infectious diseases. Toxins 2018, 10, 252. [Google Scholar] [CrossRef]
- Ladhani, S.; Joannou, C.L.; Lochrie, D.P.; Evans, R.W.; Poston, S.M. Clinical, microbial, and biochemical aspects of the exfoliative toxins causing staphylococcal scalded-skin syndrome. Clin. Microbiol. Rev. 1999, 12, 224–242. [Google Scholar] [CrossRef]
- Vandenesch, F.; Naimi, T.; Enright, M.C.; Lina, G.; Nimmo, G.R.; Heffernan, H.; Liassine, N.; Bes, M.; Greenland, T.; Reverdy, M.-E. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: Worldwide emergence. Emerg. Infect. Dis. 2003, 9, 978. [Google Scholar] [CrossRef]
- Hitchins, A.D.; Feng, P.; Watkins, W.; Rippey, S.; Chandler, L. Bacteriological Analytical Manual; Food and Drug Administration: Washington, DC, USA, 1998. [Google Scholar]
- Weinstein, M.P. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olson-Liljequist, B.D.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2011, 18, 268–281. [Google Scholar] [CrossRef]
- Dinges, M.M.; Orwin, P.M.; Schlievert, P.M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 2000, 13, 16–34. [Google Scholar] [CrossRef]
- Fang, F.C.; McClelland, M.; Guiney, D.G.; Jackson, M.M.; Hartstein, A.I.; Morthland, V.H.; Davis, C.E.; McPherson, D.C.; Welsh, J. Value of molecular epidemiologic analysis in a nosocomial methicillin-resistant Staphylococcus aureus outbreak. JAMA 1993, 270, 1323–1328. [Google Scholar] [CrossRef]
- Kreiswirth, B.; Kornblum, J.; Arbeit, R.D.; Eisner, W.; Maslow, J.N.; McGeer, A.; Low, D.E.; Novick, R.P. Evidence for a clonal origin of methicillin resistance in Staphylococcus aureus. Science 1993, 259, 227–230. [Google Scholar] [CrossRef]
- Le Loir, Y.; Baron, F.; Gautier, M. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2003, 2, 63–76. [Google Scholar] [PubMed]
- Oliveira, D.C.; Lencastre, H.n.d. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2002, 46, 2155–2161. [Google Scholar] [CrossRef] [PubMed]
- Obayashi, Y.; Fujita, J.; Ichiyama, S.; Hojo, S.; Negayama, K.; Takashima, C.; Miyawaki, H.; Tanabe, T.; Yamaji, Y.; Kawanishi, K. Investigation of nosocomial infection caused by arbekacin-resistant, methicillin-resistant Staphylococcus aureus. Diagn. Microbiol. Infect. Dis. 1997, 28, 53–59. [Google Scholar] [CrossRef] [PubMed]
- van BELKUM, A.; Kluytmans, J.; van LEEUWEN, W.; Bax, R.; Quint, W.; Peters, E.; Fluit, A.; Vandenbroucke-Grauls, C.; Van den Brule, A.; Koeleman, H. Multicenter evaluation of arbitrarily primed PCR for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 1995, 33, 1537–1547. [Google Scholar] [CrossRef] [PubMed]
- Miao, J.; Chen, L.; Wang, J.; Wang, W.; Chen, D.; Li, L.; Li, B.; Deng, Y.; Xu, Z. Evaluation and application of molecular genotyping on nosocomial pathogen-methicillin-resistant Staphylococcus aureus isolates in Guangzhou representative of Southern China. Microb. Pathog. 2017, 107, 397–403. [Google Scholar] [CrossRef]
- Boye, K.; Bartels, M.; Andersen, I.; Møller, J.; Westh, H. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I–V. Clin. Microbiol. Infect. 2007, 13, 725–727. [Google Scholar] [CrossRef]
- Deplano, A.; De Mendonça, R.; De Ryck, R.; Struelens, M. External quality assessment of molecular typing of Staphylococcus aureus isolates by a network of laboratories. J. Clin. Microbiol. 2006, 44, 3236–3244. [Google Scholar] [CrossRef]
- Shopsin, B.; Gomez, M.; Montgomery, S.; Smith, D.; Waddington, M.; Dodge, D.; Bost, D.; Riehman, M.; Naidich, S.; Kreiswirth, B. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 1999, 37, 3556–3563. [Google Scholar] [CrossRef]
- Hallin, M.; Deplano, A.; Denis, O.; De Mendonça, R.; De Ryck, R.; Struelens, M. Validation of pulsed-field gel electrophoresis and spa typing for long-term, nationwide epidemiological surveillance studies of Staphylococcus aureus infections. J. Clin. Microbiol. 2007, 45, 127–133. [Google Scholar] [CrossRef] [Green Version]
Table 1.
Distribution of S. aureus isolated from different clinical samples.
| Isolation Source | Strain Amount | Percentage * | |
|---|---|---|---|
| Department | Internal medicine | 158 | 30.15% |
| ICU | 42 | 8.02% | |
| Orthopedic | 52 | 9.92% | |
| urology | 47 | 8.97% | |
| Neurology | 37 | 7.06% | |
| Surgery | 32 | 6.11% | |
| Pediatrics | 16 | 3.05% | |
| Obstetrics and Gynecology | 4 | 0.76% | |
| Other | 136 | 25.95% | |
| Infection site | Sputum | 269 | 51.34% |
| Pus | 39 | 7.44% | |
| Urinary tract | 37 | 7.06% | |
| Bloodstream | 29 | 5.53% | |
| Wound | 27 | 5.15% | |
| Respiratory tract | 10 | 1.91% | |
| Other | 113 | 21.56% | |
| Age | The old | 272 | 51.91% |
| The young and the middle-aged | 217 | 41.41% | |
| Infant | 35 | 6.68% |
* The percentage was calculated by the amount of strains in each isolation source divided by the total amount of strains. There is overlap among isolation sources in the department, infection site, and age.
Table 2.
Antimicrobial susceptibility, carriage of virulence genes, and SCCmec types of S. aureus isolates.
Table 2.
Antimicrobial susceptibility, carriage of virulence genes, and SCCmec types of S. aureus isolates.
| 2009 (n = 25) | 2010 (n = 23) | 2011 (n = 104) | 2012 (n = 115) | 2013 (n = 81) | 2014 (n = 121) | 2015 (n = 51) | Total | ||
|---|---|---|---|---|---|---|---|---|---|
| SCCmec * | I | 0 | 0 | 0 | 1 | 3 | 1 | 7 | 12 |
| IA | 0 | 0 | 0 | 1 | 3 | 1 | 2 | 7 | |
| II | 1 a | 2 ab | 18 a | 24 a | 16 a | 21 a | 9 a | 91 | |
| III | 18 d | 12 f | 54 a | 53 b | 16 e | 29 c | 8 f | 190 | |
| IIIA | 1 b | 0 b | 9 a | 6 b | 7 ab | 15 a | 7 a | 45 | |
| IV | 2 b | 4 b | 8 b | 12 b | 15 a | 20 a | 7 b | 68 | |
| V | 0 b | 0 b | 1 b | 9 a | 4 ab | 3 ab | 1 ab | 18 | |
| VI | 1 b | 0 b | 4 b | 1 b | 7 a | 12 a | 6 a | 31 | |
| Others | 0 | 0 | 0 | 1 | 6 | 14 | 3 | 24 | |
| Toxins * | sea | 21 b | 22 b | 73 a | 71 a | 56 a | 79 a | 30 a | 352 |
| seb | 9 d | 3 e | 28 c | 32 c | 37 b | 39 a | 23 d | 171 | |
| sec | 2 b | 5 b | 22 b | 52 a | 47 a | 62 a | 32 a | 222 | |
| sed | 0 b | 0 b | 2 b | 8 a | 0 b | 0 b | 0 b | 10 | |
| see | 14 d | 17 b | 53 a | 49 a | 2 e | 16 c | 11 e | 186 | |
| eta | 0 c | 1 c | 8 c | 9 c | 15 b | 31 a | 15 b | 79 | |
| etb | 3 c | 9 b | 16 a | 13 a | 1 c | 6 c | 1 c | 49 | |
| pvl | 2 d | 13 b | 25 a | 21 a | 3 d | 2 d | 10 c | 76 | |
| tsst | 0 e | 7 d | 8 d | 17 d | 43 a | 41 b | 30 c | 146 | |
| Antibiotic resistance # | oxacillin | 10 b | 19 b | 96 a | 103 a | 68 b | 93 b | 45 b | 434 |
| trimethoprim/ sulfamethoxazole | 3 c | 11 c | 8 c | 14 c | 34 b | 109 a | 48 b | 227 | |
| erythromycin | 23 a | 23 a | 90 a | 90 a | 49 a | 87 a | 39 a | 401 | |
| ciprofloxacin | 23 c | 21 c | 87 a | 91 a | 54 b | 78 b | 34 b | 388 | |
| rifampin | 14 c | 9 d | 27 b | 30 b | 40 a | 33 b | 12 d | 165 | |
| moxifloxacin | 23 b | 15 c | 71 a | 81 a | 53 a | 76 a | 34 a | 353 | |
| penicillin | 20 c | 21 c | 78 a | 69 a | 46 b | 64 a | 30 b | 328 | |
| tetracycline | 17 d | 12 d | 81 a | 37 b | 36 c | 68 b | 35 d | 286 | |
| levofloxacin | 6 b | 12 b | 87 a | 91 a | 53 b | 78 b | 34 b | 361 | |
| clindamycin | 17 e | 23 d | 86 a | 71 b | 43 c | 66 c | 29 c | 335 |
* The amount of S. aureus isolates identified to be positive for each SCCmec types (I, IA, II, III, IIIA, IV, V, VI, and Others) and virulence factors (sea, seb, sec, sed, see, eta, etb, pvl, and tsst) in each year were listed, with total amount of isolates in the rightmost column. # The amount of S. aureus isolates resistance to each antibiotic (oxacillin, trimethoprim/sulfamethoxazole, erythromycin, ciprofloxacin, rifampin, moxifloxacin, penicillin, tetracycline, levofloxacin, and clindamycin) in each year were listed. The data were adapted to chi-square test between years and the superscripted “abcde” in the table is the significant difference letter marking method. (Arrange all the averages from large to small, label the largest average with the letter “a”, subtract that average from the following to obtain the range, and label any range less than 0.05 with the letter “a”, until the range is greater than or equal to 0.05, or a significant difference from an average, the average is superscript with the letter “b”, and the average labeled “b” is used as the criterion, compared with the above average which is larger than it, any difference which is not significant is marked with the letter “b”, and the maximum average marked with “b” is used as the standard, compared with the unmarked average below, those that are not significantly different continue to be labeled with the letter “b” until an average that is significantly different is labeled with the letter “c”. The comparisons are repeated until the smallest average has a marked letter).
Table 3.
Genotypes of S. aureus isolated.
| Genotypes | 2009 | 2010 | 2011 | 2012 | 2013 | 2014 | 2015 | Total |
|---|---|---|---|---|---|---|---|---|
| ST239-t037 | 11 | 6 | 60 | 42 | 9 | 10 | 3 | 141 |
| ST239-t030 | 5 | 3 | 16 | 13 | 15 | 26 | 15 | 93 |
| ST239-t1081 | 4 | 2 | 4 | 11 | 2 | 2 | 0 | 25 |
| ST59-t437 | 1 | 0 | 4 | 6 | 2 | 2 | 0 | 15 |
| ST5-t002 | 0 | 0 | 5 | 2 | 0 | 2 | 0 | 9 |
| ST546-t1081 | 0 | 4 | 3 | 3 | 0 | 0 | 0 | 10 |
| ST45-t1081 | 1 | 0 | 5 | 2 | 0 | 0 | 0 | 8 |
| ST1-t4084 | 0 | 0 | 0 | 0 | 1 | 7 | 0 | 8 |
| ST5-t030 | 0 | 1 | 1 | 5 | 0 | 0 | 0 | 7 |
| ST5-t1084 | 0 | 0 | 0 | 0 | 0 | 1 | 5 | 6 |
| ST45-t037 | 0 | 0 | 1 | 2 | 1 | 1 | 1 | 6 |
| ST1357-t030 | 0 | 0 | 0 | 0 | 0 | 5 | 1 | 6 |
| ST188-t6367 | 0 | 0 | 0 | 0 | 4 | 1 | 0 | 5 |
| ST2139-t189 | 0 | 0 | 0 | 0 | 0 | 2 | 2 | 4 |
| ST238-t030 | 0 | 0 | 0 | 0 | 3 | 1 | 0 | 4 |
| ST366-t437 | 0 | 0 | 0 | 0 | 0 | 2 | 2 | 4 |
| ST5-t037 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 3 |
| ST585-t030 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 2 |
| ST188-t189 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 2 |
| ST1-t114 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 2 |
| ST1057-t002 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 2 |
| Others | 3 | 7 | 4 | 26 | 39 | 44 | 19 | 142 |
The amount of S. aureus isolates identified in each genotype (MLST-spa) in each year were listed.
Table 4.
Relatedness among SCCmec, virulence, and genotypes of clinical S. aureus.
| Virulence Associated Genes | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Sea | Seb | Sec | Sed | See | eta | etb | tsst | pvl | |||||||||||
| SCCmec | I/IA | 17 */19 # | 89.5% a | 17/19 | 89.5% a | 12/19 | 63.2% a | 12/19 | 63.2% a | 13/19 | 68.4% a | 12/19 | 63.2% a | 7/19 | 36.8% a | 0/19 | 0.0% b | 5/19 | 26.3% ab |
| II | 54/91 | 59.3% c | 28/91 | 30.8% b | 58/91 | 63.7% a | 2/91 | 2.2% b | 21/91 | 23.1% c | 11/88 | 12.5% b | 11/88 | 12.5% b | 26/88 | 29.5% a | 28/88 | 31.8% a | |
| III/IIIA | 181/237 | 76.4% b | 69/237 | 29.1% b | 77/237 | 32.5% b | 6/237 | 2.5% b | 121/237 | 51.1% b | 39/236 | 16.5% b | 21/236 | 8.9% b | 26/236 | 11.0% b | 49/236 | 20.8% b | |
| IV | 45/68 | 66.2% bc | 27/68 | 39.7% b | 37/68 | 54.4% a | 2/68 | 2.9% b | 16/68 | 23.5% c | 12/68 | 17.6% b | 5/68 | 7.4% b | 14/68 | 20.6% a | 29/68 | 42.6% a | |
| V | 11/18 | 61.1% bc | 4/18 | 22.2% b | 5/18 | 27.8% b | 0/18 | 0.0% b | 2/18 | 11.1% cd | 1/17 | 5.9% b | 3/17 | 17.6% b | 0/17 | 0.0% b | 4/17 | 23.5% ab | |
| VI | 15/31 | 48.4% c | 7/31 | 22.6% b | 10/31 | 32.3% b | 0/31 | 0.0% b | 2/31 | 6.5% d | 3/31 | 9.7% b | 5/31 | 16.1% b | 3/31 | 9.7% b | 9/31 | 29.0% a | |
| ST types | ST239 | 222/305 | 72.8% a | 86/305 | 28.2% b | 107/305 | 35.1% a | 4/305 | 1.3% b | 140/305 | 45.9% b | 40/301 | 13.3% b | 35/301 | 11.6% ab | 47/301 | 15.6% b | 69/301 | 22.9% b |
| ST5 | 20/42 | 47.6% a | 14/42 | 33.3% ab | 20/42 | 47.6% a | 2/42 | 4.8% ab | 10/42 | 23.8% c | 6/40 | 15.0% ab | 1/40 | 2.5% b | 10/40 | 25.0% b | 6/40 | 15.0% b | |
| ST45 | 27/35 | 77.1% a | 13/35 | 37.1% ab | 11/35 | 31.4% a | 1/35 | 2.9% ab | 9/35 | 25.7% c | 5/33 | 15.2% ab | 6/33 | 18.2% a | 3/33 | 9.1% b | 10/33 | 30.3% ab | |
| ST59 | 11/25 | 44.0% a | 11/25 | 44.0% ab | 15/25 | 60.0% a | 3/25 | 12.0% a | 7/25 | 28.0% bc | 4/24 | 16.7% ab | 2/24 | 8.3% ab | 3/24 | 12.5% b | 10/24 | 41.7% a | |
| ST546 | 8/10 | 80.0% a | 3/10 | 30.0% ab | 5/10 | 50.0% a | 0/10 | 0.0% b | 8/10 | 80.0% a | 0/10 | 0.0% b | 2/10 | 20.0% a | 6/10 | 60.0% a | 2/10 | 20.0% b | |
| ST366 | 5/8 | 62.5% a | 0/8 | 0.0% b | 5/8 | 62.5% a | 0/8 | 0.0% b | 0/8 | 0.0% c | 2/8 | 25.0% ab | 0/8 | 0.0% b | 1/8 | 12.5% b | 5/8 | 62.5% a | |
| ST1 | 6/10 | 60.0% a | 6/10 | 60.0% a | 3/10 | 30.0% a | 0/10 | 0.0% b | 1/10 | 10.0% c | 4/10 | 40.0% a | 0/10 | 0.0% b | 0/10 | 0.0% b | 4/10 | 40.0% ab | |
| ST188 | 4/9 | 44.4% a | 6/9 | 66.7% a | 4/9 | 44.4% a | 0/9 | 0.0% b | 1/9 | 11.1% c | 0/9 | 0.0% b | 1/9 | 11.1% ab | 1/9 | 11.1% b | 4/9 | 44.4% a | |
| spa types | t030 | 81/124 | 65.3% b | 33/124 | 26.6% a | 56/124 | 45.2% ab | 1/124 | 0.8% b | 36/124 | 29.0% b | 23/121 | 19.0% a | 5/121 | 4.1% b | 9/121 | 7.4% b | 29/121 | 24.0% ab |
| t037 | 131/179 | 73.2% ab | 55/179 | 30.7% a | 55/179 | 30.7% b | 2/179 | 1.1% b | 96/179 | 53.6% a | 17/177 | 9.6% b | 24/177 | 13.6% a | 32/177 | 18.1% a | 38/177 | 21.5% b | |
| t437 | 14/27 | 51.9% b | 8/27 | 29.6% a | 12/27 | 44.4% ab | 1/27 | 3.7% ab | 5/27 | 18.5% ab | 2/27 | 7.4% b | 1/27 | 3.7% b | 8/27 | 29.6% a | 4/27 | 14.8% b | |
| t1081 | 55/68 | 80.9% a | 18/68 | 26.5% a | 23/68 | 33.8% b | 3/68 | 4.4% ab | 30/68 | 44.1% a | 8/65 | 12.3% ab | 14/65 | 21.5% a | 16/65 | 24.6% a | 17/65 | 26.2% ab | |
| t002 | 13/27 | 48.1% b | 9/27 | 33.3% a | 16/27 | 59.3% a | 3/27 | 11.1% a | 6/27 | 22.2% b | 6/27 | 22.2% a | 2/27 | 7.4% ab | 4/27 | 14.8% ab | 11/27 | 40.7% a | |
* The numbers represent the amount of strains positive for each virulence associated gene (sea, seb, sec, sed, see, eta, etb, pvl, and tsst) in the first line and the genotypes (SCCmec, ST type, spa type) at the first column. # The numbers represent the total amount of strains in each SCCmec (I, IA, II, III, IIIA, IV, V, VI, and Others), ST (ST239, ST5, ST45, ST59, ST546, ST366, ST1, ST188) or spa (t030, t037, t437, t1081,t002) type. The data were adapted to chi-square test and the superscripted “abcd” in the table is the significant difference letter marking method analysis result.
Table 5.
Primers used in this study.
| Primer Name | Sequence (5′-3′) | Target | Amplicon (bp) | Tm (°C) |
|---|---|---|---|---|
| C1 | GATGAGTGCTAAGTGTTAGG | 16S rRNA | 542 | 55 |
| C2 | TCTACGATTACTAGCGATTC | |||
| F1 | AAAGCTTGCTGAAGGTTATG | femA | 823 | |
| F2 | TTCTTCTTGTAGACGTTTAC | |||
| M1 | GGCATCGTTCCAAAGAATGT | mecA | 374 | |
| M2 | CCATCTTCATGTTGGAGCTTT | |||
| O1 | ACCACAATCMACAGTCAT | orf-X | 212 | 48 |
| O2 | CCCGCATCATTTGATGTG | |||
| ccrB | ATTGCCTTGATAATAGCCITCT | ccrAB1 | 700 | 48 |
| ccrA1 | AACCTATATCATCAATCAGTACGT | |||
| ccrB | ATTGCCTTGATAATAGCCITCT | ccrAB2 | 1000 | |
| ccrA2 | TAAAGGCATCAATGCACAAACACT | |||
| ccrB | ATTGCCTTGATAATAGCCITCT | ccrAB3 | 1600 | |
| ccrA3 | AGCTCAAAAGCAAGCAATAGAAT | |||
| ccrA4-F | ATGGGATAAGAGAAAAAGCC | ccrAB4 | 1400 | |
| ccrB4-R | TAATTTACCTTCGTTGGCAT | |||
| ccrC-F | ATGAATTCAAAGAGCATGGC | ccrC | 520 | |
| ccrC-R | GATTTAGAATTGTCGTGATTGC | |||
| mI4 | CAAGTGAATTGAAACCGCCT | mecI-mecR1 | 1800 | 50 |
| mcR3 | GTCTCCACGTTAATTCCATT | |||
| IS5 | AACGCCACTCATAACATATGGAA | IS1272-mecA | 2000 | 52 |
| mA6 | TATACCAAACCCGACAAC | |||
| mA2 | AACGTTGTAACCACCCCAAGA | IS431-mecI-mecA | 2000 | 53 |
| IS2 | TGAGGTTATTCAGATATTTCGATGT | |||
| IS431-P4 | CAGGTCTCTTCAGATCTACG | pUB110 | 381 | 55 |
| pUB110 R1 | GAGCCATAAACACCAATAGCC | |||
| IS431-P4 | CAGGTCTCTTCAGATCTACG | pT181 | 303 | 52 |
| PT181 R1 | GAAGAATGGGGAAAGCTTCAC | |||
| AP1 | GGTTGGGTGAGAATTGCACG | Random | 38 | |
| AP7 | GTGGATGCGA | 45 | ||
| ERIC2 | AAGTAAGTGACTGGGGTGAGCG | 45 | ||
| arcC-Up | TTGATTCACCAGCGCGTATTGTC | arcC | 456 | 55 |
| arcC-Dn | AGGTATCTGCTTCAATCAGCG | |||
| aroE-Up | ATCGGAAATCCTATTTCACATTC | aroE | 456 | 55 |
| aroE-Dn | GGTGTTGTATTAATAACGATATC | |||
| glpF-Up | CTAGGAACTGCAATCTTAATCC | glpF | 465 | 55 |
| glpF-Dn | TGGTAAAATCGCATGTCCAATTC | |||
| gmk-Up | ATCGTTTTATCGGGACCATC | gmk | 417 | 55 |
| gmk-Dn | TCATTAACTACAACGTAATCGTA | |||
| pta-Up | GTTAAAATCGTATTACCTGAAGG | pta | 474 | 55 |
| pta-Dn | GACCCTTTTGTTGAAAAGCTTAA | |||
| tpi-Up | TCGTTCATTCTGAACGTCGTGAA | tpi | 402 | 55 |
| tpi-Dn | TTTGCACCTTCTAACAATTGTAC | |||
| yqiL-Up | CAGCATACAGGACACCTATTGGC | yqiL | 516 | 55 |
| yqiL-Dn | CGTTGAGGAATCGATACTGGAAC | |||
| spa-Up | GTAAAACGACGGCCAGTGCTAAAAAGCTAAACGATGC | spa | 260 | 60 |
| spa-Dn | CAGGAAACAGCTATGACCCCACCAAATACAGTTGTACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Liu, J.; Huang, T.; Soteyome, T.; Miao, J.; Yu, G.; Chen, D.; Ye, C.; Yang, L.; Xu, Z. Antimicrobial Resistance, SCCmec, Virulence and Genotypes of MRSA in Southern China for 7 Years: Filling the Gap of Molecular Epidemiology. Antibiotics 2023, 12, 368. https://doi.org/10.3390/antibiotics12020368
AMA Style
Liu J, Huang T, Soteyome T, Miao J, Yu G, Chen D, Ye C, Yang L, Xu Z. Antimicrobial Resistance, SCCmec, Virulence and Genotypes of MRSA in Southern China for 7 Years: Filling the Gap of Molecular Epidemiology. Antibiotics. 2023; 12(2):368. https://doi.org/10.3390/antibiotics12020368
Chicago/Turabian StyleLiu, Junyan, Tengyi Huang, Thanapop Soteyome, Jian Miao, Guangchao Yu, Dingqiang Chen, Congxiu Ye, Ling Yang, and Zhenbo Xu. 2023. "Antimicrobial Resistance, SCCmec, Virulence and Genotypes of MRSA in Southern China for 7 Years: Filling the Gap of Molecular Epidemiology" Antibiotics 12, no. 2: 368. https://doi.org/10.3390/antibiotics12020368
APA StyleLiu, J., Huang, T., Soteyome, T., Miao, J., Yu, G., Chen, D., Ye, C., Yang, L., & Xu, Z. (2023). Antimicrobial Resistance, SCCmec, Virulence and Genotypes of MRSA in Southern China for 7 Years: Filling the Gap of Molecular Epidemiology. Antibiotics, 12(2), 368. https://doi.org/10.3390/antibiotics12020368
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
