Next Article in Journal
Prevalence and Molecular Characterization of Methicillin-Resistant Staphylococci (MRS) and Mammaliicocci (MRM) in Dromedary Camels from Algeria: First Detection of SCCmec-mecC Hybrid in Methicillin-Resistant Mammaliicoccus lentus
Next Article in Special Issue
Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolated from Food-Producing Animals in Tamaulipas, Mexico
Previous Article in Journal
General Perceptions and Knowledge of Antibiotic Resistance and Antibiotic Use Behavior: A Cross-Sectional Survey of US Adults
Previous Article in Special Issue
Phenotypic and Genotypic Investigation of Carbapenem-Resistant Acinetobacter baumannii in Maharaj Nakhon Si Thammarat Hospital, Thailand
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 4
10.3390/antibiotics12040673
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle

by
Lubna
1,2,†,
Tahir Hussain
2,
Ashwag Shami
3,
Naseem Rafiq
4,
Shehryar Khan
1,5,
Muhammad Kabir
6,
Naimat Ullah Khan
1,
Irfan Khattak
1,
Mustafa Kamal
1,4,*,† and
Tahir Usman
1,*,†
1
College of Veterinary Sciences and Animal Husbandry, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
2
Department of Microbiology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
3
Department of Biology, College of Sciences, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia
4
Department of Zoology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
5
Department of Biotechnology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
6
Department of Biological Sciences, Thal University Bhakkar, University of Sargodha, (Ex-Sub Campus Bhakkar), Bhakkar 30000, Punjab, Pakistan
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antibiotics 2023, 12(4), 673; https://doi.org/10.3390/antibiotics12040673
Submission received: 27 February 2023 / Revised: 21 March 2023 / Accepted: 26 March 2023 / Published: 29 March 2023
(This article belongs to the Special Issue Molecular Epidemiology, Antimicrobial Resistance, and Virulence Genes in Drug-Resistant Bacteria)
Versions Notes

Abstract

:
Staphylococcus aureus is a prominent cause of food-borne diseases worldwide. Enterotoxigenic strains of this bacteria are frequently found in raw milk, and some of these strains are resistant to antimicrobials, posing a risk to consumers. The main objectives of this study were to determine the antimicrobial resistance pattern of S. aureus in raw milk and to detect the presence of mecA and tetK genes in it. A total of 150 milk samples were obtained aseptically from lactating cattle, including Holstein Friesian, Achai, and Jersey breeds, maintained at different dairy farms. The milk samples were checked for the presence of S. aureus, and it was detected in 55 (37%) of them. The presence of S. aureus was verified by culturing on selective media, gram staining, and performing coagulase and catalase tests. Further confirmation was performed through PCR with a species-specific thermonuclease (nuc) gene. Antimicrobial susceptibility testing of the confirmed S. aureus was then determined by using the Kirby–Bauer disc diffusion technique. Out of the 55 confirmed S. aureus isolates, 11 were determined to be multidrug-resistant (MDR). The highest resistance was found to penicillin (100%) and oxacillin (100%), followed by tetracycline (72.72%), amikacin (27.27%), sulfamethoxazole/trimethoprim (18.18%), tobramycin (18.18%), and gentamycin (9.09%). Amoxicillin and ciprofloxacin were found to be susceptible (100%). Out of 11 MDR S. aureus isolates, the methicillin resistance gene (mecA) was detected in 9 isolates, while the tetracycline resistance gene (tetK) was found in 7 isolates. The presence of these methicillin- and tetracycline-resistant strains in raw milk poses a major risk to public health, as they can cause food poisoning outbreaks that can spread rapidly through populations. Our study concludes that out of nine empirically used antibiotics, amoxicillin, ciprofloxacin, and gentamicin were highly effective against S. aureus compared to penicillin, oxacillin, and tetracycline.

1. Introduction

Bovine mastitis is an inflammation of udder tissue caused mainly by microbial infection or by physical trauma, resulting in enormous economic losses to the dairy industry [1]. Mastitis affects approximately 40% of cows and costs the world economy EUR 125 billion every year [2,3]. Mastitis manifests in two forms: clinical or subclinical. Clinical mastitis (CM) is characterized by sudden onset, change in milk composition, a reduction in milk production, and the appearance of basic symptoms of inflammation in the infected udder that can be easily identified. Sometimes, clinical mastitis is characterized by fever and decreased appetite [4], whereas in subclinical mastitis (SCM), no obvious symptoms are detected in the udder or milk. However, the output of milk decreases and somatic cells increase [5]. Subclinical mastitis occurs more frequently than CM. Both types of mastitis result in changes in milk composition of varying degrees, depending on the severity of the disease [6]. The milk in CM is rejected by the farmer, owing to obvious abnormalities, whereas SCM causes no visible alterations and is, thus, included in bulk milk [7].
Mastitis can affect human health by promoting the spread of bacteria that are resistant to antibiotics, which is worrisome [8]. Despite considerable research and attention devoted to controlling mastitis, it remains one of the most expensive diseases affecting dairy cattle [9]. Milk from infected cows is unfit for human use due to bacterial contamination [10]. Mastitis is a global issue because it endangers not only the health of cattle but also human lives by contaminating the milk with pathogens and lowering the production of milk, ultimately resulting in significant economic losses [11].
S. aureus is one of the main bacteria that cause mastitis in dairy cattle [12]. It is a gram-positive, facultative anaerobic bacterium that is oxidase-negative, catalase-positive, and coagulase-positive coccus. S. aureus is spherical in shape, 0.5–1.5 µm in diameter, non-spore-forming, and non-motile. It is a major infectious agent for both the community and the health sector [13,14]. In 1881, Alexander Ogaston, a Scottish surgeon, first identified S. aureus in a surgical abscess [15]. Besides infecting people and animals, S. aureus also colonizes pets and wild species, where it may behave as an opportunistic pathogen [16]. S. aureus is a serious pathogen that can cause intramammary infection in dairy animals. According to reports, it causes 40% of cases of mastitis in various countries [17,18,19]. S. aureus has the ability to develop resistance and generates a variety of virulence elements, including endotoxins and other hazardous proteins. It causes recurring and chronic infections and is highly resistant to β-lactam antibiotics. Its rate of resistance has dramatically increased in recent years [20].
S. aureus has been recognized as a major source of zoonotic infections as well as a transmission factor of methicillin-resistant S. aureus (MRSA) from animals to humans through bodily interaction, handling, or ingestion of S. aureus-contaminated animal products [21]. S. aureus contamination of raw milk and infection of dairy cattle, particularly when it has a phenotype of MDR and is capable of forming biofilm and toxins, such as TSST-1, PVL, and enterotoxin, continues to be a major concern for the health of people [22]. Food-borne poisoning incidents linked to S. aureus-contaminated dairy products, involving one of the worst outbreaks of food-borne diseases ever recorded in Japan involving 13,420 infected people, show the bacterium’s significance for public health [23]. Consumption of unprocessed milk is a primary source of S. aureus infections, which can cause common and severe illnesses, including septicemia, pneumonia, and dermatitis in humans [24]. Various antimicrobial agents are used on farm animals on a daily basis as a therapy against S. aureus mastitis or to enhance production, which results in the emergence of MDR and MRSA among farm animals.
Antimicrobial resistance (AMR) has been highlighted as a serious danger to world health. According to the World Health Organization (WHO), mutations in bacteria can lead to AMR, making drugs ineffective and causing illnesses to remain in the body, increasing the risk of dissemination to others [25]. There are various explanations underlying the development of AMR, ranging from microbial origins to human components, such as the misuse and over-prescription of antimicrobial drugs, the agricultural and manufacturing application of antimicrobials in the animal sector, and human behavioral factors [26]. MDR S. aureus infections have been linked to a number of infectious diseases, a high rate of morbidity, and financial loss to the dairy industry. MRSA, which is linked with animals and communities, was found recently, and it represents a major public health issue [27].
Antimicrobials are frequently used to treat microbial diseases in farm animals, such as cattle [28]. However, due to lateral gene transfer, the prevalence of antibiotic-resistant genes in the Staphylococcus species is a major problem, as these resistant bacterial strains can be carried from animals to humans [29]. The mecA gene (methicillin), tetM/tetK (tetracycline), blaz gene (methicillin), and ermA/ermC gene (erythromycin), as well as msrA/msrB, are common antibiotic resistance genes in the dairy sector that have been reported worldwide [30]. Mastitis is often treated with an intramuscular or intravenous injection of antibiotics, such as ampicillin, streptomycin, cloxacillin, tetracycline, and penicillin. However, due to the fast development of antibiotic-resistant bacteria, the therapy is expected to become troublesome in the near future [31]. As a result, other alternatives to antibiotic therapy must be sought.
Using antimicrobials for a long time might cause the formation of bacterial strains that are antimicrobial-resistant, which is a major worry not only for animal welfare but, more crucially, for human health as well. The purpose of this study was to find out the prevalence and antimicrobial resistance of the genes mecA and tetK among S. aureus isolates, which were isolated from raw milk collected from dairy farms in Khyber Pakhtunkhwa, Pakistan.

2. Results

2.1. Somatic Cell Count

The samples were divided into three groups based on SCC. The number of cattle in SCC Group 1 (≤200,000 cells/mL of milk, healthy cows) was 72, of which 38 were Achai, 24 were Jersey, and 10 were Holstein Friesian. SCC Group 2 (>200,000–500,000 cells/mL of milk, infected cows) included 27 cattle, of which 4 were Achai, 9 were Jersey, and 14 were Holstein Friesian, while SCC Group 3 (>500,000 cells/mL of milk, severely infected cows) had 51 cattle, of which 19 were Achai, 7 were Jersey, and 25 were Holstein Friesian.

2.2. Prevalence of S. Aureus

A total of 150 milk samples were screened for the detection of S. aureus. A total of 55 (37%) milk samples were found positive. The presence of S. aureus was verified by culturing on selective media, gram staining, and coagulase and catalase tests. The catalase and coagulase positivity and the purple round shape colonies observed under a microscope confirmed the presence of S. aureus. S. aureus was further confirmed molecularly through PCR with a species-specific thermonuclease (nuc) gene.
The breed-wise prevalence of S. aureus was recorded highest in Holstein Friesian (48.98%) followed by Achai (37.70%), while the lowest prevalence was recorded in Jersey (20%). The prevalence difference between the different cattle breeds was statistically significant (p < 0.05). S. aureus prevalence was highest in the Harichand dairy farm at 65.30%, followed by the Munda dairy farm, 41.66%; Field 1 Dir, 28.57%; and the Agricultural University Peshawar dairy farm, 28%. The lowest prevalence was recorded in Hanifa Research Center Dir (8.69%), whereas 0% prevalence was recorded in Field 2 Swat sampling (Table 1). S. aureus prevalence had a significant association with the farm of cattle (p < 0.05).

2.3. Antibiotic Susceptibility Test

An antibiotic susceptibility test (AST) was carried out on all S. aureus isolates (n = 55). All confirmed S. aureus isolates were grouped according to the Clinical and Laboratory Standards Institute (CLSI) guideline 2018 as resistant, intermediate, and susceptible for each antimicrobial drug tested. The highest resistance was found to penicillin (100%) and oxacillin (100%), followed by tetracycline (72.72%), amikacin (27.27%), sulfamethoxazole/trimethoprim (18.18%), tobramycin (18.18%), and gentamycin (9.09%). On the other hand, amoxicillin and ciprofloxacin were found to be 100% susceptible (Table 2). Out of the 55 verified S. aureus isolates, 11 were determined to be MDR.

2.4. Detection of Resistance Genes

All S. aureus MDR isolates were screened for resistance genes, i.e., mecA and tetK, through PCR. The methicillin resistance gene (mecA) was detected in 9 isolates out of 11, whereas the tetracycline resistance gene (tetK) was found in 7 isolates out of 11. The amplified gene sizes were 533 bp and 360 bp for mecA and tetK, respectively.

3. Discussion

In the present study, S. aureus was found in 37% of milk samples collected from different breeds of cattle, including Holstein Friesian, Jersey, and Achai. The high prevalence is due to the poor hygienic environment in the farms during milk processing. The results of the present study are in line with previous studies that reported nearly similar prevalences of S. aureus in milk samples in China, Italy, and Brazil [28,32,33]. A recent study conducted in Khyber Pakhtunkhwa, Pakistan, reported a 34% prevalence of staphylococcal mastitis in lactating bovine [12]. Another study conducted by Bano et al. [34] in three provinces (Khyber Pakhtunkhwa, Punjab, and Sindh) of Pakistan found a 45% prevalence of S. aureus in raw milk. Aqib et al. [35] carried out similar research in Faisalabad, Pakistan, and concluded that 34% of the raw milk samples were infected with S. aureus. Other studies from Pakistan and Iran reported 34.2%, 80.79%, 37.14%, and 12.4% prevalences of S. aureus [28,36,37,38].
In the present study, the difference in S. aureus prevalence between different cattle breeds (Holstein Friesian, Achai, and Jersey) was statistically significant (p < 0.05). The highest prevalence was reported in the exotic Holstein Friesian breed. The variation in S. aureus occurrence between breeds may be due to the inherited characteristics, immunity of different breeds, and cows’ habituation to the impact of climate [39]. In the present study, S. aureus prevalence had a significant association with the farm of cattle (p < 0.05). The difference in S. aureus prevalence in cattle farms is associated with the contamination in the housing facilities of the cattle and teat exposure to the surrounding environment [39].
In this study, the in vitro disc sensitivity tests show that the resistance of S. aureus was highest to penicillin (100%) and oxacillin (100%), followed by tetracycline (72.72%), amikacin (27.27%), sulfamethoxazole/trimethoprim, and tobramycin (18.18%). Gentamycin was proven to have less resistance (9.09%). Isolates, on the other hand, were more susceptible to amoxicillin (100%) and ciprofloxacin (100%) and least to penicillin and oxacillin (0%). The antibiogram revealed that eleven of the total isolates (20%) were MDR. The probable development of resistance through the extended and indiscriminate use of some antimicrobials is suggested by Stefani and Guglio [40]. Correspondingly, a report by Beyene [41] in Ethiopia revealed that all isolates of S. aureus were resistant to penicillin in cow milk. The subclinical mastitis isolates of S. aureus in German dairy cows also proved to be 74.28% resistant to Penicillin [42]. In Brazilian mastitis buffalo, S. aureus-resistant isolates of oxacillin have been discovered in 50% of isolates [43].
Recent investigations have revealed high frequencies of S. aureus resistance to penicillin and tetracycline in unpasteurized milk. In Iran, according to the results of Jamali et al. [28], strains isolated from bovine raw milk were found resistant to penicillin and tetracycline at 44.4% and 56.2%, respectively. Conversely, Gao et al. [44] conducted similar research in China and reported that 96.2% of S. aureus raw milk isolates are penicillin-resistant and 98.1% are tetracycline-resistant.
The treatment of S. aureus infection in cattle is widespread. In various countries, farmers routinely use penicillin and tetracycline in dairy cattle to eliminate S. aureus infections from the herd [45]. Penicillin and tetracycline resistance increases with persistent and pervasive usage due to breed, nutrition, and climate [28,45]. Tetracycline resistance, especially from the tetK gene, was mostly dependent on the efflux mechanism of staphylococci. This conclusion is consistent with prior veterinarian observations. The tetK gene from tetracycline was the most often identified in staphylococci resistance [46]. Surprisingly, S. aureus isolates were discovered in China to be significantly tetracycline-resistant (98.1%) in a single herd [44]. While in India, tetracycline resistance was found in 57% of dairy cows (Pati and Mukherjee, 2016). Saidi et al. [47] also found that S. aureus isolates from bovine mastitis in Algeria had a rather high (61.9%) resistance to tetracycline.
MRSA is a major issue in both animals and humans. In the current study, 9 (81.81%) out of 11 MDR S. aureus isolates were found to be MRSA, with the mecA gene present. Aqib et al. [35] from Faisalabad, Pakistan, reported a lower (34%) prevalence of MRSA in cattle and buffaloes. In the neighboring country, India, Ganai et al. [48] reported that 44.1% of the S. aureus isolates were MRSA. Other studies conducted in Turkey, Egypt, China, and Algeria reported 75.4%, 35.7%, 9.61%, and 4.1% prevalences of MRSA [49,50,51,52]. The main causes of increased MRSA prevalence are the irregular use of beta-lactam antibiotics and poor hygienic conditions during milking [35].

4. Materials and Methods

4.1. Study Design and Sample Collection

The study was carried out on selected pure breeds of cattle, including Achai (A), Holstein Friesian (HF), and Jersey (J), maintained at Khyber Pakhtunkhwa dairy cattle farms. A total of 150 samples, including HF (n = 49), Jersey (n = 40), and Achai (n = 61), were collected. Aseptic methods were used in the collection of milk to prevent contamination by bacteria present on the skin, udder, teat, and farm environment. The udder was cleaned and disinfected with ethanol (70%), and the first few streaks were discarded from each teat canal. Milk samples were collected in 15 mL pre-labeled sterile milk bottles with 0.01 mg of potassium dichromate as a preservative and transferred in an ice box (at 4 °C) to the laboratory for further biological processes.

4.2. Somatic Cell Count

Microscopic slides were prepared from the milk samples and examined for somatic cell count (SCC) under a microscope by using the protocol of Usman et al. [53]. Somatic cell count (SCC) was categorized into three major groups based on somatic cells/mL of milk: healthy animals (SCC, <200,000 cells/mL of milk), elevated SCC ranged between 200,000 to 500,000 cells/mL of milk, whereas the high SCC group had SCC higher than 500,000 cells/mL of milk.

4.3. Bacterial Isolation

S. aureus was isolated and identified by directly streaking milk onto mannitol salt agar (MSA), then incubated at 37 °C for 24–48 h. The bacteriological media were prepared according to the protocol of Quinn et al. [54]. The plates were analyzed for the growth of S. aureus colonies. For pure cultivation, staphylococcal colonies were sub-cultured and incubated at 37 °C for 24–48 h on freshly prepared nutrient agar. The development of presumed colonies was determined by utilizing traditional bacteriological techniques based on colony, pigment production, and hemolysis features.

4.4. Biochemical Tests

The isolated S. aureus was further confirmed by using different biochemical tests, i.e., gram staining (+coccus) and catalase (+) and coagulase tests, as described by Quinn et al. [25]. For the catalase test, S. aureus pure colonies that were between 18 and 24 h old were selected. A single colony was picked and placed on a glass slide using a sterile inoculating loop. Using a dropper, 3 percent hydrogen peroxide solution was poured on the glass slide. Immediate bubbles were observed, which were considered positive results, while no bubble formation was considered a negative test result. To distinguish S. aureus from the rest of the staphylococcal species, a coagulase test was practiced. On a clean, glass slide, an S. aureus colony was mixed in a drop of water, making a smear. A sterile wire loop was dipped into the plasma, and the attached plasma traces were added to the suspension of Staphylococcus created on the slide. When a bacterial suspension and plasma are combined, the coagulase enzyme that S. aureus generates causes the cells to clump.

4.5. S. aureus Stock Preparation

Brain–heart infusion (BHI) was prepared according to the manufacturer’s protocol. Fresh S. aureus colonies from NAP were added to BHI media and incubated for 24 h at 37 °C. Turbidity showed growth of S. aureus after incubation time. For stock preparation, 50 μL of glycerol was taken in microcentrifuge tubes (Eppendorf), and 1 mL BHI (containing S. aureus) was added to it and stored at −80 °C until further use.

4.6. DNA Extraction and Molecular Identification of S. aureus

DNA was extracted from the samples by using the protocol that was previously established by Walsh et al. [55]. A 5% Sigma-Aldrich Chelex® 100 stock solution was prepared by adding 5 g of Chelex powder and 95 mL of water followed by proper vertexing. An amount of 200 microliters of the 5% Chelex was pipetted out into a 1.5 mL Eppendorf tube, and several bacterial colonies were picked by sterile wire loop and dipped into Chelex, which was followed by mixing multiple times using slow pipetting to avoid bubbling. The reagent was then incubated at a temperature of 65 °C for 8 min. The reagent was vortexed several times to ensure Chelex encountered the bacterial colonies to extract DNA. The reagent was again heated at 60 °C for 7 min and, after cooling, centrifuged at 12,000 rpm for 2 min. The supernatant was collected into separate tubes, as it contained DNA, while the pellet was discarded, as it had the remaining Chelex reagent. The collected DNA was stored at −4 °C for further use.
The S. aureus isolates were molecularly identified through PCR, with a species-specific thermonuclease (nuc) gene, as previously described by Louie et al. [56]. The primers used in the amplification of the nuc gene are given in Table 3.

4.7. Antimicrobial Susceptibility Testing

The S. aureus isolates isolated from milk were examined in vitro for their susceptibility to various antimicrobial agents frequently used in veterinary practices. Using the Kirby–Bauer disc diffusion test technique on Muller–Hinton agar (MHA), the antibiotic susceptibility of S. aureus isolates was evaluated [57]. Antimicrobial agents (Oxoid, Basingstoke, UK) including penicillin (10 μg), tetracycline (30 μg), oxacillin (10 μg), amoxicillin (30 μg), ciprofloxacin (10 μg), amikacin (30 μg), gentamycin (10 μg), sulfamethoxazole/trimethoprim, and tobramycin (10 μg) were used.
Colonies obtained from pure culture were placed in a glass tube containing 5 mL of broth culture, a colony suspension was prepared, and the colony was incubated at 37 °C for 8 h. The turbidity of the isolates’ direct colony suspensions was adjusted, in comparison to the turbidity corresponding to a 0.5 McFarland standard, for the antimicrobial drugs determined for isolated strains using the disc diffusion method. To prepare the Muller–Hunter agar (MHA) plates, one colony of mannitol salt agar was picked up with a cotton swab and diluted in 3 mL of normal saline in a glass tube. Bacterial lawns were then formed through the cotton bud (swab). The MHA agar plate was covered with these bacteria lawns such that not a single point remained empty. After lawn preparation, antibiotic discs were applied aseptically. Following that, the plates were incubated at 37 °C for 24 h.
According to Clinical and Laboratory Standards Institute (CLSI) criteria, the inhibition zone was measured. The Krumperman [58] approach was used to calculate the Multiple Antibiotic Resistance (MAR) Index. The bacterial isolates were acknowledged as having multidrug resistance (MDR) when they were found resistant to three or more categories of antimicrobial drugs, as defined by Magiorakos et al. [59].
Table
Table 3. Primers for the amplification of nuc, mecA and tetK genes of S. aureus.
Table 3. Primers for the amplification of nuc, mecA and tetK genes of S. aureus.
GenesNucleotide SequenceBase PairReference
NucForward: 5′ GCGATTGATGGTGATACGGTT     3′
Reverse:  3′ CGAAATCAAGCAGTTCCGAACCGA   5′		270[60]
MecAForward: 5′ AAAATCGATGGTAAAGGTTGGC   3′
Reverse:  3′ AGTTCTGCAGTACCGGATTTGC     5′		533[61]
TetKForward: 5′ GTAGCGACAATAGGTAATAGT    3′
Reverse:  3′ GTAGTGACAATAAACCTCCTA       5′		360[62]

4.8. Molecular Detection of Antimicrobial Resistance Gene

A well-established methodology was utilized to identify the antibiotic resistance genes, i.e., mecA and tetK. Polymerase chain reaction was employed to amplify and identify the necessary resistance genes by utilizing primers (Table 3), and the reaction was performed in a thermal cycler. A 20 µL reaction was produced by adding 10 μL of master mix, 2 µL of DNA sample, 6 µL of PCR-grade water, and 1 µL (10 μM Conc) of each of the forward and reverse primers. The thermal cycling procedure for PCR was initial denaturation at a temperature of 95 °C for 10 min and a 2nd denaturation temperature of 95 °C for 30 s, and the annealing temperature was held at 55 °C for 30 s and polymerization at 72 °C for 30 s, with a final extension phase at 72 °C for 10 min for a total of 35 cycles. The PCR product was visualized on 2 percent agarose gel using gel electrophoresis.

4.9. Gel Electrophoresis

The amplified PCR product was subjected to gel electrophoresis. To make 2 percent agarose gel, 0.40 g of agarose gel was added to 20 mL of TAE buffer in a small beaker. The mixture was swirled to blend. The agarose/buffer mixture was melted by heating it in the microwave for 30 s at a time and swirling it until the agarose was completely dissolved. Ethidium bromide (EtBr) was added to a concentration of 0.5 μg/mL solution after it had been appropriately brought to a boil. A 15-tooth comb was placed in a casting tray to create wells. For appropriate solidification, the gel was put onto the tray and allowed to sit at room temperature for 20 min. The 1st well of gel was loaded with 4 μL of 1 kb ladder marker. Afterward, 5 μL of the PCR product was added to the other wells in order to conduct the assessment. For gel electrophoresis, gels containing TAE buffer and electrodes connected to the negative and positive terminals were exposed to 120 volts for 30 min at 500 mA current. The gel was removed from the gel tray and exposed to UV light by using a gel documentation system that shows orange fluorescent DNA bands.

4.10. Statistical Analysis

The data from well-established government dairy farms were collected and transferred to excel sheets. A statistical study was undertaken to determine the relationship between S. aureus prevalence and different cattle breeds and farms. The chi-squared test was used, and p < 0.05 was considered significant.

5. Conclusions

This study revealed that out of the 55 S. aureus-positive isolates, 11 isolates showed multidrug resistance. Out of 11 MDR S. aureus isolates, the methicillin resistance gene (mecA) was detected in 9 isolates, while the tetracycline resistance gene (tetK) was found in 7 isolates. The presence of these methicillin- and tetracycline-resistant strains in raw milk poses a major risk to public health, as these strains can induce food poisoning outbreaks that spread across populations. This study concludes that among the nine empirically used antibiotics, amoxicillin, ciprofloxacin, and gentamicin were highly effective against mastitis compared to penicillin, oxacillin, and tetracycline. This study infers that dairy farms should use only those antibiotics to which bacteria are sensitive. It is recommended that farm workers should be aware of adequate antibiotic usage in dairy farms because resistant strains among dairy cows may pose a danger to human health due to the possibility of ingesting contaminated food, mainly raw milk.

Author Contributions

Conceptualization, T.H. and T.U.; data curation, L., S.K. and M.K. (Mustafa Kamal); formal analysis, N.R., S.K., M.K. (Muhammad Kabir), N.U.K. and I.K.; funding acquisition, A.S. and T.U.; investigation, L. and M.K. (Mustafa Kamal); methodology, L. and M.K. (Mustafa Kamal); project administration, T.U.; software, M.K. (Muhammad Kabir), N.U.K. and I.K.; supervision, T.H. and T.U.; validation, N.R., N.U.K. and I.K.; visualization, M.K. (Muhammad Kabir); writing—original draft, L. and M.K. (Mustafa Kamal); writing—review and editing, A.S., N.R., I.K. and T.U. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by a joint project of the Pakistan Science Foundation and the Nature Science Foundation of China PSF-NSFC III/Agr/KP/AWKUM/and (20) (31961143009); Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R31), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All relevant data are within the manuscript.

Acknowledgments

We are thankful to the dairy farms for providing samples and data for this study. The authors also acknowledge the Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R31), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Patnaik, S.; Prasad, A.; Ganguly, S. Mastitis, an infection of cattle udder: A review. J. Chem. Biol. Phys. Sci. JCBPS 2013, 3, 2676. [Google Scholar]
  2. Sordillo, L.M.; Streicher, K.L. Mammary gland immunity and mastitis susceptibility. J. Mammary Gland Biol. Neoplasia 2002, 7, 135–146. [Google Scholar] [CrossRef]
  3. Kovačević, Z.; Mihajlović, J.; Mugoša, S.; Horvat, O.; Tomanić, D.; Kladar, N.; Samardžija, M. Pharmacoeconomic Analysis of the Different Therapeutic Approaches in Control of Bovine Mastitis: Phytotherapy and Antimicrobial Treatment. Antibiotics 2023, 12, 11. [Google Scholar] [CrossRef] [PubMed]
  4. Bude, S.A.; Mengesha, A.K. Isolation and Identification of Staphylococcus aureus from Dairy Farms in Bishoftu Town, Ethiopia. J. Biochem. Biotech. 2021, 4, 9–13. [Google Scholar]
  5. Williamson, J.; Callaway, T.; Rollin, E.; Ryman, V. Association of Milk Somatic Cell Count with Bacteriological Cure of Intramammary Infection—A Review. Agriculture 2022, 12, 1437. [Google Scholar] [CrossRef]
  6. Bogni, C.; Odierno, L.; Raspanti, C.; Giraudo, J.; Larriestra, A.; Reinoso, E.; Lasagno, M.; Ferrari, M.; Ducrós, E.; Frigerio, C. War against mastitis: Current concepts on controlling bovine mastitis pathogens. Sci. Against Microb. Pathog. Commun. Curr. Res. Technol. Adv. 2011, 11, 483–494. [Google Scholar]
  7. Hameed, K.G.A.; Sender, G.; Korwin-Kossakowska, A. Public health hazard due to mastitis in dairy cows. Anim. Sci. Pap. Rep. 2007, 25, 73–85. [Google Scholar]
  8. Ashraf, A.; Imran, M. Causes, types, etiological agents, prevalence, diagnosis, treatment, prevention, effects on human health and future aspects of bovine mastitis. Anim. Health Res. Rev. 2020, 21, 36–49. [Google Scholar] [CrossRef]
  9. Riekerink, R.O.; Barkema, H.; Kelton, D.; Scholl, D. Incidence rate of clinical mastitis on Canadian dairy farms. J. Dairy Sci. 2008, 91, 1366–1377. [Google Scholar] [CrossRef] [Green Version]
  10. Tesfaye, K.; Gizaw, Z.; Haile, A.F. Prevalence of Mastitis and Phenotypic Characterization of Methicillin-Resistant Staphylococcus aureus in Lactating Dairy Cows of Selected Dairy Farms in and Around Adama Town, Central Ethiopia. Environ. Health Insights 2021, 15, 11786302211021297. [Google Scholar] [CrossRef]
  11. Botaro, B.G.; Cortinhas, C.S.; Dibbern, A.G.; Benites, N.R.; dos Santos, M.V. Staphylococcus aureus intramammary infection affects milk yield and SCC of dairy cows. Trop. Anim. Health Prod. 2015, 47, 61–66. [Google Scholar] [CrossRef]
  12. Ali, T.; Kamran, n.; Raziq, A.; Wazir, I.; Ullah, R.; Shah, P.; Ali, M.I.; Han, B.; Liu, G. Prevalence of Mastitis Pathogens and Antimicrobial Susceptibility of Isolates from Cattle and Buffaloes in Northwest of Pakistan. Front. Vet. Sci. 2021, 8, 746755. [Google Scholar] [CrossRef] [PubMed]
  13. Bitrus, A.; Peter, O.; Abbas, M.; Goni, M. Staphylococcus aureus: A review of antimicrobial resistance mechanisms. Vet. Sci. Res. Rev. 2018, 4, 43–54. [Google Scholar] [CrossRef]
  14. Harris, L.G.; Foster, S.; Richards, R.G. An introduction to Staphylococcus aureus, and techniques for identifying and quantifying S. aureus adhesins in relation to adhesion to biomaterials: Review. Eur. Cell Mater. 2002, 4, 100–120. [Google Scholar] [CrossRef] [PubMed]
  15. Rasheed, N.A.; Hussein, N.R. Staphylococcus aureus: An Overview of Discovery, Characteristics, Epidemiology, Virulence Factors and Antimicrobial Sensitivity. Eur. J. Mol. Clin. Med. 2021, 8, 1160–1183. [Google Scholar]
  16. Tang, Y.; Qiao, Z.; Wang, Z.; Li, Y.; Ren, J.; Wen, L.; Xu, X.; Yang, J.; Yu, C.; Meng, C. The Prevalence of Staphylococcus aureus and the Occurrence of MRSA CC398 in Monkey Feces in a Zoo Park in Eastern China. Animals 2021, 11, 732. [Google Scholar] [CrossRef] [PubMed]
  17. Kateete, D.P.; Kabugo, U.; Baluku, H.; Nyakarahuka, L.; Kyobe, S.; Okee, M.; Najjuka, C.F.; Joloba, M.L. Prevalence and antimicrobial susceptibility patterns of bacteria from milkmen and cows with clinical mastitis in and around Kampala, Uganda. PLoS ONE 2013, 8, e63413. [Google Scholar] [CrossRef] [Green Version]
  18. Basanisi, M.; La Bella, G.; Nobili, G.; Franconieri, I.; La Salandra, G. Genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk and dairy products in South Italy. Food Microbiol. 2017, 62, 141–146. [Google Scholar] [CrossRef] [Green Version]
  19. Wang, X.; Liu, Q.; Zhang, H.; Li, X.; Huang, W.; Fu, Q.; Li, M. Molecular characteristics of community-associated Staphylococcus aureus isolates from pediatric patients with bloodstream infections between 2012 and 2017 in Shanghai, China. Front. Microbiol. 2018, 9, 1211. [Google Scholar] [CrossRef] [Green Version]
  20. Guzmán-Rodríguez, J.J.; León-Galván, M.F.; Barboza-Corona, J.E.; Valencia-Posadas, M.; Loeza-Lara, P.D.; Sánchez-Ceja, M.; Ochoa-Zarzosa, A.; López-Meza, J.E.; Gutiérrez-Chávez, A.J. Analysis of virulence traits of Staphylococcus aureus isolated from bovine mastitis in semi-intensive and family dairy farms. J. Vet. Sci. 2020, 21, e77. [Google Scholar] [CrossRef]
  21. Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef] [PubMed]
  22. Cavicchioli, V.; Scatamburlo, T.; Yamazi, A.; Pieri, F.; Nero, L. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil. J. Dairy Sci. 2015, 98, 8386–8390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Hennekinne, J.-A.; De Buyser, M.-L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Fagundes, H.; Barchesi, L.; Filho, A.N.; Ferreira, L.M.; Oliveira, C.A.F. Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil. Braz. J. Microbiol. 2010, 41, 376–380. [Google Scholar] [CrossRef]
  25. World Health Organization. Antimicrobial Resistance. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 20 December 2022).
  26. Michael, C.A.; Dominey-Howes, D.; Labbate, M. The antimicrobial resistance crisis: Causes, consequences, and management. Front. Public Health 2014, 2, 145. [Google Scholar] [CrossRef]
  27. Algammal, A.M.; Enany, M.E.; El-Tarabili, R.M.; Ghobashy, M.O.I.; Helmy, Y.A. Prevalence, Antimicrobial Resistance Profiles, Virulence and Enterotoxins-Determinant Genes of MRSA Isolated from Subclinical Bovine Mastitis in Egypt. Pathogens 2020, 9, 362. [Google Scholar] [CrossRef]
  28. Jamali, H.; Paydar, M.; Radmehr, B.; Ismail, S.; Dadrasnia, A. Prevalence and antimicrobial resistance of Staphylococcus aureus isolated from raw milk and dairy products. Food Control. 2015, 54, 383–388. [Google Scholar] [CrossRef]
  29. Walther, C.; Perreten, V. Methicillin-resistant Staphylococcus epidermidis in organic milk production. J. Dairy Sci. 2007, 90, 5351. [Google Scholar] [CrossRef] [Green Version]
  30. Wang, D.; Zhang, L.; Yong, C.; Shen, M.; Ali, T.; Shahid, M.; Han, K.; Zhou, X.; Han, B. Relationships among superantigen toxin gene profiles, genotypes, and pathogenic characteristics of Staphylococcus aureus isolates from bovine mastitis. J. Dairy Sci. 2017, 100, 4276–4286. [Google Scholar] [CrossRef]
  31. Bhosale, R.R.; Osmani, R.A.; Ghodake, P.P.; Shaikh, S.M.; Chavan, S.R. Mastitis: An intensive crisis in veterinary science. Int. J. Pharma Res. Health Sci. 2014, 2, 96–103. [Google Scholar]
  32. Wang, W.; Lin, X.; Jiang, T.; Peng, Z.; Xu, J.; Yi, L.; Li, F.; Fanning, S.; Baloch, Z. Prevalence and Characterization of Staphylococcus aureus Cultured from Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China. Front Microbiol. 2018, 9, 1123. [Google Scholar] [CrossRef] [PubMed]
  33. Giacinti, G.; Carfora, V.; Caprioli, A.; Sagrafoli, D.; Marri, N.; Giangolini, G.; Amoruso, R.; Iurescia, M.; Stravino, F.; Dottarelli, S.; et al. Prevalence and characterization of methicillin-resistant Staphylococcus aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus aureus in dairy sheep farms in central Italy. J. Dairy Sci. 2017, 100, 7857–7863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Bano, S.A.; Hayat, M.; Samreen, T.; Asif, M.; Habiba, U.; Uzair, B. Detection of Pathogenic Bacteria Staphylococcus aureus and Salmonella sp. from Raw Milk Samples of Different Cities of Pakistan. Nat. Sci. 2020, 12, 295. [Google Scholar] [CrossRef]
  35. Aqib, A.I.; Ijaz, M.; Anjum, A.A.; Malik, M.A.R.; Mehmood, K.; Farooqi, S.H.; Hussain, K. Antibiotic susceptibilities and prevalence of Methicillin resistant Staphylococcus aureus (MRSA) isolated from bovine milk in Pakistan. Acta Trop. 2017, 176, 168–172. [Google Scholar] [CrossRef] [PubMed]
  36. Altaf, M.; Ijaz, M.; Iqbal, M.K.; Rehman, A.; Avais, M.; Ghaffar, A.; Ayyub, R.M. Molecular Characterization of Methicillin Resistant Staphylococcus aureus (MRSA) and Associated Risk Factors with the Occurrence of Goat Mastitis. Pak. Vet. J. 2020, 40, 1–6. [Google Scholar] [CrossRef]
  37. Javed, M.U. Frequency and Antimicrobial Susceptibility of Methicillin and Vancomycin-Resistant Staphylococcus aureus from Bovine Milk. PVJ 2021, 41, 463–468. [Google Scholar] [CrossRef] [PubMed]
  38. Maalik, A.; Ali, S.; Iftikhar, A.; Rizwan, M.; Ahmed, H.; Khan, I. Prevalence and Antibiotic Resistance of Staphylococcus aureus and Risk Factors for Bovine Subclinical Mastitis in District Kasur, Punjab, Pakistan. Pak. J. Zool. 2019, 51, 1123. [Google Scholar] [CrossRef]
  39. Kurjogi, M.M.; Kaliwal, B.B. Epidemiology of Bovine Mastitis in Cows of Dharwad District. Int. Sch. Res. Not. 2014, 2014, 1–9. [Google Scholar] [CrossRef] [Green Version]
  40. Stefani, S.; Goglio, A. Methicillin-resistant Staphylococcus aureus: Related infections and antibiotic resistance. Int. J. Infect. Dis. 2010, 14, S19–S22. [Google Scholar] [CrossRef] [Green Version]
  41. Beyene, G.F. Antimicrobial Susceptibility of Staphylococcus aureus in Cow Milk, Afar Ethiopia. Int. J. Mod. Chem. Appl. Sci. 2016, 3, 280–283. [Google Scholar]
  42. Behiry, A.E.; Schlenker, G.; Szabo, I.; Roesler, U. In vitro susceptibility of Staphylococcus aureus strains isolated from cows with subclinical mastitis to different antimicrobial agents. J. Vet. Sci. 2012, 13, 153–161. [Google Scholar] [CrossRef] [Green Version]
  43. Vásquez-García, A.; Silva, T.d.S.; Almeida-Queiroz, S.R.d.; Godoy, S.H.S.; Fernandes, A.M.; Sousa, R.L.M.; Franzolin, R. Species identification and antimicrobial susceptibility profile of bacteria causing subclinical mastitis in buffalo. Pesqui. Veterinária Bras. 2017, 37, 447–452. [Google Scholar] [CrossRef] [Green Version]
  44. Gao, J.; Ferreri, M.; Yu, F.; Liu, X.; Chen, L.; Su, J.; Han, B. Molecular types and antibiotic resistance of Staphylococcus aureus isolates from bovine mastitis in a single herd in China. Vet. J. 2012, 192, 550–552. [Google Scholar] [CrossRef] [PubMed]
  45. Chambers, H.F. Methicillin-resistant Staphylococcus aureus. Mechanisms of resistance and implications for treatment. Postgrad. Med. 2001, 109, 43–50. [Google Scholar] [CrossRef] [PubMed]
  46. Aarestrup, F.M.; Agersø, Y.; Ahrens, P.; Jørgensen, J.C.Ø.; Madsen, M.; Jensen, L.B. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry. Vet. Microbiol. 2000, 74, 353–364. [Google Scholar] [CrossRef]
  47. Saidi, R.; Cantekin, Z.; Khelef, D.; Ergün, Y.; Solmaz, H.; Kaidi, R. Antibiotic Susceptibility and Molecular Identification of Antibiotic Resistance Genes of Staphylococci Isolated from Bovine Mastitis in Algeria. Kafkas Üniversitesi Vet. Fakültesi Derg. 2015, 21, 513–520. [Google Scholar]
  48. Ganai, A.; Kotwal, S.K.; Wani, N.; Malik, M.A.; Jeelani, R.; Kour, S.; Zargar, R. Detection of mecA gene of methicillin resistant Staphylococcus aureus by PCR assay from raw milk. Indian J. Anim. Sci. 2016, 86, 508–511. [Google Scholar]
  49. Keyvan, E.; Yurdakul, O.; Demirtas, A.; Yalcin, H.; Bilgen, N. Identification of Methicillin-Resistant Staphylococcus aureus in Bulk Tank Milk. Food Sci. Technol. 2020, 40, 150–156. [Google Scholar] [CrossRef] [Green Version]
  50. Selim, A.; Kelis, K.; AlKahtani, M.D.F.; Albohairy, F.M.; Attia, K.A. Prevalence, antimicrobial susceptibilities and risk factors of Methicillin resistant Staphylococcus aureus (MRSA) in dairy bovines. BMC Vet. Res. 2022, 18, 293. [Google Scholar] [CrossRef] [PubMed]
  51. Titouche, Y.; Hakem, A.; Houali, K.; Meheut, T.; Vingadassalon, N.; Ruiz-Ripa, L.; Salmi, D.; Chergui, A.; Chenouf, N.; Hennekinne, J.A.; et al. Emergence of methicillin-resistant Staphylococcus aureus (MRSA) ST8 in raw milk and traditional dairy products in the Tizi Ouzou area of Algeria. J. Dairy Sci. 2019, 102, 6876–6884. [Google Scholar] [CrossRef] [PubMed]
  52. Zhang, H.; Zhou, Y.; Zhang, L.; Wang, R. Prevalence, Enterotoxin Gene and Antimicrobial Resistance of Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus from Clinical Healthy Dairy Cows. Pak. Vet. J. 2016, 10, 641. [Google Scholar]
  53. Usman, T.; Wang, Y.; Liu, C.; Wang, X.; Zhang, Y.; Yu, Y. Association study of single nucleotide polymorphisms in JAK 2 and STAT 5B genes and their differential mRNA expression with mastitis susceptibility in Chinese Holstein cattle. Anim. Genet. 2015, 46, 371–380. [Google Scholar] [CrossRef]
  54. Quinn, P.J.; Markey, B.K.; Carter, M.E.; Donnelly, W.J.C.; Leonard, F.C. Veterinary Microbiology and Microbial Disease; Blackwell Science: Hoboken, NJ, USA, 2002. [Google Scholar]
  55. Walsh, P.S.; Metzger, D.A.; Higushi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 1991, 10, 506–513, reprinted in Biotechniques 2013, 54, 134–139. [Google Scholar] [CrossRef] [Green Version]
  56. Louie, L.; Goodfellow, J.; Mathieu, P.; Glatt, A.; Louie, M.; Simor, A.E. Rapid detection of methicillin-resistant staphylococci from blood culture bottles by using a multiplex PCR assay. J. Clin. Microbiol. 2002, 40, 2786–2790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef] [PubMed]
  58. Krumperman, P.H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Green Version]
  60. Brakstad, O.G.; Aasbakk, K.; Maeland, J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992, 30, 1654–1660. [Google Scholar] [CrossRef] [Green Version]
  61. Faisal, M. Optimasi Suhu Annealing Gen mecA Resistensi Antibiotik Amoksisilin dari Bakteri Staphylococcus aureus pada Pasien Ulkus Diabetik. J. Mhs. Farm. Fak. Kedokt. UNTAN 2019, 4, 1. [Google Scholar]
  62. Qu, Y.; Zhao, H.; Nobrega, D.B.; Cobo, E.R.; Han, B.; Zhao, Z.; Li, S.; Li, M.; Barkema, H.W.; Gao, J. Molecular epidemiology and distribution of antimicrobial resistance genes of Staphylococcus species isolated from Chinese dairy cows with clinical mastitis. J. Dairy Sci. 2019, 102, 1571–1583. [Google Scholar] [CrossRef] [Green Version]
Table
Table 1. Prevalence of S. aureus in different farms and breeds of cattle.
Table 1. Prevalence of S. aureus in different farms and breeds of cattle.
VariablePrevalence %
(Infected/Total)		Chi-Square (χ2)p-Value
Farm
Harichand dairy farm65.30 (32/49)32.970.0001 *
Agriculture University Peshawar dairy farm28% (7/25)
Munda dairy farm41.66% (10/26)
Hanifa research center Dir8.69% (2/23)
Field 1 Dir28.57% (4/14)
Field 2 Swat0% (0/13)
Breed
Holstein Friesian48.98% (24/49)8.080.018 *
Jersey20% (8/40)
Achai37.70% (23/61)
* = p < 0.05.
Table
Table 2. Antimicrobial susceptibility of S. aureus isolates.
Table 2. Antimicrobial susceptibility of S. aureus isolates.
Antimicrobial
Agents		Conc (μg)Zone Diameter (mm)
Sensitive %Intermediate %Resistant %
Oxacillin10≥13
(0%)		11–12
(0%)		≤10
(100%)
Gentamycin10≥15
(72.72%)		13–14
(18.19%)		≤12
(9.09%)
Tetracycline30≥19
(27.28%)		15–18
(0%)		≤14
(72.72)
Ciprofloxacin10≥21
(100%)		16–20
(0%)		≤15
(0%)
Penicillin10≥29
(0%)		-
(0%)		≤28
(100%)
Amoxicillin30≥20
(100%)		-
(0%)		≤19
(0%)
Sulfamethoxazole/
trimethoprim		25≥16
(81.82%)		11–15
(0%)		≤10
(18.18%)
Tobramycin10≥15
(72.73%)		13–14
(9.09%)		≤12
(18.18%)
Amikacin 30≥17
(63.64%)		15–16
(9.09%)		≤14
(27.27%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lubna; Hussain, T.; Shami, A.; Rafiq, N.; Khan, S.; Kabir, M.; Khan, N.U.; Khattak, I.; Kamal, M.; Usman, T. Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle. Antibiotics 2023, 12, 673. https://doi.org/10.3390/antibiotics12040673

AMA Style

Lubna, Hussain T, Shami A, Rafiq N, Khan S, Kabir M, Khan NU, Khattak I, Kamal M, Usman T. Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle. Antibiotics. 2023; 12(4):673. https://doi.org/10.3390/antibiotics12040673

Chicago/Turabian Style

Lubna, Tahir Hussain, Ashwag Shami, Naseem Rafiq, Shehryar Khan, Muhammad Kabir, Naimat Ullah Khan, Irfan Khattak, Mustafa Kamal, and Tahir Usman. 2023. "Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle" Antibiotics 12, no. 4: 673. https://doi.org/10.3390/antibiotics12040673

APA Style

Lubna, Hussain, T., Shami, A., Rafiq, N., Khan, S., Kabir, M., Khan, N. U., Khattak, I., Kamal, M., & Usman, T. (2023). Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle. Antibiotics, 12(4), 673. https://doi.org/10.3390/antibiotics12040673

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop