Next Article in Journal
The Use of Nanomedicine for Targeted Therapy against Bacterial Infections
Previous Article in Journal
Prevention of Pseudomonas aeruginosa Biofilm Formation on Soft Contact Lenses by Allium sativum Fermented Extract (BGE) and Cannabinol Oil Extract (CBD)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 8
Issue 4
10.3390/antibiotics8040259
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogenetic Diversity, Antimicrobial Susceptibility and Virulence Characteristics of Escherichia coli Isolates from Pigeon Meat

by
Rosa Capita
1,2,*,
Jorge Cordero
1,2,
Diana Molina-González
1,2,
Gilberto Igrejas
3,4,5,
Patrícia Poeta
3,6 and
Carlos Alonso-Calleja
1,2
1
Department of Food Hygiene and Technology, Veterinary Faculty, University of León, 24071 León, Spain
2
Institute of Food Science and Technology, University of León, 24071 León, Spain
3
Associated Laboratory for Green Chemistry, University NOVA of Lisboa, 2829-516 Caparica, Portugal
4
Department of Genetics and Biotechnology, University of Trás-os-Montes and Alto Douro, 5000-811 Vila Real, Portugal
5
Functional Genomics and Proteomics Unit, University of Trás-os-Montes and Alto Douro, 5000-811 Vila Real, Portugal
6
Department of Veterinary Sciences, University of Trás-os-Montes and Alto Douro, 5000-811 Vila Real, Portugal
*
Author to whom correspondence should be addressed.
Antibiotics 2019, 8(4), 259; https://doi.org/10.3390/antibiotics8040259
Submission received: 16 September 2019 / Revised: 28 November 2019 / Accepted: 30 November 2019 / Published: 10 December 2019
(This article belongs to the Section Mechanism and Evolution of Antibiotic Resistance)
Browse Figures
Versions Notes

Abstract

:
Monitoring resistance to antibiotics in wild animals may assist in evaluating tendencies in the evolution of this major public health problem. The aims of this research work were to determine the patterns of antibiotic resistance in Escherichia coli isolates from the meat of wild or domestically reared pigeons from Spain, to detect the presence of virulence and antibiotic resistance genes, and to carry out a phylogenetic classification of the isolates. Of the 37 E. coli strains tested, 32.43% of them belonged to the B2 phylogenetic group, which is often implicated in extra-intestinal infections. None of the strains showed extended-spectrum beta-lactamase activity. All the isolates presented resistance or reduced susceptibility to two or more antibiotics, with high levels of resistance to β-lactams, aminoglycosides and tetracycline. Ten resistance genes were detected, the most frequent of which were ampC, conferring resistance to ampicillin and aadA, conferring resistance to streptomycin. In total, 97.30% of the strains carried virulence factors (between one and five). The strains from pigeons reared in captivity harboured higher average numbers of resistance and virulence genes than isolates from wild pigeons. Pigeon meat is an important reservoir of E. coli with genes for antibiotic resistance and virulence having the potential to cause disease in humans.

Graphical Abstract

1. Introduction

Escherichia coli is a common bacterium in the gut of humans and animals. Most strains of E. coli are not pathogenic to humans and are seen solely as indicators of faecal contamination. However, between 10% and 15% of strains are pathogenic and able to cause a wide range of illnesses, mainly due to the consumption of contaminated food or drink [1,2]. To this effect, E. coli was responsible for 0.9% (48 out of a total of 5,079) of the outbreaks of foodborne diseases in the European Union in 2017 [3]. This microorganism is also a cause for concern in the medical field, where it is responsible for a considerable percentage of nosocomial infections [4].
Resistance to antibiotics has been defined as one of the greatest threats to public health and one of the main challenges in medicine for the twenty-first century [5]. E. coli has a noteworthy capacity to acquire antibiotic resistance genes as a result of the efficient horizontal transfer mechanisms these microorganisms have developed over time [6]. Hence, strains of this bacterial group act as reservoirs of resistance genes. This is a worrying fact in the context of public health, since there is a high likelihood of transfer of genes to other, pathogenic, bacteria. It also allows this bacterial group to be used as sentinel for resistance to antibiotics [6].
The acquisition of antibiotic resistant bacteria by wild animals contributes to increasing the problem of resistance, given that these animals constitute an environmental reservoir of genes and are a biological mechanism for spreading them into the general surroundings [7]. This circumstance enables these animals to be used as environmental indicators of resistance to antibiotics. Moreover, in species used for human consumption, as is the case with pigeons, there is a further problem of potential infection of consumers by resistant bacteria as an outcome of cross-contamination or insufficiently cooked foodstuffs [8].
In recent years, several studies have reported increasing resistance in bacteria isolated from wild animals [9,10,11]. This circumstance makes it feasible to use these animals as indicators of resistance to antibiotics in the environment. However, there is very limited research on phenotypic and genotypic characterization of E. coli isolates from pigeons in Spain. The aims of this research work were to determine the patterns of antibiotic resistance among a collection of E. coli strains isolated from the meat of pigeons from north-west Spain for the purpose of performing a phylogenetic classification of the strains and detecting the genes for resistance to antibiotics and the virulence factors present. A comparison was made of the findings for isolates from both wild pigeons and others raised in captivity.

2. Results

2.1. Antibiotic Susceptibility

The E. coli strains showed resistance or reduced susceptibility to two (2.70% of strains), three (13.51%), four (40.54%), five (27.02%), six (5.41%), seven (2.70%) and even eight (8.11%) antibiotics. Considering resistance in the strict sense only (excluding strains with reduced susceptibility), 40.54% of the strains were susceptible, while 40.54% showed resistance to one antibiotic, and 18.92% showed resistance to two antibiotics. The average number of resistances per strain was 0.78 (resistance in the strict sense only) or 4.59 (resistance together with reduced susceptibility).
None of the strains were extended-spectrum beta-lactamase producers. Figure 1 shows the percentages of strains that were sensitive, intermediate (with reduced susceptibility) or resistant to each of the antibiotics tested. The strains presented a high prevalence of resistance or reduced susceptibility to β-lactams, aminoglycosides and tetracycline. There were percentages of strains with resistance or reduced susceptibility amounting to 48.65% (amoxicillin-clavulanic acid), 100% (ampicillin), 94.59% (ceftazidime), 83.78% (streptomycin) and 51.35% (tetracycline). For the remaining antibiotics, the percentages of strains showing resistance or reduced susceptibility ranged between 2.70% and 13.51%, the exception being imipenem, to which all strains were sensitive.
A greater prevalence of resistant strains (P < 0.05) was observed among strains from birds reared in captivity (70.83% of these presented resistance to at least one antibiotic). In contrast, wild birds showed less prevalence (38.46% had resistance to at least one antibiotic).
Table 1 shows the various patterns of resistance found and the number of strains associated with each. Four patterns stood out as particularly frequent, amoxicillin-clavulanic acid/ampicillin/ceftazicime/streptomycin/tetracycline (shown by seven strains; 18.92% of the total), amoxicillin-clavulanic acid/ampicillin/ceftazidime/streptomycin (six strains; 16.22%), ampicillin/ceftazidime/streptomycin (three strains; 8.11%) and ampicillin/ceftazidime/streptmycin/tetracycline (three strains; 8.11%).

2.2. Genotypic Characterization

A total of 28 genes were studied. Three of them served to ascribe the strains to phylogenetic groups, 18 were antibiotic resistance genes and seven were genes encoding virulence determinants. The classification into phylogenetic groups placed the strains in Groups A (two strains; 5.41% of the total), B1 (23 strains; 62.16%) and B2 (12 strains; 32.43%). No strain from Group D was detected. No significant differences were observed between groups of strains (from wild or domestic birds) regarding their ascription to the various phylogenetic groups.
Figure 2 shows the percentage of strains (relative to the 37 strains studied) that carried each of the genes conferring resistance to the antibiotics analysed. Overall, 79 genes giving resistance to antibiotics were detected in the 37 isolates investigated. The strains from pigeons reared in captivity presented a greater (P < 0.05) prevalence of resistance genes (2.42 genes per strain) than those from wild pigeons (1.62 genes per strain). Similar average numbers of resistance genes were observed in the strains belonging to the different phylogenetic groups.
The three strains that were resistant or intermediate to quinolones and fluoroquinolones (nalidixic acid or ciprofloxacin), representing 8.11% of all the strains of E. coli tested, had the gyrA and parC genes. The ampC gene was studied in all the strains (all the isolates showed resistance or reduced susceptibility to ampicillin) and was detected in 100% of them.
The cmlA gene was present in the four strains presenting resistance or reduced susceptibility to chloramphenicol (10.81% of all the strains). Furthermore, the aadA, aac(3)II and aac(3)IV genes, which were analysed in the 32 strains with resistance or reduced susceptibility to aminoglycosides, were found in 20 strains (aadA), four strains (aac(3)II) and two strains (aac(3)IV), respectively.
No genes for resistance to tetracycline (tetA, tetB and tetC) were detected in any of the 19 strains tested. Last, the sul1, sul2, sul3, intl1, intl2, qacEΔ1, rvintl1 and rvintl2 genes were analysed in the two strains presenting resistance or reduced susceptibility to SXT. The intl1, intl2, rvint1, rvint2 and qacEΔ1 genes were not found in any of the strains checked, while the sul1, sul2 and sul3 genes were detected, all of them in both strains (5.41% of the total).
Several genes for virulence were detected: aer (21 strains; 16 from phylogenetic group B1 and five from phylogenetic group B2), cnf1 (eight strains; five B1 and three B2), fimA (35 strains; 23 B1 and 12 B2), hly (16 strains; four B1 and 12 B2) and papGIII (nine strains; one A, and eight B2). The papC and stx1 genes were not detected. Table 2 shows a grouping of strains as a function of the number of virulence factors they bore. Several virulence patterns stand out: aer/fimA (14 strains; 37.84%), aer/fimA/hly/papGIII (five strains; 13.51%), fimA/hly (four strains; 10.81%) and cnf1/fimA/hly (four strains; 10.81%). Of the 89 virulence factors encountered in the overall set of strains trialled, 72 were detected in strains from birds raised in captivity (3.00 virulence factors per strain), and 17 in isolates from wild pigeons (1.31 virulence factors per strain; P < 0.05). The strains from phylogenetic groups B1 and B2 harboured similar (P > 0.05) average numbers of virulence factors (48 and 40, respectively).

3. Discussion

3.1. Antibiotic Susceptibility

In recent years, E. coli isolates producing extended-spectrum β-lactamases (ESBLs) have become a serious health problem worldwide [12]. In the study presented here, the double disc synergy test for detecting ESBLs was negative for all the E. coli isolates. The absence of ESBLs is in line with the results of other researchers who have investigated both domestic and wild birds [9,13,14,15].
The considerable prevalence of resistant or intermediate strains observed in this research work is a worrying finding considering that antibiotic resistance undermines the usefulness of these compounds in clinical practice. Along these lines, infections caused by multi-resistant bacteria are associated with high morbidity and mortality rates, in addition to increased treatment costs [16,17]. Notably, over 50% of the strains showed resistance or reduced susceptibility to ampicillin, ceftazidime, streptomycin and tetracycline, which are categorized as “critically important antimicrobials” (ampicillin, ceftazidime and streptomycin) or “highly important antimicrobials” (tetracycline) for human medicine [18]. According to the World Organization for Animal Health [19], ampicillin, streptomycin and tetracycline are classified as “critically important antimicrobial agents” in veterinary medicine. High levels of resistance to these antimicrobials have also been reported among various animal species, including pigeons [9,10,11,12,13,20,21,22,23,24,25].
The high prevalence of strains showing resistance or reduced susceptibility found in this study coincides with the outcomes of other research work undertaken in north-west Spain focused on chickens [26,27], game [28] and meat preparations [29,30]. Specifically regarding pigeons, a high prevalence of resistance has been noted in Spain [31], Japan [20], Belgium [13], Brazil [32], the Czech Republic [9], Poland [25], Bangladesh [33] and Slovakia [12]. Other researchers have also detected a considerable presence of resistance to antibiotics in strains of E. coli derived from the droppings of various kinds of wild birds and mammals living in close proximity to humans [9,24,34,35].
The results obtained in this research work highlight an association between the level of antimicrobial resistance in E. coli isolates from pigeon meat and these birds’ proximity to human populations. To this effect, the highest rates of resistance to antibiotics were found in strains isolated from animals kept in captivity. Similar findings have been reported by other authors [36]. Notably, exposure to anthropogenic factors such as human refuse or livestock farming may encourage resistant bacteria to colonise these birds, while also facilitating exposure to antimicrobial medication, antimicrobial residues or resistant genes, contributing to the development and maintenance of antibiotic resistance in the microbiota of these animals [6,10,37,38]. In fact, several antibiotics to which considerable prevalence of resistance was observed (e.g., tetracycline) are regularly used as prophylactic or therapeutic agents in animal production [39]. It should be noted, however, that due to the impact of both livestock and human densities on the environment, very slight differences between domestic and wild pigeons with respect to resistance to antibiotics were reported in a previous study [31].

3.2. Genotypic Characterization

Escherichia coli is classified into various phylogenetic groups, which differ in their ecological niches, characteristics and capacity to cause diseases. Isolates belonging to phylogenetic Groups A and B1, to which most of the strains in this research were ascribed, are commensals and only exceptionally associated with human extra-intestinal infections. In such cases, this is a consequence of the horizontal transfer of genes coding for virulence [38]. The predominance of strains from these phylogenetic groups is a finding that coincides with the results obtained by other authors on examining strains from different animal species [11,15,40,41,42,43]. In contrast, Groups B2 and D include strains with zoonotic potential involved in extra-intestinal human diseases such as urinary tract infections, neonatal meningitis and septicaemia [44]. Along these lines, the presence of Group B2 strains observed in this study (32.43% of strains fell into this phylogenetic group) is a worrying matter.
Regarding genes for antibiotic resistance, in the case of E. coli and other Gram-negative bacteria, resistance to quinolones is primarily due to mutations in the gyrA gene (which codes for the enzyme DNA gyrase). Mutations in the parC gene (which codes for the enzyme topoisomerase IV) provide additional resistance [45]. Other resistance mechanisms, such as changes in the permeability of the cell membrane and an increased expression of efflux pumps may also be linked with the acquisition of resistance to these antibiotics. Mutations in the gyrA and parC genes were detected in all the strains resistant to quinolones and fluoroquinolones in the present research work, a result which agrees with the observations of Gonçalves et al. [46].
Regarding resistance to β-lactams, many bacterial species contain β-lactamases, termed AmpC enzymes and chromosomally encoded by ampC genes, which are often detected in strains of intestinal origin [47,48]. Normally these genes are expressed at a low level in E. coli, which is insufficient to confer resistance. Nonetheless, a super-expression of the ampC sometimes occurs, increasing enzyme activity and generating resistance in the bacteria. This super-expression is generally caused by mutations in ampC genes [32]. The 37 strains of E. coli tested in this paper contained the ampC gene, although a full study of the possible mutations present was not undertaken.
All the strains with resistance or reduced susceptibility to chloramphenicol harboured the cmlA gene, which is responsible for the synthesizing of efflux pumps [49]. Other researchers have detected this gene in a high percentage of strains of porcine or avian origin [50,51]. The presence of genes for resistance to chloramphenicol observed in the present work may be surprising given that the use of this antibiotic in animals for human consumption was banned in the 1990s due to its toxicological effects (carcinogenicity and mutagenicity). European Council Regulation 2377/90 laid down a policy of zero tolerance for the presence of chloramphenicol in foodstuffs of animal origin. The three decades that have elapsed since this ban came into force may seem to be long enough for chloramphenicol resistance to disappear. However, cross-resistance and co-resistance mechanisms may have contributed to the persistence over time of genes for resistance to this substance [6,27].
Aminoglycosides inhibit the synthesis of bacterial proteins by binding to ribosomes. Although changes in the permeability of cells and binding points may cause resistance to these antibiotics, the most widespread resistance mechanism is the production of enzymes inactivating these substances [52]. Of the genes determining resistance to aminoglycosides, the aadA gene stood out in this work, given that they were detected in over 50% of the strains showing resistance or reduced susceptibility to this family of antibiotics. The values indicated are slightly higher than those reported by other authors [34,53]. The aac(3)II and the aac(3)IV genes, however, were present in only 10.81% and 5.41%, respectively, of the strains tested in this research. These percentages are lower than seen in other studies of strains of E. coli of animal origin [21,46].
None of the strains with resistance or reduced susceptibility to tetracycline tested in this work carried the tetA, tetB or tetC resistance genes. These results do not concur with those of other researchers [9,11,21,34,54], who detected these genes in E. coli isolates of animal origin that were resistant to tetracycline.
Integrons play an important role in increased resistance to antibiotics [55]. These genetic elements hold information for encoding a protein (integrase) that can include or release genes (gene cassettes) such as antibiotic resistance genes (e.g., to sulphonamides). In the present study, the presence of integrons was analysed in all the strains with a phenotype of resistance to sulfamethoxazole-trimethoprim. No strains were noted that had Class 1 (intI1) or Class 2 (intI2) integrons, and neither was the qacEΔ1 gene, usually present in Class 1 integrons, nor the variable region genes rvintI1 and rvintI2 detected.
Resistance to sulphonamides is encoded by the sul1, sul2 and sul3 genes, which modify the zones that are targeted by these substances [56]. The importance of the sul3 gene should be highlighted due to its considerable capacity to transfer between different populations of bacteria [43]. Noteworthy among the results of the present study was that all the strains with full or partial resistance to sulfamethoxazole-trimethoprim (5.41%) contained the sul1, sul2 and sul3 genes. These results concur with the findings of Radhouani et al. [43], Gonçalves et al. [46] and Momtaz et al. [51] in strains of E. coli of animal origin.
The acquisition of virulence factors, which can occur through horizontal transfer mechanisms, is the outcome of a process of natural selection among the microorganisms present in a host. To this effect, they manage to adapt and survive in the habitat they find themselves in, while simultaneously conferring a pathogenic nature on strains [57]. The emergence of potentially virulent strains that also have a multi-resistant phenotype is an alarming event, which can potentially cause serious clinical problems given the difficulty of treating infections by bacteria with antibiotic resistance [6,43].
Several reports have recorded that strains belonging to phylogenetic Groups B2 and D contain more virulence factors than strains from Groups A and B1 [24]. However, in the present work no differences were noted in the average number of resistance genes or virulence factors among the various phylogenetic groups.
The aer gene makes bacteria able to scavenge iron in conditions where it is scarce, which may happen inside infected animals, increasing bacterial ability to compete for nutrients and, in consequence, bacterial survival [58]. The presence of this gene has been linked to human urinary tract infections, neonatal meningitis and septicaemia [59]. Suárez et al. [60] studied E. coli isolates from the intestines of pigs in north-west Spain, finding that 12% of strains carried the aer gene. This value is much lower than was observed in the present study, in which the aer gene was detected in 56.76% of the strains (69.57% of those in phylogenetic Group B1, 41.67% in Group B2 and 0.00% in Group A). Furthermore, the results obtained from the present research are similar to those reported by Gonçalves et al. [46], who did not find this gene in strains from Group A, but did find it in the majority of strains from Group B1. On the other hand, Radhouani et al. [43] detected this gene in 40% of the strains belonging to Group B2, while it was not present in phylogenetic Groups A and B1.
The cnf1 gene, which determines the cytotoxic necrotizing factor, was detected in 21.74% of the strains from Group B1 and 25.00% of those from Group B2. These percentages are much higher than those recorded by other researchers, whether the isolates were of clinical origin (3%) [61] or collected in the environment (0% to 5.6%) [43,62].
The fimA gene, which encodes the major sub-unit of E. coli type 1 fimbriae that enable E. coli to adhere to epithelial cells thus encouraging infection, was detected in all the strains in the phylogenetic Groups B1 and B2, but was not present in those from Group A. These results agree with the findings of Radhouani et al. [43], who also observed the presence of this gene in 100% of the strains from Groups B1 and B2. Notably, however, these authors differed from the present study in that they also detected the fimA gene in 52.9% of the strains belonging to the phylogenetic Group A. Likewise, Gonçalves et al. [46] found that 80% of the strains in phylogenetic Group A carried this gene.
The hly gene, which gives rise to the production of toxins, was found by Tarchouna et al. [61] in 19% of the strains of E. coli isolated from patients with urinary tract infections. Interestingly, this figure is lower than the prevalence found in the current study, in which the hly gene was detected in all the strains belonging to phylogenetic Group B2 and in 17.39% of the strains from Group B1. For their part, Flores et al. [63] studied strains of E. coli isolated from lakes and springs in Portugal and found this gene in just a single strain belonging to Group B2.
The papGIII gene triggers the formation of P-related (Prs) fimbriae, which are actively involved in urinary tract infections. It was present in (50.00%) of the strains in phylogenetic Group A and in 66.67% of the strains from Group B2. Other research carried out on strains of E. coli of animal origin found varying but generally slight prevalence, ranging from 0% [43] to 15% [64].
The papC gene is present in the strains of E. coli responsible for urinary infections. It is essential for the formation of the fimbriae of the pyelonephritis-associated pili (Pap) type, which enable the bacteria to adhere to the epithelium of the urinary tract [65]. This gene was not present in any of the strains trialled. In line with the results reported here, other researchers have found a very low prevalence of the papC gene in bacteria of animal origin [43]. In contrast, when clinical samples from patients with urinary infections were investigated, Tarchouna et al. [61] detected the presence of the papC gene in 41% of the strains of E. coli analysed.
Last, the stx1 gene, which codes for the production of Shiga toxin [1], was not detected in any of the strains studied. This agrees with the findings of other researchers working with isolates of animal origin [62].

4. Materials and Methods

4.1. Strains

Thirty-seven strains of Escherichia coli type I (identified using the miniaturized API 20E system, bioMérieux, Marcy l’Étoile, France) were tested. They were isolated from the surface of 37 pigeon carcasses from north-west Spain, with one isolate studied from each carcass. Twenty-four of the pigeons had been reared in captivity (Columba livia) on a diet of hen feed, while 13 were from the wild (Columba palumbus). The domestic pigeons were slaughtered and the wild pigeons were obtained directly from hunters. Immediately after death, the birds were plucked, eviscerated and transported in an ice chest to the laboratory, where they were kept under refrigeration (4 °C). Less than 24 h elapsed from death to analysis.

4.2. Antibiotic Susceptibility Testing

The susceptibility of the strains to a total of 16 antimicrobials of clinical importance was tested. The antimicrobials were nalidixic acid (NA; 30 µg), ciprofloxacin (CIP; 5 µg), amoxicillin-clavulanic acid (AMC; 20/10 µg), ampicillin (AMP, 10 µg), imipenem (IPM, 10 µg), aztreonam (ATM, 30 µg), cefoxitin (FOX, 30 µg), cefotaxime (CTX, 30 µg), ceftazidime (CAZ, 10 µg), chloramphenicol (C, 30 µg), gentamicin (CN, 10 µg), amikacin (AK, 30 µg), streptomycin (STR, 10 µg), tobramycin (TOB, 10 µg), tetracycline (TE, 30 µg) and sulfamethoxazole-trimethoprim (SXT, 25 µg) (Figure 3). All the antibiotic discs were obtained from Oxoid Ltd. (Hampshire, England).
The United States National Committee for Clinical and Laboratory Standards (CLSI) guidelines [66] were used to produce the antibiograms (disc diffusion on Mueller-Hinton agar, Oxoid; with incubation for 24 h at 37 °C) and to interpret the inhibition halos. The inhibition zones were measured and scored as sensitive, intermediate (with reduced susceptibility) or resistant. Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 29213 were used as the reference strains for the antibiotic disc control.

4.3. Phenotypic Determination of Extended Spectrum β-Lactamases (ESBLs)

ESBL phenotypic detection was carried out using the double-disk synergy test. Mueller–Hinton agar plates (Oxoid) were used with discs of the antibiotics ceftazidime, cefotaxime, aztreonam and amoxicillin-clavulanic acid (Oxoid), the latter being placed in the middle of the other three. The discs were placed at a distance of 2 cm from one another and the plates were incubated for 24 h at 37 °C. A phenotype was deemed positive for the production of ESBLs when an increase in the size of the halo was observable in the zone where the inhibition halos of amoxicillin-clavulanic acid intersected with the other three antibiotics. This so-called “ghost zone” is due to the inhibition of ESBLs by clavulanic acid [67].

4.4. Genotypic Characterization

For the DNA extraction, the strains were first streaked onto tryptone soya plates (TSA, Oxoid) and incubated for 24 h at 37 °C. They were then transferred to an Eppendorf tube with 0.5 ml of milliQ sterile water and brought to 100 °C in an H-BLOC thermal block (Selecta, Barcelona, Spain) for 8 minutes. Quantification of the extracted DNA was performed with the aid of a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Inc., West Palm Beach, Florida, U.S.A.). Concentrations of DNA of between 200 ng/μL and 800 ng/μL were considered as acceptable. Once the DNA was extracted, it was stored under refrigeration at 4 ± 1 °C ready for later use.
Polymerase chain reactions (PCRs) were carried out in a total volume of 25 µL made up of 0.5 µM of each primer (Isogen Life Science, Barcelona, Spain), 0.2 mM of deoxynucleoside triphosphates (dNTPs) mix (GeneAmp® dNTP blend, Thermo Fisher Scientific), PCR incomplete buffer 1× (Bioron GmbH, Ludwigshafen, Germany), 1.5 mM of MgCl2 (Bioron), 1.25 U of taq DNA polymerase (Bioron) and 5 µl of extracted solution of bacterial DNA.
DNA amplifications were performed in a Mastercycler (Eppendorf Ibérica S.L.U., Madrid, Spain). The PCR products were separated by horizontal electrophoresis through 1% (wt/vol) agarose gels (Bioron) in TAE buffer 1×, stained with GelRed (Biotium Inc., Hayward, California, U.S.A.), diluted to 1:10,000, and visualized and photographed on a UV transilluminator (Gel Doc™ EZ System; Bio-Rad, Hercules, California, U.S.A.). The size of each PCR product was estimated using standard molecular weight markers (1-kb DNA ladder; Bioron). Negative controls (samples without DNA templates) and positive controls (samples with DNA from positive strains) were included in all PCR assays.
The phylogenetic group of each strain was determined in accordance with Clermont et al. [68], by means of multiplex polymerase chain reaction (PCR) of the genetic markers chuA and yjaA and the DNA fragment tspE4.C2, using the specific primers and conditions shown in Table 3. The strains were assigned to the phylogenetic groups A (chuaA- and tspE4.C2-), B1 (chuaA- and tspE4.C2+), B2 (chuaA+ and yjaA+) or D (chuaA+ and yjaA-).
Genes for resistance to quinolones (gyrA and parC), β-lactams (ampC), chloramphenicol (cmlA), streptomycin (aadA), gentamicin (aac(3)II and aac(3)IV), tetracycline (tetA, tetB and tetC), and trimethoprim-sulfamethoxazole (sul1, sul2 and sul3) were studied by specific PCR. The presence of the intl1 and intl2 genes, encoding Class 1 and 2 integrases, respectively, and their variable region (vrintl1 and vrintl2) were also analysed by PCR. Additionally, the presence of the qacEΔ1 region was studied, given that this is associated with sul3 and non-classical Class 1 integrons. The oligonucleotide sequences of the primers used and the amplification conditions are given in Table 4.
The presence of genes involved in the expression of aerolysin (aer), necrotizing factor type 1 (cnf1), type 1 fimbriae (fimA), haemolysin (hly), type C fimbriae (papC), adhesin PapG class III (papGIII) and Shiga toxin 1 (stx1) was also investigated by PCR (Table 5). Positive and negative PCR controls from the bacterial collection of the University of Trás-os-Montes and Alto Douro (Vila Real, Portugal) were used in all the assays.

4.5. Statistical Analysis

The prevalence of resistant strains and the prevalence of resistance genes in the various groups of isolates (from both wild and domestic birds) were compared using Fisher’s exact test. Significant differences were set at a probability level of 5% (P < 0.05). The Statistica® 8.0 package (Statsoft Ltd., Tulsa, Oklahoma, U.S.A.) was used to carry out the statistical analysis.

5. Conclusions

As a general conclusion, it must be highlighted that pigeon meat is a major reservoir of strains of Escherichia coli resistant to agents listed as critically important antimicrobials for human medicine, which is of major concern for public health. Moreover, 32.43% of the strains of E. coli analysed belonged to phylogenetic groups considered as pathogenic (specifically Group B2) and are normally responsible for extra-intestinal infections in humans. More than 97% of the strains carried one or more virulence factors. These findings are worrying in the context of food safety and public health, not just because of the direct risk of infection through consuming food contaminated with E. coli, but also because of the major indirect risk arising from possible horizontal transfers of genes into other pathogenic bacteria. Moreover, the mobility of pigeons, which often make long journeys, facilitates the spread of bacteria carrying resistance genes or virulence factors, or the genes themselves, in the environment.
The results presented here show that bacteria isolated from birds reared in close proximity to human populations have the highest prevalence of antibiotic resistance. However, resistant bacteria were also found in wild pigeons, indicating that environmental exposure to antimicrobials, antimicrobial residues, resistant bacteria or resistance genes is widespread. To this effect, the presence of strains resistant to antibiotics in ecosystems that have not been subjected to selective pressures enables these animals to be used as biological indicators of resistance to antibiotics.

Author Contributions

Conceptualization, R.C. and C.A.-C.; data curation, R.C. and J.C.; formal analysis, R.C., J.C., D.M.-G. and C.A.-C.; funding acquisition, R.C. and C.A.-C.; investigation, R.C., J.C. and C.A.-C.; methodology, R.C., D.M.-G., G.I. and P.P.; project administration, C.A.-C.; resources, R.C. and C.A.-C.; software, R.C.; supervision, R.C. and C.A.-C.; validation, R.C. and C.A.-C.; visualization, C.A.-C.; writing—original draft, J.C. and R.C.; writing—review and editing, R.C., G.I., P.P. and C.A.-C.

Funding

This research was funded by the Ministerio de Ciencia, Innovación y Universidades (Spain, Project RTI2018-098267-R-C33) and by the Junta de Castilla y León (Consejería de Educación, Spain, Project LE164G18).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
  2. Brzuszkiewicz, E.; Thurmer, A.; Schuldes, J.; Leimbach, A.; Liesegang, H.; Meyer, F.D.; Boelter, J.; Petersen, H.; Gottschalk, G.; Daniel, R. Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: Entero-Aggregative-Haemorrhagic Escherichia coli (EAHEC). Arch. Microbiol. 2011, 193, 883–891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. EFSA and ECDC. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA J. 2018, 16, e05500. [Google Scholar]
  4. Hamadi, F.; Latrache, H.; Zahir, H.; Elghmari, A.; Timinouni, M.; Ellouali, M. The relation between Escherichia coli surface functional groups’ composition and their physicochemical properties. Braz. J. Microbiol. 2008, 39, 10–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. OECD. Antimicrobial Resistance. Tackling the Burden in the European Union. 2019. Available online: https://www.oecd.org/health/health-systems/AMR-Tackling-the-Burden-in-the-EU-OECD-ECDC-Briefing-Note-2019.pdf (accessed on 15 September 2019).
  6. Capita, R.; Alonso-Calleja, C. Antibiotic-resistant bacteria: A challenge for the food industry. Crit. Rev. Food Sci. Nutr. 2013, 53, 11–48. [Google Scholar] [CrossRef] [PubMed]
  7. Wu, J.; Huang, Y.; Rao, D.; Zhang, Y.; Yang, K. Evidence for environmental dissemination of antibiotic resistance mediated by wild birds. Front. Microbiol. 2018, 9, 745. [Google Scholar] [CrossRef]
  8. Paulsen, P. Hygiene and microbiology of meat from wild game: An Australian view. In Game Meat Hygiene in Focus: Microbiology, Epidemiology, Risk Analysis and Quality Assurance; Paulsen, P., Bauer, A., Vodnansly, M., Winkelmayer, R., Smulders, F.J.M., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2011; pp. 19–37. [Google Scholar]
  9. Radimersky, T.; Frolkova, P.; Janoszowska, D.; Dolejska, M.; Svec, P.; Roubalova, E.; Cikova, P.; Cizek, A.; Literak, I. Antibiotic resistance in faecal bacteria (Escherichia coli, Enterococcus spp.) in feral pigeons. J. Appl. Microbiol. 2010, 109, 1687–1695. [Google Scholar] [CrossRef]
  10. Allen, S.E.; Boerlin, P.; Janecko, N.; Lumsden, J.S.; Barker, I.K.; Pearl, D.L.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in generic Escherichia coli isolates from wild small mammals living in swine farm, residential, landfill, and natural environments in southern Ontario, Canada. Appl. Environ. Microbiol. 2011, 77, 882–888. [Google Scholar] [CrossRef] [Green Version]
  11. Gonçalves, A.; Igrejas, G.; Radhouani, H.; Correia, S.; Pacheco, R.; Santos, T.; Monteiro, R.; Guerra, A.; Petrucci-Fonseca, F.; Brito, F.; et al. Antimicrobial resistance in faecal enterococci and Escherichia coli isolates recovered from Iberian wolf. Lett. Appl. Microbiol. 2013, 56, 268–274. [Google Scholar] [CrossRef]
  12. Zigo, F.; Takac, L.; Zigova, M.; Takacova, J.; Vasi, M. Occurrence of antibiotic-resistant bacterial strains isolated in carrier pigeons during the race season. J. Chem. Pharm. Sci. 2017, 10, 10–13. [Google Scholar]
  13. Kimpe, A.; Decostere, A.; Martel, A.; Haesebrouck, F.; Devriese, L.A. Prevalence of antimicrobial resistance among pigeon isolates of Streptococcus gallolyticus, Escherichia coli and Salmonella enterica serotype Typhimurium. Avian Pathol. 2002, 31, 393–397. [Google Scholar] [CrossRef] [PubMed]
  14. Iroha, I.; Afiukwa, F.; Oji, A.; Ejikeugwu, P.; Nwakeze, E. Occurrence of extended spectrum beta lactamase producing Escherichia coli from human clinical and wild birds (pigeons, bats, parrots and ducks) samples from Ebonyi state, Nigeria. World J. Pharm. Sci. 2015, 4, 20–29. [Google Scholar]
  15. Borges, C.A.; Cardozo, M.V.; Beraldo, L.G.; Oliveira, E.S.; Maluta, R.P.; Barboza, K.B.; Werther, K.; Ávila, F.A. Wild birds and urban pigeons as reservoirs for diarrheagenic Escherichia coli with zoonotic potential. J. Microbiol. 2017, 55, 344–348. [Google Scholar] [CrossRef] [PubMed]
  16. Cosgrove, S.E. The relationship between antimicrobial resistance and patient outcomes: Mortality, length of hospital stays, and health care costs. Clin. Infect. Dis. 2006, 42 (Suppl. S2), S82–S89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Tumbarello, M.; Spanu, T.; Di Bidino, R.; Marchetti, M.; Ruggeri, M.; Trecarichi, E.M.; De Pascale, G.; Proli, E.M.; Cauda, R.; Cicchetti, A.; et al. Costs of bloodstream infections caused by Escherichia coli and influence of extended-spectrum-beta-lactamase production and inadequate initial antibiotic therapy. Antimicrob. Agents Chemother. 2010, 54, 4085–4091. [Google Scholar] [CrossRef] [Green Version]
  18. WHO. Critically Important Antimicrobials for Human Medicine, 6th ed.; World Health Organization: Geneva, Switzerland, 2009. [Google Scholar]
  19. OIE. OIE List of Antimicrobial Agents of Veterinary Importance; World Organization for Animal Health: Paris, France, 2018. [Google Scholar]
  20. Ishiguro, N.; Oka, C.; Sato, G. Isolation of citrate-positive variants of Escherichia coli from domestic pigeons, pigs, cattle, and horses. Appl. Environ. Microbiol. 1978, 36, 217–222. [Google Scholar]
  21. Guerra, B.; Junker, E.; Schroeter, A.; Malorny, B.; Lehmann, S.; Helmuth, R. Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. J. Antimicrob. Chemother. 2003, 52, 489–492. [Google Scholar] [CrossRef]
  22. Costa, D.; Poeta, P.; Saenz, Y.; Vinue, L.; Rojo-Bezares, B.; Jouini, A.; Zarazaga, M.; Rodrigues, M.J.; Torres, C. Detection of Escherichia coli harbouring extended-spectrum beta-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J. Antimicrob. Chemother. 2006, 58, 1311–1312. [Google Scholar] [CrossRef]
  23. Radhouani, H.; Poeta, P.; Igrejas, G.; Goncalves, A.; Vinue, L.; Torres, C. Antimicrobial resistance and phylogenetic groups in isolates of Escherichia coli from seagulls at the Berlengas nature reserve. Vet. Rec. 2009, 165, 138–142. [Google Scholar] [CrossRef]
  24. Radhouani, H.; Igrejas, G.; Gonçalves, A.; Pacheco, R.; Monteiro, R.; Sargo, R.; Brito, F.; Torres, V.; Poeta, P. Antimicrobial resistance and virulence genes in Escherichia coli and enterococci from red foxes (Vulpes vulpes). Anaerobe 2013, 23, 82–86. [Google Scholar] [CrossRef]
  25. Stenzel, T.; Bancerz-Kisiel, A.; Tykałowski, B.; Śmiałek, M.; Pestka, D.; Koncicki, A. Antimicrobial resistance in bacteria isolated from pigeons in Poland. Pol. J. Vet. Sci. 2014, 17, 169–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Alonso-Hernando, A.; Prieto, M.; García-Fernández, C.; Alonso-Calleja, C.; Capita, R. Increase over time in the prevalence of multiple antibiotic resistance among isolates of Listeria monocytogenes from poultry in Spain. Food Control 2012, 23, 37–41. [Google Scholar] [CrossRef]
  27. Álvarez-Fernández, E.; Cancelo, A.; Díaz-Vega, C.; Capita, R.; Alonso-Calleja, C. Antimicrobial resistance in E. coli isolates from conventionally and organically reared poultry: A comparison of agar disc diffusion and Sensi Test Gram-negative methods. Food Control 2013, 30, 227–234. [Google Scholar] [CrossRef]
  28. Guerrero-Ramos, E.; Molina-González, D.; Blanco-Morán, S.; Igrejas, G.; Poeta, P.; Alonso-Calleja, C.; Capita, R. Prevalence, antimicrobial resistance, and genotypic characterization of vancomycin-resistant enterococci in meat preparations. J. Food Protect. 2016, 79, 748–756. [Google Scholar] [CrossRef] [PubMed]
  29. Guerrero-Ramos, E.; Cordero, J.; Molina-González, D.; Poeta, P.; Igrejas, G.; Alonso-Calleja, C.; Capita, R. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain. Food Microbiol. 2016, 53, 156–164. [Google Scholar] [CrossRef]
  30. Buzón-Durán, L.; Capita, R.; Alonso-Calleja, C. Microbial loads and antibiotic resistance patterns of Staphylococcus aureus in different types of raw poultry-based meat preparations. Poult. Sci. 2017, 96, 4046–4052. [Google Scholar] [CrossRef]
  31. Cordero, J.; Alonso-Calleja, C.; García-Fernández, C.; Capita, R. Microbial load and antibiotic resistance patterns of Escherichia coli and Enterococcus faecalis isolates from the meat of wild and domestic pigeons. Foods 2019, 8. [Google Scholar] [CrossRef] [Green Version]
  32. Silva, V.L.; Nicoli, J.R.; Nascimento, T.C.; Diniz, C.G. Diarrheagenic Escherichia coli strains recovered from urban pigeons (Columba livia) in Brazil and their antimicrobial susceptibility patterns. Curr. Microbiol. 2009, 59, 302–308. [Google Scholar] [CrossRef]
  33. Hasan, B.; Islam, K.; Ahsan, M.; Hossain, Z.; Rashid, M.; Talukder, B.; Ahmed, K.U.; Olsen, B.; Kashem, M.A. Fecal carriage of multi-drug resistant and extended spectrum beta-lactamases producing E. coli in household pigeons, Bangladesh. Vet. Microbiol. 2014, 168, 221–224. [Google Scholar] [CrossRef]
  34. Santos, T.; Silva, N.; Igrejas, G.; Rodrigues, P.; Micael, J.; Rodrigues, T.; Resendes, R.; Goncalves, A.; Marinho, C.; Goncalves, D.; et al. Dissemination of antibiotic resistant Enterococcus spp. and Escherichia coli from wild birds of Azores Archipelago. Anaerobe 2013, 24, 25–31. [Google Scholar] [CrossRef]
  35. Hata, A.; Shibahara, T.; Yamamoto, H.; Fujitani, N. Antimicrobial resistance of Enterobacteriaceae in feral pigeons living in the Kanto region of Japan. Int. J. Anal. Bio-Sci. 2018, 6, 10–18. [Google Scholar]
  36. Álvarez-Fernández, E.; Alonso-Calleja, C.; García-Fernández, C.; Capita, R. Prevalence and antimicrobial resistance of Salmonella serotypes isolated from poultry in Spain: Comparison between 1993 and 2006. Int. J. Food Microbiol. 2012, 153, 281–287. [Google Scholar] [CrossRef] [PubMed]
  37. Navarro-González, N.; Casas-Díaz, E.; Porrero, C.M.; Mateos, A.; Domínguez, L.; Lavín, S.; Serrano, E. Food-borne zoonotic pathogens and antimicrobial resistance of indicator bacteria in urban wild boars in Barcelona, Spain. Vet. Microbiol. 2013, 167, 686–689. [Google Scholar] [CrossRef] [PubMed]
  38. Radhouani, H.; Silva, N.; Poeta, P.; Torres, C.; Correia, S.; Igrejas, G. Potential impact of antimicrobial resistance in wildlife, environment and human health. Front. Microbiol. 2014, 5, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Doming, K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef] [PubMed]
  40. Machado, E.; Coque, T.M.; Cantón, R.; Sousa, J.C.; Peixe, L. Antibiotic resistance integrons and extended-spectrum β-lactamases among Enterobacteriaceae isolates recovered from chickens and swine in Portugal. J. Antimicrob. Chemother. 2008, 62, 296–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Poeta, P.; Radhouani, H.; Pinto, L.; Martinho, A.; Rego, V.; Rodrigues, R.; Gonçalves, A.; Rodrigues, J.; Estepa, V.; Torres, C.; et al. Wild boars as reservoirs of extended-spectrum beta-lactamase (ESBL) producing Escherichia coli of different phylogenetic groups. J. Basic Microbiol. 2009, 49, 584–588. [Google Scholar] [CrossRef]
  42. Carlos, C.; Pires, M.M.; Stoppe, N.C.; Hachich, E.M.; Sato, M.I.Z.; Gomes, T.A.T.; Amaral, L.A.; Ottoboni, L.M.M. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol. 2010, 10, 161. [Google Scholar] [CrossRef] [Green Version]
  43. Radhouani, H.; Poeta, P.; Goncalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef]
  44. Chakraborty, A.; Saralaya, V.; Adhikari, P.; Shenoy, S.; Baliga, S.; Hegde, A. Characterization of Escherichia coli phylogenetic groups associated with extraintestinal infections in South Indian population. Ann. Med. Health Sci. Res. 2015, 5, 241–246. [Google Scholar]
  45. Sáenz, Y. Caracterización Fenotípica y Genotípica de la Resistencia a Antibióticos en Cepas de Escherichia coli no Patógenas de Alimentos y de la Microflora Intestinal de Humanos y Animales; Tesis Doctoral, Universidad de La Rioja: Logroño, Spain, 2004. [Google Scholar]
  46. Gonçalves, A.; Igrejas, G.; Radhouani, H.; Estepa, V.; Pacheco, R.; Monteiro, R.; Brito, F.; Guerra, A.; Petrucci-Fonseca, F.; Torres, C.; et al. Iberian wolf as a reservoir of extended-spectrum beta-lactamase-producing Escherichia coli of the TEM, SHV, and CTX-M groups. Microb. Drug Res. 2012, 18, 215–219. [Google Scholar] [CrossRef] [PubMed]
  47. Li, X.Z.; Mehrotra, M.; Ghimire, S.; Adewoye, L. Beta-Lactam resistance and beta-lactamases in bacteria of animal origin. Vet. Microbiol. 2007, 121, 97–214. [Google Scholar] [CrossRef] [PubMed]
  48. Carattoli, A. Animal reservoirs for extended spectrum beta-lactamase producers. Clin. Microbiol. Infect. 2008, 14, 117–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Kim, E.; Aoki, T. Sequence analysis of the florfenicol resistance gene encoded in the transferable R-plasmid of a fish pathogen, Pasteurella piscicida. Microbiol. Immunol. 1996, 40, 665–669. [Google Scholar] [CrossRef] [PubMed]
  50. Bischoff, K.M.; White, D.G.; Hume, M.E.; Poole, T.L.; Nisbet, D.J. The chloramphenicol resistance gene cmlA is disseminated on transferable plasmids that confer multiple-drug resistance in swine Escherichia coli. FEMS Microbiol. Lett. 2005, 243, 285–291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Momtaz, H.; Rahimi, E.; Moshkelani, S. Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran. Vet. Med. 2012, 57, 193–197. [Google Scholar] [CrossRef] [Green Version]
  52. Sousa, J.C.F.; Peixe, L.V. Antibióticos Antibacterianos. In Microbiologia; Ferreira, W.F.C., Sousa, J.C.F., Lima, N., Eds.; LIDEL—Edições Técnicas, Lda: Lisboa, Portugal, 2000; pp. 453–469. [Google Scholar]
  53. Altalhi, A.D.; Gherbawy, Y.A.; Hassan, S.A. Antibiotic resistance in Escherichia coli isolated from retail raw chicken meat in Taif, Saudi Arabia. Foodborne Pathog. Dis. 2000, 7, 281–285. [Google Scholar] [CrossRef]
  54. Literak, I.; Dolejska, M.; Janoszowska, D.; Hrusakova, J.; Meissner, W.; Rzyska, H.; Bzoma, S.; Cizek, A. Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland. Appl. Environ. Microbiol. 2010, 76, 8126–8134. [Google Scholar] [CrossRef] [Green Version]
  55. Pereira, J.M. Elementos genéticos móveis. In Microbiologia; Ferreira, W.F.C., Sousa, J.C.F., Lima, N., Eds.; LIDEL—Edições Técnicas, Lda: Lisboa, Portugal, 2010; pp. 261–282. [Google Scholar]
  56. Perreten, V.; Boerlin, P. A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland. Antimicrob. Agents Chemother. 2003, 47, 1169–1172. [Google Scholar] [CrossRef] [Green Version]
  57. Appelberg, R. Virulência Microbiana. In Microbiologia; Ferreira, W.F.C., Sousa, J.C.F., Lima, N., Eds.; Edições Técnicas, Lda: Lisboa, Portugal, 2010; pp. 261–282. [Google Scholar]
  58. Warner, P.J.; Williams, P.H.; Bindereif, A.; Neilands, J.B. ColV plasmid-specific aerobactin synthesis by invasive strains of Escherichia coli. Infect. Immun. 1981, 33, 540–545. [Google Scholar]
  59. Gado, I.; Milch, H.; Czirok, E.; Herpay, M. The frequency of aerobactin production and its effect on the pathogenicity of human Escherichia coli strains. Acta Microbiol. Hung. 1989, 36, 51–60. [Google Scholar] [PubMed]
  60. Suárez, S.; Celemin, C.; Zdunczyr, E.; Medina, E.; Williams, P.H. Aerobactin production by enterotoxigenic Escherichia coli of porcine intestine. Vet. Microbiol. 1995, 47, 229–233. [Google Scholar] [CrossRef]
  61. Tarchouna, M.; Ferjani, A.; Ben-Selma, W.; Boukadida, J. Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int. J. Infect. Dis. 2013, 17, e450–e453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Gonçalves, A.; Igrejas, G.; Radhouani, H.; Estepa, V.; Alcaide, E.; Zorrilla, I.; Serra, R.; Torres, C.; Poeta, P. Detection of extended-spectrum beta-lactamase-producing Escherichia coli isolates in faecal samples of Iberian lynx. Lett. Appl. Microbiol. 2012, 54, 73–77. [Google Scholar] [CrossRef]
  63. Flores, C.E.; Loureiro, L.; Bessa, L.J.; Martins Da Costa, P. Presence of multidrug-resistant E. coli, Enterococcus spp. and Salmonella spp. in lakes and fountains of Porto, Portugal. J. Water Res. Prot. 2013, 5, 1117–1126. [Google Scholar] [CrossRef] [Green Version]
  64. Stenske, K.A.; Bemis, D.A.; Gillespie, B.E.; Oliver, S.P.; Draughon, F.A.; Matteson, K.J.; Bartges, J.W. Prevalence of urovirulence genes cnf, hlyD, sfa/foc, and papGIII in fecal Escherichia coli from healthy dogs and their owners. Am. J. Vet. Res. 2009, 70, 1401–1406. [Google Scholar] [CrossRef] [Green Version]
  65. Norgren, M.; Bága, M.; Tennent, J.M.; Normark, S. Nucleotide sequence, regulation and functional analysis of the papC gene required for cell surface localization of Pap pili of uropathogenic Escherichia coli. Mol. Microbiol. 1987, 1, 169–178. [Google Scholar] [CrossRef]
  66. CLSI. M100 Performance Standards for Antimicrobial Susceptibility Testing, 29th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2019. [Google Scholar]
  67. Cormican, M.G.; Marshall, S.A.; Jones, R.N. Detection of extended-spectrum beta-lactamase (ESBL)-producing strains by the Etest ESBL screen. J. Clin. Microbiol. 1996, 34, 1880–1884. [Google Scholar]
  68. Clermont, O.; Bonacorsi, S.; Bingen, E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef] [Green Version]
  69. Oram, M.; Fisher, L.M. 4-Quinolone resistance mutations in the DNA gyrase of Escherichia coli clinical isolates identified by using the polymerase chain reaction. Antimicrob. Agents Chemother. 1991, 35, 387–389. [Google Scholar] [CrossRef] [Green Version]
  70. Vila, J.; Ruiz, J.; Goni, P.; De Anta, M.T. Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli. Antimicrob. Agents Chemother. 1996, 40, 491–493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Stapleton, P.D.; Shannon, K.P.; French, G.L. Carbapenem resistance in Escherichia coli associated with plasmid-determined CMY-4 beta-lactamase production and loss of an outer membrane protein. Antimicrob. Agents Chemother. 1999, 43, 1206–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Sáenz, Y.; Briñas, L.; Domínguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Hollingshead, S.; Vapnek, D. Nucleotide sequence analysis of the gene encoding a streptomycin/spectinomycin adenylyltransferase. Plasmid 1985, 13, 17–30. [Google Scholar] [CrossRef]
  74. Guardabassi, L.; Dijkshoorn, L.; Collard, J.M.; Olsen, J.E.; Dalsgaard, A. Distribution and in-vitro transfer of tetracycline resistance determinants in clinical and aquatic Acinetobacter strains. J. Med. Microbiol. 2000, 49, 929–936. [Google Scholar] [CrossRef] [Green Version]
  75. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [Google Scholar] [CrossRef] [Green Version]
  76. Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Lariviere, S.; Harel, J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef] [Green Version]
  77. Levesque, C.; Roy, P.H. PCR Analysis of integrons. In Diagnostic Molecular Microbiology; Persing, D.H., Smith, T.F., Tenover, C.F., Whith, T.J., Eds.; American Society for Microbiology: Washington, DC, USA, 1993; pp. 590–594. [Google Scholar]
  78. White, P.A.; McIver, C.J.; Rawlinson, W.D. Integrons and gene cassettes in the enterobacteriaceae. Antimicrob. Agents Chemother. 2001, 45, 2658–2661. [Google Scholar] [CrossRef] [Green Version]
  79. Yamamoto, S.; Terai, A.; Yuri, K.; Kurazono, H.; Takeda, Y.; Yoshida, O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol. Med. Microbiol. 1995, 12, 85–90. [Google Scholar] [CrossRef]
  80. Ruiz, J.; Simon, K.; Horcajada, J.P.; Velasco, M.; Barranco, M.; Roig, G.; Moreno-Martinez, A.; Martinez, J.A.; Jimenez De Anta, T.; Mensa, J.; et al. Differences in virulence factors among clinical isolates of Escherichia coli causing cystitis and pyelonephritis in women and prostatitis in men. J. Clin. Microbiol. 2002, 40, 4445–4449. [Google Scholar] [CrossRef] [Green Version]
  81. Paton, J.C.; Paton, A.W. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 1998, 11, 450–479. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Antibiotics 08 00259 g001 550
Figure 1. Percentage of Escherichia coli strains sensitive, intermediate or resistant to each antibiotic tested. Nalidixic acid (NA), ciprofloxacin (CIP), amoxicillin-clavulanic acid (AMC), ampicillin (AMP), imipenem (IPM), aztreonam (ATM), cefoxitin (FOX), ceftazidime (CAZ), cefotaxime (CTX), chloramphenicol (C), gentamicin (CN), amikacin (AK), streptomycin (STR), tobramycin (TOB), tetracycline (TE) and sulfamethoxazole- trimethoprim (SXT).
Figure 1. Percentage of Escherichia coli strains sensitive, intermediate or resistant to each antibiotic tested. Nalidixic acid (NA), ciprofloxacin (CIP), amoxicillin-clavulanic acid (AMC), ampicillin (AMP), imipenem (IPM), aztreonam (ATM), cefoxitin (FOX), ceftazidime (CAZ), cefotaxime (CTX), chloramphenicol (C), gentamicin (CN), amikacin (AK), streptomycin (STR), tobramycin (TOB), tetracycline (TE) and sulfamethoxazole- trimethoprim (SXT).
Antibiotics 08 00259 g001
Antibiotics 08 00259 g002 550
Figure 2. Percentage of Escherichia coli strains harbouring each antibiotic resistance gene studied. Genes for resistance to quinolones (gyrA, parC), β-lactams (ampC), chloramphenicol (cmlA), streptomycin (aadA), gentamicin (aac(3)II, aac(3)IV), tetracycine (tetA, tetB, tetC) and trimethoprim-sulfamethoxazole (sul1, sul2, sul3) were studied by PCR. The resence of the intl1 and intl2 genes, encoding Class 1 and 2 integrases, respectively, their variable region (vrintl1, vrintl2), and the presence of the qacEΔ1 region, were also studied.
Figure 2. Percentage of Escherichia coli strains harbouring each antibiotic resistance gene studied. Genes for resistance to quinolones (gyrA, parC), β-lactams (ampC), chloramphenicol (cmlA), streptomycin (aadA), gentamicin (aac(3)II, aac(3)IV), tetracycine (tetA, tetB, tetC) and trimethoprim-sulfamethoxazole (sul1, sul2, sul3) were studied by PCR. The resence of the intl1 and intl2 genes, encoding Class 1 and 2 integrases, respectively, their variable region (vrintl1, vrintl2), and the presence of the qacEΔ1 region, were also studied.
Antibiotics 08 00259 g002
Antibiotics 08 00259 g003 550
Figure 3. Chemical structure of the 16 antibiotics tested; β-lactams are in red.
Figure 3. Chemical structure of the 16 antibiotics tested; β-lactams are in red.
Antibiotics 08 00259 g003
Table
Table 1. Antibiotic resistance patterns in the thirty-seven Escherichia coli strains tested.
Table 1. Antibiotic resistance patterns in the thirty-seven Escherichia coli strains tested.
Strain NumberOriginResistance Pattern
22Domestic pigeonAMP/ATM/STR
19Domestic pigeonAMP/CAZ/STR
12Domestic pigeonAMC/AMP/CAZ/STR
13Domestic pigeonAMC/AMP/CAZ/STR
18Domestic pigeonAMC/AMP/CAZ/STR
4Domestic pigeonAMC/AMP/STR/TE
24Domestic pigeonAMP/ATM/ CAZ/CTX
14Domestic pigeonAMP/CAZ/CN/STR
16Domestic pigeonAMP/CAZ/AK/STR
7Domestic pigeonAMP/CAZ/STR/TE
9Domestic pigeonAMP/CAZ/STR/TE
1Domestic pigeonAMC/AMP/CAZ/STR/TE
5Domestic pigeonAMC/AMP/CAZ/STR/TE
6Domestic pigeonAMC/AMP/CAZ/STR/TE
10Domestic pigeonAMC/AMP/CAZ/STR/TE
11Domestic pigeonAMC/AMP/CAZ/STR/TE
21Domestic pigeonAMC/AMP/CAZ/STR/TE
23Domestic pigeonAMC/AMP/CAZ/STR/TE
15Domestic pigeonAMP/CAZ/C/AK/STR
20Domestic pigeonAMP/CAZ/AK/STR/TOB
3Domestic pigeonAMP/CAZ/CTX/STR/TOB/TE
2Domestic pigeonNA/AMC/AMP/CAZ/STR/TOB/TE/SXT
17Domestic pigeonCIP/AMC/AMP/CAZ/C/CN/AK/STR
8Domestic pigeonAMC/AMP/ FOX/CAZ/C/AK/TOB/TE
28Wild pigeonAMP/CAZ
25Wild pigeonAMP/CAZ/STR
32Wild pigeonAMP/CAZ/STR
37Wild pigeonAMP/CAZ/TE
34Wild pigeonNA/AMP/CAZ/TE
30Wild pigeonAMC/AMP/CAZ/STR
33Wild pigeonAMC/AMP/CAZ/STR
27Wild pigeonAMC/AMP/CAZ/STR
31Wild pigeonAMP/CAZ/STR/TE
36Wild pigeonAMP/CAZ/STR/SXT
29Wild pigeonAMP/FOX/CAZ/CTX/TE
35Wild pigeonAMP/ FOX/CAZ/ STR/TOB/TE
26Wild pigeonAMC/AMP/CAZ/C/ CN/STR/TE
Nalidixic acid (NA), ciprofloxacin (CIP), amoxicillin-clavulanic acid (AMC), ampicillin (AMP), aztreonam (ATM), cefoxitin (FOX), ceftazidime (CAZ), cefotaxime (CTX), chloramphenicol (C), gentamicin (CN), amikacin (AK), streptomycin (STR), tobramycin (TOB), tetracycline (TE) and sulfamethoxazole- trimethoprim (SXT).
Table
Table 2. Virulence factors present in the Escherichia coli strains tested.
Table 2. Virulence factors present in the Escherichia coli strains tested.
Virulence FactorsNumber of Strains
fimA4
papGIII1
aer/fimA14
cnf1/fimA1
fimA/hly4
cnf1/fimA/hly4
aer/fimA/hly/papGIII5
cnf1/fimA/hly/papGIII1
aer/cnf1/fimA/hly/papGIII2
None1
Table
Table 3. Target genes and primers used in the PCRs performed in this study to determine Escherichia coli phylogenetic groups.
Table 3. Target genes and primers used in the PCRs performed in this study to determine Escherichia coli phylogenetic groups.
Target GenePrimer NameSequence (5′-3′)Annealing Temperature (°C) (Amplicon Size, bp)Reference
chuaAchuaA-FGACGAACCAACGGTCAGGAT55 (279)[68]
chuaA-RTGCCGCCAGTACCAAAGACA
tspE4.C2tspE4.C2-FGAGTAATGTCGGGGCATTCA55 (152)[68]
tspE4.C2-RCGCGCCAACAAAGTATTACG
yjaAyjaA-FTGAAGTGTCAGGAGACGCTG55 (211)[68]
yjaA-RATGGAGAATGCGTTCCTCAAC
Table
Table 4. Target genes and primers used in the PCRs performed in this study to determine the antibiotic resistance genes and integrons of Escherichia coli.
Table 4. Target genes and primers used in the PCRs performed in this study to determine the antibiotic resistance genes and integrons of Escherichia coli.
Target GenePrimer NameSequence (5′-3′)Annealing Temperature (°C) (Amplicon Size, bp)Reference
gyrAgyrA-FTACACCGGTCAACATTGAGG64 (648)[69]
gyrA-RTTAATGATTGCCGCCGTCGG
parCparC-FAAACCTGTTCAGCGCCGCATT55 (395)[70]
parC-RGTGGTGCCGTTAAGCAAA
ampCampC-FAATGGGTTTTCTACGGTCTG57 (1800)[71]
ampC-RGGGCAGCAAATGTGGAGCAA
cmlAcmlA-FTGTCATTTACGGCATACTCG55 (455)[72]
cmlA-RATCAGGCATCCCATTCCCAT
aadAaadA-FGCAGCGCAATGACATTCTTG60 (282)[73]
aadA-RATCCTTCGGCGCGATTTTG
aac(3)IIaac(3)II-FACTGTGATGGGATACGCGTC60 (237)[72]
aac(3)II-RCTCCGTCAGCGTTTCAGCTA
aac(3)IVaac(3)IV-FCTTCAGGATGGCAAGTTGGT60 (286)[72]
aac(3)IV-RTCATCTCGTTCTCCGCTCAT
tetAtetA-FGTAATTCTGAGCACTGTCGC62 (937)[74]
tetA-RCTGCCTGGACAACATTGCTT
tetBtetB-FCTCAGTATTCCAAGCCTTTG57 (416)[74]
tetB-RCTAAGCACTTGTCTCCTGTT
tetCtetC-FTCTAACAATGCGCTCATCGT62 (570)[74]
tetC-RGGTTGAAGGCTCTCAAGGGC
sul1sul1-FTGGTGACGGTGTTCGGCATTC63 (789)[75]
sul1-RGCGAGGGTTTCCGAGAAGGTG
sul2sul2-FCGGCATCGTCAACATAACC50 (722)[76]
sul2-RGTGTGCGGATGAAGTCAG
sul3sul3-FCATTCTAGAAAACAGTCGTAGTTCG51 (990)[56]
sul3-RCATCTGCAGCTAACCTAGGGCTTTGGA
intl1intl1-FGGGTCAAGGATCTGGATTTCG62 (483)[75]
intl1-RACATGGGTGTAAATCATCGTC
rvintl1rvintl1-FGGCATCCAAGCAGCAAG55 (variable)[77]
rvintl1-RAAGCAGACTTGACCTGA
qacEΔ1qacEΔ1-FGGCTGGCTTTTTCTTGTTATCG60 (287)[75]
qacEΔ1-RTGAGCCCCATACCTACAAAGC
intl2intl2-FCACGGATATGCGACAAAAAGGT62 (788)[75]
intl2-RGTAGCAAACGAGTGACGAAATG
rvintl2rvintl2-FCGGGATCCCGGACGGCATGCACGATTTGTA60 (variable)[78]
rvintl2-RGATGCCATCGCAAGTACGAG
Table
Table 5. Target genes and primers used in the PCRs performed in this study to determine the Escherichia coli virulence factors.
Table 5. Target genes and primers used in the PCRs performed in this study to determine the Escherichia coli virulence factors.
Target GenePrimer NameSequence (5′-3′)Annealing Temperature (°C) (Amplicon Size, bp)Reference
aeraer-FTACCGGATTGTCATATGCAGACCGT63 (602)[79]
aer-RAATATCTTCCTCCAGTCCGGAGAAG
cnf1cnf1-FAAGATGGAGTTTCCTATGCAGGAG63 (498)[79]
cnf1-RCATTCAGAGTCCTGCCCTCATTATT
fimAfimA-FGTTGTTCTGTCGGCTCTGTC55 (447)[80]
fimA-RATGGTGTTGGTTCCGTTATTC
hlyhly-FAACAAGGATAAGCACTGTTCTGGCT63 (1177)[79]
hly-RACCATATAAGCGGTCATTCCCGTCA
papCpapC-FGACGGCTGTACTGCAGGGTGTGGCG63 (328)[79]
papC-RATATCCTTTCTGCAGGGATGCAATA
papGIIIpapGIII-FCATTTATCGTCCTCAACTTAG55 (482)[80]
papGIII-RAAGAAGGGATTTTGTAGCGTC
stx1stx1-RATAAATCGCCATTCGTTGACTAC65-60 (180)[81]
stx1-RAGAACGCCCACTGAGATCATC

Share and Cite

MDPI and ACS Style

Capita, R.; Cordero, J.; Molina-González, D.; Igrejas, G.; Poeta, P.; Alonso-Calleja, C. Phylogenetic Diversity, Antimicrobial Susceptibility and Virulence Characteristics of Escherichia coli Isolates from Pigeon Meat. Antibiotics 2019, 8, 259. https://doi.org/10.3390/antibiotics8040259

AMA Style

Capita R, Cordero J, Molina-González D, Igrejas G, Poeta P, Alonso-Calleja C. Phylogenetic Diversity, Antimicrobial Susceptibility and Virulence Characteristics of Escherichia coli Isolates from Pigeon Meat. Antibiotics. 2019; 8(4):259. https://doi.org/10.3390/antibiotics8040259

Chicago/Turabian Style

Capita, Rosa, Jorge Cordero, Diana Molina-González, Gilberto Igrejas, Patrícia Poeta, and Carlos Alonso-Calleja. 2019. "Phylogenetic Diversity, Antimicrobial Susceptibility and Virulence Characteristics of Escherichia coli Isolates from Pigeon Meat" Antibiotics 8, no. 4: 259. https://doi.org/10.3390/antibiotics8040259

APA Style

Capita, R., Cordero, J., Molina-González, D., Igrejas, G., Poeta, P., & Alonso-Calleja, C. (2019). Phylogenetic Diversity, Antimicrobial Susceptibility and Virulence Characteristics of Escherichia coli Isolates from Pigeon Meat. Antibiotics, 8(4), 259. https://doi.org/10.3390/antibiotics8040259

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop