Next Article in Journal
Epidemiological Characteristics and Antimicrobial Resistance Changes of Carbapenem-Resistant Klebsiella pneumoniae and Acinetobacter baumannii under the COVID-19 Outbreak: An Interrupted Time Series Analysis in a Large Teaching Hospital
Previous Article in Journal
Effect of Antibiotic Compared to Non-Antibiotic Dry Cow Treatment on the Bacteriological Cure of Intramammary Infections during the Dry Period—A Retrospective Cross-Sectional Study
Previous Article in Special Issue
Characteristics of tet(X4)−Producing Escherichia coli in Chicken and Pig Farms in Hunan Province, China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 3
10.3390/antibiotics12030430
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Recent Trends of Antibiotic Resistance in Staphylococcus aureus Causing Clinical Mastitis in Dairy Herds in Abruzzo and Molise Regions, Italy

by
Franca Rossi
1,*,
Ilaria Del Matto
1,
Maria Antonietta Saletti
2,
Luciano Ricchiuti
2,
Patrizia Tucci
1 and
Lucio Marino
1
1
Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise, Sezione di Campobasso, 86100 Campobasso, Italy
2
Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise, Sezione di Lanciano, 66034 Lanciano, Italy
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(3), 430; https://doi.org/10.3390/antibiotics12030430
Submission received: 23 January 2023 / Revised: 15 February 2023 / Accepted: 20 February 2023 / Published: 21 February 2023
(This article belongs to the Special Issue Antimicrobial Use and Antimicrobial Resistance in Food Animals)
Browse Figures
Versions Notes

Abstract

:
This study aimed to investigate the recent trends of antibiotic resistance (AR) prevalence in Staphylococcus aureus isolated from the milk of animals with clinical mastitis in areas of the Abruzzo and Molise regions in Central Italy. Fifty-four S. aureus isolates were obtained from routine testing for clinical mastitis agents carried out in the author institution in the years 2021 and 2022 and were analyzed for phenotypic resistance to eight antibiotics recommended for testing by European norms and belonging to the antibiotic classes used for mastitis treatment in milk-producing animals. Moreover, the presence of 14 transferable genetic determinants encoding resistance to the same antibiotics was analyzed using qPCR tests developed in this study. Phenotypic resistance to non-β-lactams was infrequent, with only one 2022 isolate resistant to clindamycin. However, resistance to the β-lactam cefoxitin at concentrations just above the threshold of 4 µg/mL was observed in 59.2% of isolates in both years, making these isolates classifiable as methicillin-resistant. The AR genotypes detected were the blaZ gene (50% of 2021 isolates and 44.4% of 2022 isolates), aphA3-blaZ- ermC/T (one 2021 isolate), aphA3-ant6-blaZ-ermC/T (one 2021 isolate), blaZ-ermB (one 2022 isolate) and mecA-mph (one 2022 isolate). An inquiry into the veterinarians who provided the samples, regarding the antimicrobials prescribed for mastitis treatment and criteria of usage, indicated a possible causal relation with the AR test results. The occurrence of AR genotypes did not increase in time, most probably reflecting how mastitis was treated and prevented in farms. However, the frequently observed cefoxitin resistance needs to be explained genotypically, further monitored and limited by modifying antibiotic usage practices. The identification of a mecA-positive isolate in 2022 suggests further investigation if this genotype is emerging locally.

1. Introduction

Staphylococcus aureus is one of the main causative agents of mastitis in milk-producing animals and the first for clinical bovine mastitis with the ability to give causation to persistent intramammary infections [1]. This bacterial species is also a major human pathogen capable of causing food poisoning for the production of multiple heat-stable enterotoxins (SE), localized soft tissue or skin infections and systemic infections triggered by virulence factors comprising staphylococcal superantigens (SAgs) [2,3,4], cytotoxic proteins [5] and factors that favor colonization and immune evasion [6]. The emergence of antibiotic-resistant (AR) S. aureus strains, among which the methicillin-resistant Staphylococcus aureus (MRSA) are listed by the World Health Organization among the pathogens of “high priority” against which new antibiotics are urgently needed, worsens the threat to human health posed by this bacterial species, since MRSA cause infections with high mortality rates [7]. The transferable genetic element providing the MRSA phenotype is the chromosomal cassette mec (SCCmec) that most often carries the mecA or the mecC gene, and sometimes other rare homologues, encoding for additional penicillin-binding proteins (PBP2a) with reduced affinity for β-lactams plus genes for site-specific recombinases [8,9].
Use of antibiotics in the animal farming sector to treat conditions such as mastitis can cause MRSA that is transmissible to humans through raw milk and derived products [10]. Some risk factors have been identified for MRSA transmission in dairy farms, such as poor milking hygiene. However, the role of antimicrobial usage has been little investigated and only one study reported an increase in antibiotic minimum inhibitory concentration (MIC) values in the occurrence of AR genes tetK, tetM, and blaZ after enrofloxacin treatment of persistent mastitis in goats [11]. This study underlined the role of antimicrobial usage on the emergence of AR S. aureus strains.
Phylogenetic analysis based on multi-locus sequence typing (MLST) gives evidence that some S. aureus lineages are found both in human and animal hosts, in particular strains from bovine mastitis, as a consequence of transference from humans to animals and vice versa. Moreover, it was demonstrated that S. aureus has the capacity to switch hosts [12], therefore S. aureus with a resistance to antibiotics circulating among farm animals must be considered a threat to public health.
Analysis of the prevalence of antibiotic-resistant strains of S. aureus can indicate if risk factors that favor their increase in farms are active and allow for the adoption of measures to reduce the dissemination of the genetic determinants encoding resistance. Therefore, this study was undertaken to analyze the prevalence of AR S. aureus in farms by taking into account isolates from the milk of animals affected by clinical mastitis and requiring antibiotic treatment. The study was carried out in areas of the Abruzzo and Molise regions in Central Italy, and aspects of mastitis management in the sampled farms were taken into account to understand if these can be linked by a causal relation to phenotypic and genotypic AR prevalence.

2. Results

2.1. Rate of Mastitis Caused by S. aureus in 2021 and 2022

The number of farms with clinical mastitis caused by S. aureus were 16 among 56 analyzed in 2021 and 13 among 52 analyzed in 2022, accounting for 28.5% and 25% of mastitis outbreaks, respectively. More than one isolate was obtained from the same sample if colonies were of a different dimension and appearance, and hemolysis halo aspects were observed on the blood agar, and this led to obtaining 27 strains per year.

2.2. Phenotypic AR of S. aureus Isolates

In this study, isolates with cefoxitin MIC 6–8 µg/mL accounted for 59.2% of isolates in both years. According to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) indications, these isolates are resistant to this antibiotic, though at low levels, and must be considered methicillin-resistant [13]. However, all of them were sensitive to oxacillin. The percentages of isolates assigned to groups with different cefoxitin MIC values in the years 2021 and 2022 are shown in Figure 1.
The distributions of the S. aureus isolates in different cefoxitin MIC groups in the two years were highly correlated (r = 0.99), thus indicating that there was very little variation in the percentage of isolates with a given cefoxitin resistance level in the investigation period.
The distribution of MIC values for all antibiotics tested in the two years is shown in Figure 2.
The MIC distributions for S. aureus isolates between the years 2021 and 2022 were not significantly different for any of the antibiotics considered. However, it can be noted that MICs for norfloxacin showed a shift to higher values in 2022, though resistance was not detected using the disc diffusion assay. According to the MIC values, all the isolates were susceptible to oxacillin, norfloxacin, erythomycin, gentamicin, kanamycin, tobramycin and clindamycin, except for one isolate that was resistant to the latter antibiotic.

2.3. Occurrence of AR Genes in the S. aureus Isolates

The AR genes sought in this study were those encoding resistance to the antibiotics of interest and found most frequently in S. aureus, as deduced from the consultation of the sequence databases. In addition, the cfr gene was sought in this study since it codes for a 23S rRNA methyltransferase that provides resistance to different antibiotic classes, among which are lincosamides and phenicols [14]. The primer/probe systems used are reported in Table 1.
For the ermC/ermT genes and for the mecA/mecC genes, a unique primer/probe system was designed in order to merge the diagnostic tests. A mecA-specific test was carried out on the sole mecA/C positive isolate to identify the mec gene homolog, which was then identified as mecA.
The AR gene detected in this study and the phenotypic AR for each isolate are reported in Table 2.
The blaZ gene occurrence was frequent and found in 59.2% of 2021 isolates and in 48.1% of 2022 isolates. Differences in the occurrence of this gene between the two years were not statistically significant according to the Student’s t test. None of the isolates overexpressed blaZ to levels determining a borderline oxacillin resistant S. aureus (BORSA) phenotype [13].
Only a few genetic determinants beyond blaZ were identified in the isolates studied here. In particular, the mecA gene was found only in isolate six from 2022 (Table 2), which was resistant to cefoxitin (MIC 6 µg/mL) but sensitive to oxacillin, though the MIC value (2 µg/mL) was equal to the cut-off value above which S. aureus strains must be considered resistant [13].
Other AR genes occurring in the S. aureus isolates examined, namely aph3, ant6, ermB, ermC/T and mph, with the exception of ermB which was detected in a 2022 isolate harboring only this gene, were found mostly in association with other AR determinants. In particular, MDR genotypes ant6-aph3-blaZ-ermC/T and aph3-blaZ-ermC/T were each found in one 2021 isolate (Table 2).
The gene mph for resistance to macrolides was found in the sole mecA-positive strain. This strain was also resistant to clindamycin, possibly for the presence of a genetic determinant different from the genes lnuB and cfr, tested in this study.

2.4. Evaluation of Antibiotic Management via Veterinarian Interview

In order to understand if the results of AR screenings might be linked with a causal relation to the antibiotic usage practices adopted locally, the 18 veterinarians providing medical care to the sampled farms were interviewed via a questionnaire regarding the antibiotics used, farm hygiene and the criteria adopted for decisions surrounding antibiotic use in clinical mastitis. The results of the interviews are presented in Table 3.
It is possible to observe that all the antibiotic classes allowed for mastitis treatment were used; however, penicillins, cephalosporins and enrofloxacin prevailed.
Hygiene in the farms was considered good or acceptable in most cases, and the milking hygiene was found to be adequate in all instances. However, four veterinarians observed insufficient mastitis prevention measures in some farms. In addition, most farms were found to adopt adequate mastitis prevention measures and protocols for antibiotic usage. However, four veterinarians reported inadequate mastitis prevention measures in the farms, and these were the same veterinarians who also reported antibiotic treatment failure. Fourteen veterinarians defined farm and milking hygiene and mastitis prevention management good or adequate. Nevertheless, they reported cases of recidivating mastitis. Management of the total bacterial and somatic cell counts in bulk tank milk was referred to be good or adequate, thus showing little concern for the occurrence of subclinical mastitis.
Half of the interviewed veterinarians declared to be committed to the reduction of antibiotic usage and all of them declared to use antibiotics based on the antibiogram outcomes for the specific pathogens. Notably, all veterinarians observed cases of AR, though most of them defined those cases as rare.

3. Discussion

The AR genes sought in this study were those encoding resistance to the antibiotic classes used for mastitis therapy in dairy herds in the area of interest and found most frequently in S. aureus, as deduced from consultation of the sequence databases and from a recent survey on identity and the frequency of AR genes in 29,679 genomes of S. aureus isolated worldwide [16]. The qPCR technique was introduced in this study for some of the AR genes for which only end point PCR tests were available because they are more rapid, specific and sensitive. The design of new tests for genes for which qPCR tests were already described [17,18,19] was decided to ensure specificity for S. aureus after the BLASTn alignment of sequences available for the species in the public domain database. Oligonucleotides were designed to match all gene variants retrieved. In particular, for the blaZ and the mecA genes, qPCR tests were previously reported as primer/probe systems were redesigned in this study after the alignment via BLASTn of one thousand sequences for each gene. Therefore, the results can be considered comparable to those of former investigations carried out with different primer/probe systems. In addition, unique primer/probe systems were designed in this study to detect couples of genes with sequence similarity, i.e., ermC/ermT and mecA/mecC, to reduce the number of tests necessary to identify isolates with transferable AR genotypes.
The classes of β-lactams and fluoroquinolones prevailed among the antibiotics prescribed by veterinarians, and this could explain the high prevalence of strains harboring blaZ genes and the increase in norfloxacin MIC values in 2022. In investigations carried out in different countries, the blaZ gene was found at high frequencies as well, with a maximum of 95.7% [20]. The increase in norfloxacin MIC values could be indicative of an increase in resistance to quinolones that in S. aureus is mediated by the core gene norA, encoding different variants of an efflux pump, as well as other efflux systems [14]. These are increasingly expressed under antimicrobial pressure and can lead to the emergence of resistant phenotypes [21,22].
The isolation of only one strain harboring the mecA gene indicated a frequency lower than that reported in other studies [23,24,25,26] but similar to that reported in Southern Italy for the bulk tank milk of small ruminants [27], thus indicating that its prevalence can vary on a local basis. The mecA-positive strain was not resistant to oxacillin, showing an MIC equal to the S. aureus epidemiological cut-off (ECOFF) for this antibiotic. The occurrence of mecA-positive and oxacillin-sensitive strains was reported recently [28].
The percentage of isolates resistant to cefoxitin observed in this study was among the highest reported for European countries [29]. According to the EUCAST AST guidelines, S. aureus strains resistant to cefoxitin have an MIC > 4 µg/mL, a value that coincides with the ECOFF of the species for cefoxitin, and in most cases they harbor a mecA or mecC gene [13]. However, in this study cefoxitin resistance was not associated with the presence of the mecA or the mecC gene, resulting in an example of a mec-independent β-lactam resistant phenotype. The occurrence of cefoxitin resistant isolates without the mec genetic determinants was described previously [30,31,32,33,34], and different genetic features were found to determine resistance only to cefoxitin with an MIC of 6 µg/mL, namely mutations in native pbp1, pbp2, pbp3 and pbp4 penicillin-binding protein genes, mutations in the pbp4 promoter and in gene gdpP for a phosphodiesterase c-di-AMP regulator [30]. Further investigations should be devoted to defining the genetic basis of cefoxitin resistance in the isolates examined in this study.
An increase in AR to clindamycin, erythromycin, gentamycin and oxacillin was not observed, though it was reported to occur globally for S. aureus strains, causing bovine mastitis or isolated from milk and dairy products [35,36]. In addition, a recent meta-analysis carried out in China suggested how the AR rate can be particularly high in some geographical contexts, suggesting local misuse of antibiotics [37]. Therefore, it can be hypothesized that the low frequency of phenotypic AR for some antibiotic classes observed in this study is a consequence of the low usage of those drugs, as corroborated by veterinarian’s statements. Nevertheless, isolates harboring AR genes encoding resistance to macrolides and aminoglycosides were identified in this study, though these were susceptible to the antibiotics for which resistance was encoded. Further experiments aimed at elucidating if those genes can be induced upon gradual exposure to antimicrobials should be carried out. Moreover, the occurrence of multiresistance-encoding mobile genetic elements should be investigated to assess the risk of MDR genotype dissemination.
According to the veterinarian statements, strains causing mastitis were isolated and tested via antibiogram only in the case of recidivating mastitis or in the case of treatment failure. This could imply that initial treatments were carried out without antibiogram execution, thus possibly leading to the selection of antibiotic resistant strains that become difficult to eradicate. Changes in this practice, together with improvements in mastitis management, could reduce the prevalence of AR S. aureus in farms. The answers of veterinarians to questions regarding hygiene in the farms, milking hygiene and mastitis prevention measures indicated good or acceptable levels in most cases. This might imply a low usage of antibiotics, since good farming practices reduce the occurrence of infections and need for antibiotic treatment [10]. On the other hand, the veterinarian’s statements indicated that clinical mastitis was recidivating and sometimes impossible to treat. This could be a consequence of antibiotic misusage, so the protocols of antibiotic usage adopted in farms need to be examined and, if necessary, revised to reduce the risk of AR bacteria selection.

4. Materials and Methods

4.1. Bacterial Strains and Culture Conditions

The bacterial strains used in this study were all isolates from mastitic milk samples analyzed upon the request of veterinarians by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise (IZSAM), Campobasso and Lanciano branches, for identification of the infectious agent and antibiogram execution. Strains phenotypically identified as S. aureus in routine analysis were obtained from 56 farms and 52 farms in 2021 and 2022, respectively. These were propagated by streaking on blood agar (10/L g tryptose, 10 g/L meat extract, 5 g/L NaCl, 15 g/L agar, 100 mL of defibrinated sheep blood added aseptically after autoclaving and cooling of the base medium) incubated in aerobic conditions at 37 °C for 24–48 h. Cell biomass from a colony isolated after two subsequent streaks on blood agar was used for each phenotypic or genotypic test. For long-term storage, the isolates were maintained in Microbank (Biolife Italiana, Milan, Italy) at −80 °C.

4.2. Phenotypic AR Testing

The antibiotics tested phenotypically, i.e., cefoxitin (FOX), clindamycin (CD), erythromycin (ERY), gentamicin (CN), kanamycin (KAN), norfloxacin (NOR), oxacillin (OXA) and tobramycin (TOB), were those of human usage belonging to the classes of antibiotics used for mastitis treatment and recommended for testing by the EUCAST to deduce resistance to antibiotic classes [13]. The minimum inhibitory concentration (MIC) values were determined by using the Liofilchem® MIC Test Strips (Liofilchem, Roseto degli Abruzzi, TE, Italy) according to the instructions. The MIC values were assigned in accordance with EUCAST guidelines on antimicrobial susceptibility testing (AST) [38]. For norfloxacin, resistance was defined by using discs with 10 µg of the antibiotic (Liofilchem) as recommended [13]. The reference to the ECOFF values [13] was used to define the position of the new isolates in the range of observed MIC values for the species S. aureus.

4.3. Quantitative PCR Primer Design

New qPCR tests for the transferable AR genes encoding resistance to the antibiotics tested were designed by searching and aligning sequences in the NCBI databases (https://www.ncbi.nlm.nih.gov/, accessed on 1 October 2022) and in the National Database of Antibiotic Resistant Organisms (NDARO, https://www.ncbi.nlm.nih.gov/pathogens/antimicrobial-resistance/, accessed on 2 October 2022). For each gene, a BLASTN analysis restricted to the S. aureus taxon was carried out in order to consider different variants to be aligned so as to design oligonucleotides targeting all of them. The primer/probe systems designed in this study are listed in Table 1 with respective target genes and amplicon dimensions. These were synthetized by Eurofins Genomics (Ebersberg, Germany).
The gene regions comprised between each pair of oligonucleotides, ranging in size between 130 and 246 bp, were synthetized upon request by GenScript Biotech (Rijswijk, The Netherlands) and delivered as pUC57 vector constructs to serve as positive controls in the qPCR runs.

4.4. DNA Extraction

DNA was extracted from one loopful biomass resuspended in 200 µL of Macherey Nagel T1 buffer (Carlo Erba, Cornaredo, MI, Italy) containing 100 mg of sterile 200 µm diameter glass beads in safe lock Eppendorf tubes (Eppendorf). The suspension was bead-beaten in a TissueLyser II (Qiagen Italia, Milan, Italy) at 30 hz for 2 min). Then 200 µL of Macherey Nagel B3 buffer (Carlo Erba) were added, and the extraction was continued according to the Macherey Nagel Nucleospin Tissue (Carlo Erba) protocol.

4.5. Quantitative PCR Conditions

The qPCR reactions were carried out in a QuantStudio 5 thermal cycler (Thermo Fisher Scientific, Rodano, MI, Italy). Identification of isolates at the species level was carried out as previously described via a nucA-targeted qPCR test [39]. For AR gene detection, a unique program suitable for all the primer/probe systems designed was used. This comprised initial denaturation at 94 °C for 5 min and 40 cycles of denaturation at 94 °C for 15 s and annealing at 51 °C for 30 s. The qPCR reaction of 20 µL volume comprised 10 µL of Takara Premix Ex Taq (Probe qPCR) (Diatech, Jesi, AN, Italy), 0.2 µM primers and probe, TaqMan Exogenous Internal Positive Control Reagents (Thermo Fisher Scientific) in the recommended concentration, 2 µL of DNA sample and Nuclease Free water (Thermo Fisher Scientific) added to the final volume. Four nanograms of a synthetic, positive control construction were used in the positive control reaction.

4.6. Veterinarian Questionnaire

The 18 veterinarians who requested the bacteriological examinations and antibiograms for mastitis diagnosis in the years 2021 and 2022 were interviewed to identify the antibiotic classes prescribed, the criteria adopted for antibiotic usage and different aspects of mastitis management in farms by delivering a questionnaire with closed ended questions.

4.7. Statistical Analyses

MIC values plots, Student’s t test evaluation of the distinctness of the MIC data series obtained in 2021 and 2022 and correlation analyses were carried out by using PAST 4.03 free statistical software downloaded from https://past.en.lo4d.com/windows (accessed on 23 December 2022). The data series were considered distinct for p < 0.05.

5. Conclusions

This study showed that the prevalence of both genotypic and phenotypic AR is currently low for non-β-lactam antibiotics and with no increasing trend in S. aureus isolates from the areas of Abruzzo and Molise considered. This is probably the consequence of the infrequent usage of those antibiotics, except for enrofloxacin, reported by the veterinarians interviewed. However, strains harboring β-lactam resistance blaZ genes, already known to be widespread in the species S. aureus, occurred frequently, probably for the preferential use of β-lactams in clinical mastitis therapy. Phenotypic resistance to cefoxitin in the mecA/C-negative isolates was frequent, and its genetic basis needs to be identified in order to understand the molecular bases behind the emergence of this phenotype. Moreover, the occurrence of one MRSA and two genotypically MDR isolates suggest that monitoring the presence of these AR profiles in dairy herds should be continued to understand if these genotypes tend to disseminate. This study was limited to clinical mastitis cases in which the causative agent was isolated for diagnostic and antibiotic treatment purposes. In addition to the characterization of S. aureus strains causing clinical mastitis, investigations should be undertaken for farms with suspected subclinical mastitis to isolate the causative strains and define their AR status. This could help to elucidate if AR genotypes can be spread by strains causing subclinical mastitis. Indeed, these strains are more likely to persist for long time in farms, thus representing a relevant risk of the transfer of AR determinants.

Author Contributions

Conceptualization, F.R. and I.D.M.; methodology, F.R., I.D.M., P.T. and M.A.S.; software, F.R.; validation, L.M. and L.R.; formal analysis, F.R., I.D.M., P.T. and M.A.S.; investigation, F.R.; data curation, F.R.; writing—original draft preparation, F.R.; writing—review and editing, L.R.; supervision, L.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data obtained in this study can made available by authors upon request.

Acknowledgments

The veterinarians participating to the interview are gratefully acknowledged.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zaatout, N.; Ayachi, A.; Kecha, M. Staphylococcus aureus persistence properties associated with bovine mastitis and alternative therapeutic modalities. J. Appl. Microbiol. 2020, 129, 1102–1119. [Google Scholar] [CrossRef] [PubMed]
  2. Tong, S.Y.C.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin. Microbiol. Rev. 2015, 28, 603–661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Hofer, U. Insights into the mechanism of superantigen. Nat. Rev. Microbiol. 2022, 20, 253. [Google Scholar] [CrossRef] [PubMed]
  4. Tuffs, S.W.; Goncheva, M.I.; Xu, S.X.; Craig, H.C.; Kasper, K.J.; Choi, J.; Flannagan, R.S.; Kerfoot, S.M.; Heinrichs, D.E.; McCormick, J.K. Superantigens promote Staphylococcus aureus bloodstream infection by eliciting pathogenic interferon-gamma production. Proc. Natl. Acad. Sci. USA 2022, 119, e2115987119. [Google Scholar] [CrossRef] [PubMed]
  5. Loffler, B.; Hussain, M.; Grundmeier, M.; Brück, M.; Holzinger, D.; Varga, G.; Roth, J.; Kahl, B.C.; Proctor, R.A.; Peters, G. Staphylococcus aureus Panton–Valentine leukocidin is a very potent cytotoxic factor for human neutrophils. PLoS Pathog. 2010, 6, e1000715. [Google Scholar] [CrossRef]
  6. Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef]
  7. World Health Organization. WHO Publishes List of Bacteria for Which New Antibiotics are Urgently Needed. 27 February 2017 News Release, Geneva. Available online: https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 27 December 2022).
  8. Liu, J.; Chen, D.; Peters, B.M.; Li, L.; Li, B.; Xu, Z.; Shirliff, M.E. Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus. Microb. Pathog. 2016, 101, 56–67. [Google Scholar] [CrossRef]
  9. Becker, K.; van Alen, S.; Idelevich, E.A.; Schleimer, N.; Seggewiß, J.; Mellmann, A.; Kaspar, U.; Peters, G. Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus. Emerg. Infect Dis. 2018, 24, 242–248. [Google Scholar] [CrossRef] [Green Version]
  10. Schnitt, A.; Tenhagen, B.A. Risk Factors for the Occurrence of Methicillin-Resistant Staphylococcus aureus in Dairy Herds: An Update. Foodborne Pathog. Dis. 2020, 17, 585–596. [Google Scholar] [CrossRef] [Green Version]
  11. Lima, M.C.; de Barros, M.; Scatamburlo, T.M.; Polveiro, R.C.; de Castro, L.K.; Guimarães, S.H.S.; da Costa, S.L.; da Costa, M.M.; Moreira, M.A.S. Profiles of Staphyloccocus aureus isolated from goat persistent mastitis before and after treatment with enrofloxacin. BMC Microbiol. 2020, 20, 127. [Google Scholar] [CrossRef]
  12. Shepheard, M.A.; Fleming, V.M.; Connor, T.R.; Corander, J.; Feil, E.J.; Fraser, C.; Hanage, W.P. Historical zoonoses and other changes in host tropism of Staphylococcus aureus, identified by phylogenetic analysis of a population dataset. PLoS ONE 2013, 8, e62369. [Google Scholar] [CrossRef] [Green Version]
  13. The European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 13.0. 2023. Available online: https://www.eucast.org/clinical_breakpoints (accessed on 11 January 2023).
  14. Wang, Y.; Zhang, W.; Wang, J.; Wu, C.; Shen, Z.; Fu, X.; Yan, Y.; Zhang, Q.; Schwarz, S.; Shen, J. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China. Antimicrob Agents Chemother 2012, 56, 1485–1490. [Google Scholar] [CrossRef] [Green Version]
  15. European Community. Regulation (EC) No 853/2004 of the European Parliament and of the Council of 29 April 2004 Laying Down Specific Hygiene Rules for Food of Animal Origin. Available online: https://www.legislation.gov.uk/eur/2004/853/contents# (accessed on 14 February 2023).
  16. Pennone, V.; Prieto, M.; Álvarez-Ordóñez, A.; Cobo-Diaz, J.F. Antimicrobial Resistance Genes Analysis of Publicly Available Staphylococcus aureus Genomes. Antibiotics 2022, 11, 1632. [Google Scholar] [CrossRef]
  17. Pereira, L.A.; Harnett, G.B.; Hodge, M.M.; Cattell, J.A.; Speers, D.J. Real-time PCR assay for detection of blaZ genes in Staphylococcus aureus clinical isolates. J. Clin. Microbiol. 2014, 52, 1259–1261. [Google Scholar] [CrossRef] [Green Version]
  18. Velasco, V.; Sherwood, J.S.; Rojas-García, P.P.; Logue, C.M. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) genes from selective enrichments from animals and retail meat. PLoS ONE 2014, 9, e97617. [Google Scholar] [CrossRef]
  19. Yang, D.; Heederik, D.J.J.; Scherpenisse, P.; Van Gompel, L.; Luiken, R.E.C.; Wadepohl, K.; Skarżyńska, M.; Van Heijnsbergen, E.; Wouters, I.M.; Greve, G.D.; et al. Antimicrobial resistance genes aph(3′)-III, erm(B), sul2 and tet(W) abundance in animal faeces, meat, production environments and human faeces in Europe. J. Antimicrob Chemother 2022, 77, 1883–1893. [Google Scholar] [CrossRef]
  20. Gajewska, J.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Occurrence and Characteristics of Staphylococcus aureus Strains along the Production Chain of Raw Milk Cheeses in Poland. Molecules 2022, 27, 6569. [Google Scholar] [CrossRef]
  21. Santos Costa, S.; Sobkowiak, B.; Parreira, R.; Edgeworth, J.D.; Viveiros, M.; Clark, T.G.; Couto, I. Genetic diversity of norA, coding for a main efflux pump of Staphylococcus aureus. Front. Genet. 2019, 9, 710. [Google Scholar] [CrossRef]
  22. Santos Costa, S.; Viveiros, M.; Rosato, A.E.; Melo-Cristino, J.; Couto, I. Impact of efflux in the development of multidrug resistance phenotypes in Staphylococcus aureus. BMC Microbiol. 2015, 15, 232. [Google Scholar]
  23. Titouche, Y.; Hakem, A.; Houali, K.; Meheut, T.; Vingadassalon, N.; Ruiz-Ripa, L.; Salmi, D.; Chergui, A.; Chenouf, N.; Hennekinne, J.A.; et al. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) ST8 in raw milk and traditional dairy products in the Tizi Ouzou area of Algeria. J. Dairy Sci. 2019, 102, 6876–6884. [Google Scholar] [CrossRef]
  24. Alghizzi, M.; Shami, A. The prevalence of Staphylococcus aureus and methicillin resistant Staphylococcus aureus in milk and dairy products in Riyadh, Saudi Arabia. Saudi J. Biol. Sci. 2021, 28, 7098–7104. [Google Scholar] [CrossRef] [PubMed]
  25. Shrestha, A.; Bhattarai, R.K.; Luitel, H.; Karki, S.; Basnet, H.B. Prevalence of methicillin-resistant Staphylococcus aureus and pattern of antimicrobial resistance in mastitis milk of cattle in Chitwan, Nepal. BMC Vet. Res. 2021, 17, 239. [Google Scholar] [CrossRef] [PubMed]
  26. Neelam; Jain, V.K.; Singh, M.; Joshi, V.G.; Chhabra, R.; Singh, K.; Rana, Y.S. Virulence and antimicrobial resistance gene profiles of Staphylococcus aureus associated with clinical mastitis in cattle. PLoS ONE 2022, 17, e0264762. [Google Scholar]
  27. Caruso, M.; Latorre, L.; Santagada, G.; Fraccalvieri, R.; Miccolupo, A.; Sottili, R.; Palazzo, L.; Parisi, A. Methicillin-resistant Staphylococcus aureus (MRSA) in sheep and goat bulk tank milk from Southern Italy. Small Rumin. Res. 2016, 135, 26–31. [Google Scholar] [CrossRef]
  28. Pardo, L.; Giudice, G.; Mota, M.I.; Gutiérrez, C.; Varela, A.; Algorta, G.; Seija, V.; Galiana, A.; Aguerrebere, P.; Klein, M.; et al. Phenotypic and genotypic characterization of oxacillin-susceptible and mecA positive Staphylococcus aureus strains isolated in Uruguay. Rev. Argent Microbiol. 2022, 54, 293–298. [Google Scholar] [PubMed]
  29. Naranjo-Lucena, A.; Slowey, R. Invited review: Antimicrobial resistance in bovine mastitis pathogens: A review of genetic determinants and prevalence of resistance in European countries. J. Dairy Sci. 2023, 106, 1–23. [Google Scholar] [CrossRef]
  30. Argudín, M.A.; Roisin, S.; Nienhaus, L.; Dodémont, M.; de Mendonça, R.; Nonhoff, C.; Deplano, A.; Denis, O. Genetic Diversity among Staphylococcus aureus Isolates Showing Oxacillin and/or Cefoxitin Resistance Not Linked to the Presence of mec Genes. Antimicrob Agents Chemother. 2018, 62, e00091-30. [Google Scholar] [CrossRef] [Green Version]
  31. Velasco, V.; Mallea, A.; Bonilla, A.M.; Campos, J.; Rojas-García, P. Antibiotic-resistance profile of Staphylococcus aureus strains in the pork supply chain. Chil. J. Agric. Anim. Sc. 2022, 38, 234–240. [Google Scholar] [CrossRef]
  32. Ba, X.; Kalmar, L.; Hadjirin, N.F.; Kerschner, H.; Apfalter, P.; Morgan, F.J.; Paterson, G.K.; Girvan, S.L.; Zhou, R.; Harrison, E.M.; et al. Truncation of GdpP mediates β-lactam resistance in clinical isolates of Staphylococcus aureus. J. Antimicrob Chemother. 2019, 74, 1182–1191. [Google Scholar] [CrossRef]
  33. Sommer, A.; Fuchs, S.; Layer, F.; Schaudinn, C.; Weber, R.E.; Richard, H.; Erdmann, M.B.; Laue, M.; Schuster, C.F.; Werner, G.; et al. Mutations in the gdpP gene are a clinically relevant mechanism for β-lactam resistance in meticillin-resistant Staphylococcus aureus lacking mec determinants. Microb. Genom. 2021, 7, 000623. [Google Scholar] [CrossRef]
  34. Sasaki, H.; Ishikawa, H.; Itoh, T.; Arano, M.; Hirata, K.; Ueshiba, H. Penicillin-Binding Proteins and Associated Protein Mutations Confer Oxacillin/Cefoxitin Tolerance in Borderline Oxacillin-Resistant Staphylococcus aureus. Microb Drug Resist. 2021, 27, 590–595. [Google Scholar] [CrossRef] [PubMed]
  35. Molineri, A.I.; Camussone, C.; Zbrun, M.V.; Suárez Archilla, G.; Cristiani, M.; Neder, V.; Calvinho, L.; Signorini, M. Antimicrobial resistance of Staphylococcus aureus isolated from bovine mastitis: Systematic review and meta-analysis. Prev. Vet. Med. 2021, 188, 105261. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, J.; Wang, J.; Jin, J.; Li, X.; Zhang, H.; Shi, X.; Zhao, C. Prevalence, antibiotic resistance, and enterotoxin genes of Staphylococcus aureus isolated from milk and dairy products worldwide: A systematic review and meta-analysis. Food Res. Int. 2022, 162, 111969. [Google Scholar] [CrossRef] [PubMed]
  37. Wang, K.; Cha, J.; Liu, K.; Deng, J.; Yang, B.; Xu, H.; Wang, J.; Zhang, L.; Gu, X.; Huang, C.; et al. The prevalence of bovine mastitis-associated Staphylococcus aureus in China and its antimicrobial resistance rate: A meta-analysis. Front. Vet. Sci. 2022, 9, 1006676. [Google Scholar] [CrossRef] [PubMed]
  38. Karatuna, O. Phenotypic Methods Used in Antimicrobial Susceptibility Testing. ICARS—ILRI Webinar Series. 1 December 2021. Available online: https://cgspace.cgiar.org/bitstream/handle/10568/119836/Phenotypic%20AST.pdf?sequence=1&isAllowed=y (accessed on 27 December 2022).
  39. Poli, A.; Guglielmini, E.; Sembeni, S.; Spiazzi, M.; Dellaglio, F.; Rossi, F.; Torriani, S. Detection of Staphylococcus aureus and enterotoxin genotype diversity in Monte Veronese, a Protected Designation of Origin Italian cheese. Lett. Appl. Microbiol. 2007, 45, 529–534. [Google Scholar] [CrossRef]
Antibiotics 12 00430 g001 550
Figure 1. Percentages of isolates with different MIC values for cefoxitin in the years 2021 and 2022.
Figure 1. Percentages of isolates with different MIC values for cefoxitin in the years 2021 and 2022.
Antibiotics 12 00430 g001
Antibiotics 12 00430 g002 550
Figure 2. Distribution of MIC values for oxacillin (OXA), cefoxitin (FOX), norfloxacin (NOR), erythromycin (ERY), gentamicin (CN), kanamycin (KAN), tobramycin (TOB) and clindamycin (CD) in the years 2021 and 2022.
Figure 2. Distribution of MIC values for oxacillin (OXA), cefoxitin (FOX), norfloxacin (NOR), erythromycin (ERY), gentamicin (CN), kanamycin (KAN), tobramycin (TOB) and clindamycin (CD) in the years 2021 and 2022.
Antibiotics 12 00430 g002
Table
Table 1. Primers and probes designed in this study for the detection of AR genes, respective targets and dimensions of the amplification products.
Table 1. Primers and probes designed in this study for the detection of AR genes, respective targets and dimensions of the amplification products.
Primer and Probe Labels and Sequences (5′-3′)Target GeneAmplicon Size (bp)
AadA12f: CCTGGAGAGAGCGAGA
AadA12p: FAM-TTTGGAGAATGGCAGCGCAATGAC-BHQ1
AadA12r: CTATGTTCTCTTGCTTTTGT		aadA12197
AadA-aph2f: GGTAGTGGTTATGATAGTG
AadA-aph2p: FAM-TAGAAACTAATGTAAAAATTCCTAA-MGBEQ
AadA-aph2r: TTCTGGTGTTAAAAAAGTTCC		aadA-aph2231
Aac6f: CCTTGCGATGCTCTATG
Aac6p: Cy5-CCCGACACTTGCTGACGTACA-MGBEQ
Aac6r: TCCCCGCTTCCAAGAG		aac6 b (aac4)204
Ant6f: GCGCAAATATTAATATACCTAAA
Ant6P: Cy5-TGGGAATATAATAATGATG-MGBEQ
Ant6r: GGGCAATAAGGTAAGATCA		ant6 b (aadE)157
Aph3f: TGGCTGGAAGGAAAGC
Aph3p: FAM-TGATGGCTGGAGCAATCTGCT-BHQ1
Aph3r: TGTCGATGGAGTGAAAGA		aph3-III184
BlaZf: AAGGTTGCTGATAAAAGTGG
BlaZp: FAM-GTTTATCCTAAGGGCCAATCTGAACCT-BHQ1
BlaZr: AAATTCCTTCATTACACTCTTG		blaZ182
Cfrf: AAAACCTAACTGTAGATGAGA
Cfrp: Cy5-GATAGCATTTCTTTTATGGGAATGGG-BHQ1
Cfrr: TAAACGAATCAAGAGCATCA		cfr138
ErmAf: GGTAAACCCCTCTGAGA
ErmAp: Cy5-CATCAGTACGGATATTGTC-MGBEQ
ErmAr: CCCTTCTCAACGATAAGA		ermA177
ErmBf: TACTCGTGTCACTTTAATTCAC
ErmBp: Cy5-CAGTTTCAATTCCCTAACAAACAGAGG-BHQ1
ErmBr: CCCTAGTGTTCGGTGAA		ermB205
ErmCTf: AAATGGGTTAACAAAGAATACA
ErmCTp: Cy5-GAATTGACGATTTAAACAATATTAGCTTTG-BHQ1
ErmCTr: TATTGAAAAGAGACAAGAATTG		ermC/T a123
LnuBf: TAATTCTACCTTATCTAATCG
lnuBp: FAM-GTTTAGCCAATTATCAGCAT-MGBEQ
LnuBr: CGTTCATTAGAACTCTTATC		lnuB113
MecAf: AGAAAAAGAAAAAAGATGGCAAA
MecAp: FAM-CAACATGAAAAATGATTATGGCTCAG-BHQ1
MecAr: CTCATGCCATACATAAATGGA		mecA184
mecA/Cf: ACWTCACCAGGTTCAAC
mecA/Cp: Cy5-ATGGTAARGGTTGGCAAA-MGBEQ
mecA/Cr: TCTGATGATTCTATTGCTTG 		mecA/C c194
Mhpf: GGGACTTACATCCAGG
Mphp: FAM-AAGCAAACGTCACAGGTCT-MGBEQ
Mhpr: TCGTCGTCGAATACACG		mhp134
MsrAF: CTTACCAATTTGAAAAAATAGCA
MrsAp: Cy5-GGCAAAACCACATTACTAAATATGATTG-BHQ1
MsrAR: TTCACTCATTAAACTACCGT		mrsA240
a This primer/probe system targets both ermC and ermT genes; b these genes have alternative names in the sequence databases; c this primer/probe system targets both mecA and mecC genes and, coupled with the mecA-specific test, can allow for the detection of the mecC gene.
Table
Table 2. List of isolates in the year 2021 or 2022 with respective AR phenotypes for the antibiotics for which resistance (R) was detected, i.e., cefoxitin (FOX) and clindamycin (CD), and the genotypic AR profiles.
Table 2. List of isolates in the year 2021 or 2022 with respective AR phenotypes for the antibiotics for which resistance (R) was detected, i.e., cefoxitin (FOX) and clindamycin (CD), and the genotypic AR profiles.
20212022
Farm/
Isolate *		AR
Phenotype		AR GenotypeFarm/
Isolate *		AR
Phenotype		AR Genotype
1 1 1FOX RblaZ
2FOX R 1 2FOX RblaZ
3FOX R 2 1
4 1FOX RblaZ2 2
4 3FOX R 3 1FOX RblaZ, ermB
5FOX Raph3, blaZ, ermCT3 2FOX R
6 1FOX R 4FOX RblaZ
6 2FOX R 5FOX R
7FOX Rant6, aph3, blaZ, ermCT,6FOX R, CD RmecA, mph
8 1FOX RblaZ7 blaZ
8 2FOX RblaZ8 1
8 3FOX RblaZ8 2 blaZ
9FOX R 8 3
10FOX R 8 4
11 9
12FOX R 10 1FOX RblaZ
13 blaZ10 2FOX RblaZ
14 1FOX RblaZ10 3FOX RblaZ
14 2FOX RblaZ11 1 blaZ
15 1 blaZ11 2 blaZ
15 2 blaZ11 3 blaZ
15 3 12 1FOX R
16 1 blaZ12 2FOX RblaZ
16 2 blaZ12 3FOX R
16 3 blaZ13 1FOX R
16 4 blaZ13 2FOX R
16 5 blaZ13 3FOX R
* The first one or two numbers indicate the farm, while the last number preceded by a space is the isolate number for cases in which more than one isolate was obtained from the same milk sample.
Table
Table 3. Responses of 18 veterinarians to closed ended questions on antibiotic usage and mastitis management at farm level; all veterinarians provided medical care to the farms considered in this study. The number of veterinarians giving positive responses are reported for each question.
Table 3. Responses of 18 veterinarians to closed ended questions on antibiotic usage and mastitis management at farm level; all veterinarians provided medical care to the farms considered in this study. The number of veterinarians giving positive responses are reported for each question.
QuestionNumber of Veterinarians *
1. Antibiotic classes prescribed
Aminoglycosides (gentamicin, neomicin, kanamycin)2
Penicillins (ampicillin, amoxicillin/clavulanic acid, penicillin)9
Cephalosporins (cefalexin, cefoperazone)5
Lincosamides (lincomycin-spectinomycin)2
Fluoroquinolones (enrofloxacin)9
Macrolides (spiramycin, tylosin)2
2. Hygiene conditions in farms
Excellent0
Good7
Acceptable9
Inadequate2
3. Milking hygiene
Excellent0
Good9
Acceptable9
Inadequate0
4. Mastitis prevention measures
Excellent0
Good7
Acceptable7
Inadequate4
5. Management of total bacterial and somatic cell counts in bulk tank milk [15]
Excellent0
Good13
Acceptable5
Inadequate0
6. Reason for bacteriological examination and antibiogram request for mastitis cases
Always0
In most cases2
For severe infections0
For recidivating mastitis16
After treatment failure4
7. Protocol of antibiotic usage adopted
Always0
In most cases7
Frequent7
Rare2
None2
8. Evidences of AR
Frequent2
Rare16
None0
9. Measures adopted for AR management
Infectious disease expert consultation0
Therapy against specific infectious agents18
Reduction of antibiotic usage9
* Some professionals gave multiple responses to questions 1, 6 and 9.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rossi, F.; Del Matto, I.; Saletti, M.A.; Ricchiuti, L.; Tucci, P.; Marino, L. Recent Trends of Antibiotic Resistance in Staphylococcus aureus Causing Clinical Mastitis in Dairy Herds in Abruzzo and Molise Regions, Italy. Antibiotics 2023, 12, 430. https://doi.org/10.3390/antibiotics12030430

AMA Style

Rossi F, Del Matto I, Saletti MA, Ricchiuti L, Tucci P, Marino L. Recent Trends of Antibiotic Resistance in Staphylococcus aureus Causing Clinical Mastitis in Dairy Herds in Abruzzo and Molise Regions, Italy. Antibiotics. 2023; 12(3):430. https://doi.org/10.3390/antibiotics12030430

Chicago/Turabian Style

Rossi, Franca, Ilaria Del Matto, Maria Antonietta Saletti, Luciano Ricchiuti, Patrizia Tucci, and Lucio Marino. 2023. "Recent Trends of Antibiotic Resistance in Staphylococcus aureus Causing Clinical Mastitis in Dairy Herds in Abruzzo and Molise Regions, Italy" Antibiotics 12, no. 3: 430. https://doi.org/10.3390/antibiotics12030430

APA Style

Rossi, F., Del Matto, I., Saletti, M. A., Ricchiuti, L., Tucci, P., & Marino, L. (2023). Recent Trends of Antibiotic Resistance in Staphylococcus aureus Causing Clinical Mastitis in Dairy Herds in Abruzzo and Molise Regions, Italy. Antibiotics, 12(3), 430. https://doi.org/10.3390/antibiotics12030430

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop