Next Article in Journal
Auditory Noise Facilitates Lower Visual Reaction Times in Humans
Next Article in Special Issue
Comparative Study of Nutritional Composition, Physiological Indicators, and Genetic Diversity in Litopenaeus vannamei from Different Aquaculture Populations
Previous Article in Journal
Assembly, Activation, and Helicase Actions of MCM2-7: Transition from Inactive MCM2-7 Double Hexamers to Active Replication Forks
Previous Article in Special Issue
Effects of Different Salinity Stress on the Transcriptomic Responses of Freshwater Crayfish (Procambarus clarkii, Girard, 1852)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 13
Issue 8
10.3390/biology13080630
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus

by
Xi Xie
,
Jun Zhang
,
Shisheng Tu
,
Qi Zhou
and
Dongfa Zhu
*
Key Laboratory of Aquacultural Biotechnology Ministry of Education, School of Marine Sciences, Ningbo University, Ningbo 315832, China
*
Author to whom correspondence should be addressed.
Biology 2024, 13(8), 630; https://doi.org/10.3390/biology13080630
Submission received: 27 June 2024 / Revised: 15 August 2024 / Accepted: 17 August 2024 / Published: 18 August 2024
(This article belongs to the Special Issue Advances in Biological Research into Shrimps, Crabs and Lobsters)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Functional studies of neuropeptides are of great significance in revealing the neuroendocrine regulation mechanism in crustaceans, and in guiding and developing artificial regulation techniques in economic species. In this paper, we investigated the effect of a crustacean neuropeptide corazonin (Crz) on ecdysteroid synthesis based on the high expression of Crz receptor in the Y-organ, the main site of ecdysteroid synthesis. By using Crz treatment and CrzR silencing, we found that Crz/CrzR signaling could cause up-regulation of ecdysteroid synthesis genes and an increase in ecdysteroid levels both in vitro and in vivo. In addition, it was also observed that Crz/CrzR signaling affects the expression level of ecdysis-triggering hormones. Our results provide new insights into the understanding of Crz function in crustaceans.

Abstract

The neuropeptide corazonin (Crz) exerts diverse physiological effects in insects, yet its role in crustaceans remains elusive. The abundant expression of Crz receptor (CrzR) in the Y-organs of several crustaceans suggests a potential involvement of Crz in regulating ecdysteroid synthesis. In this study, we examined the effects of PtCrz on ecdysteroid synthesis during the molting period of Portunus trituberculatus through PtCrz treatments and PtCrzR silencing. Our results showed that PtCrz peptide stimulates ecdysteroid levels and the gene expression involved in ecdysteroidogenesis both in vitro and in vivo, whereas dsPtCrzR treatments had opposite effects on ecdysteroid levels and associated gene expression. Thus, our study suggests that PtCrz may modulate ecdysteroid synthesis via Y-organ-expressed PtCrzR. Furthermore, we also discovered the involvement of PtCrz/PtCrzR signaling in regulating PtETH expression. Notably, the inhibitory effect of dsPtCrzR on ecdysteroid synthesis or PtETH expression can be reversed by PtCrz treatment, suggesting the potential existence of multiple receptors for PtCrz. This study provides new insights into the function of crustacean Crz and, for the first time, elucidates the presence of a neuropeptide that can stimulate ecdysteroid synthesis in crustaceans.

1. Introduction

Corazonin (Crz) is a peptidergic neurohormone widely distributed among arthropods. Initially discovered as a cardioacceleratory peptide in the cockroach Periplaneta americana [1], its function as such is not universally observed across all species [2,3]. Crz may also play a role in nutritional stress signaling [4], behavior modulation [5,6,7], and reproductive physiology [6,8,9] among other functions, which may vary among species. All Crz prepropeptides contain a predicted signal peptide, a conserved mature peptide of 11 amino acids, and an additional sequence known as Crz-precursor-related peptide (CrzRP) [10,11]. Among the six isoforms of mature Crzs, [Arg7]-corazonin is the most common form found in insects [12] and the sole form present in crustaceans [13].
The diverse physiological effects of Crz are primarily mediated by its membrane receptor (CrzR), a member of the G-protein coupled receptor (GPCR) family. In Drosophila melanogaster, gene silencing of CrzR often leads to altered physiological states, including changes in stress responses, feeding behavior, and energy metabolism; all of these phenotypes are associated with Crz action [14,15]. Structurally homologous to the mammalian gonadotropin-releasing hormone (GnRH) receptor [16], CrzR has been identified and characterized in various insects [5,17,18,19,20,21]. Upon activation, CrzR releases secondary messengers such as cAMP and Ca2+, thereby regulating cellular physiological functions [19]. The tissue distribution of CrzR also varies among different species, which may reflect the variable functions of Crz. Notably, in the tobacco hornworm Manduca sexta, the high expression of CrzR in Inka cells is crucial for initiating ecdysis as its activation by Crz leads to the release of ecdysis-triggering hormone (ETH) [5].
In recent years, advances in transcriptomics have facilitated the identification of Crz and CrzR sequences across various crustacean species [3,22,23,24,25]. However, a comprehensive understanding of the Crz/CrzR signaling functions within crustaceans remains incomplete. Crz had no effect on heart activity, blood glucose levels, lipid mobilization, or pigment distribution in chromatophores in the green shore crab Carcinus maenas [3]. By contrast, it influences pigment migration in the crayfish Procambarus clarkia [26], and some molt behavior in the redclaw crayfish Cherax quadricarinatus [27]. In a previous investigation, we discovered that the Crz/CrzR signaling system may also be involved in the vitellogenesis process of Portunus trituberculatus, thereby uncovering a novel function for this pathway [10]. It is noteworthy that that study not only revealed that P. trituberculatus Crz is predominantly derived from neural tissue, but also discovered a high expression of CrzR in the Y-organ, a primary site for crustacean ecdysteroid biosynthesis [10]. Extremely high CrzR levels were also observed in C. maenas Y-organ; however, it is paradoxical that while application of the Crz peptide had no significant impact on ecdysteroid biosynthesis in C. maena (with exception of slight stimulation during early postmolt) [3], it did induce an increase in expression of several ecdysteroidogenesis genes in our cultured Y-organ explant [10].
Although it is common for the Crz/CrzR action to vary across species, our aforementioned studies were specifically conducted during the period of ovarian development. In this current study, we utilized both in vitro and in vivo Crz treatments, as well as CrzR RNA interference (RNAi), to investigate whether Crz/CrzR signaling stimulates ecdysteroid synthesis during the molting period. Furthermore, given the findings in Manduca sexta and Cherax quadricarinatus indicating potential involvement of Crz/CrzR signaling in ETH action [5,27], we further explored their potential regulatory role on ETH expression.

2. Materials and Methods

2.1. Experimental Animals

Juvenile male crabs (40–70 g of bodyweight) were purchased from Xianxiang, Ningbo, in August 2021 and reared at the aquaculture base of the Institute of Marine and Fisheries, Ningbo, China. The crabs were kept in large tanks with continuous seawater flow and fed live razor clams once a day. Different stages of the molt cycle, including postmolt (stages A and B), intermolt (stage C), and premolt (stage D0, D1, D2, D3, and D4), were determined by observing the hardness of the carapace and the formation of new epidermis as described previously [28]. All crabs were anaesthetized on ice for 10 min prior to sacrifice, and tissues including the Y-organ, eyestalk, brain, and thoracic ganglion were dissected and stored in RNA preservation fluid (Cwbiotech, Taizhou, China) at −80 °C until RNA extraction.

2.2. In Vitro Treatments

The mature PtCrz peptide (pQTFQYSRGWTN-NH2) was synthesized by Sangon Biotech (Shanghai, China), with a purity of 98%. The cDNA fragments of the PtCrzR transmembrane region (565 bp) and the green fluorescent protein (GFP, 568 bp) were cloned into the pMD19-T vector (Takara, Kyoto, Japan), respectively, and the corresponding dsRNAs were prepared as previously described [10]. Since the hemolymph ecdysteroid titer generally begins to rise during the premolt stages during a natural molt, Y-organs from premolt D0 crabs were utilized for in vitro experiments. For PtCrz treatments, Y-organ explants were exposed to synthetic PtCrz peptide at final concentrations of 10−5 M, 10−6 M, and 10−7 M after pre-incubation for 1 h. The control group received an equivalent volume of crab saline. In the case of dsPtCrzR treatments, Y-organ explants from the same stage were treated with dsPtCrzR, dsGFP, and dsCrzR supplemented with PtCrz at 10−6 M (the dosage was chosen according to the results of the above PtCrz treatment experiments). The dosage of dsRNA was set at 5 μg per plate. Following an additional incubation period of 8 h, all tissue explants and corresponding culture mediums were collected for further analysis of gene expression and ecdysteroid levels.

2.3. In Vivo Treatments

Crabs in the premolt stage at D0 and D2 were selected for PtCrz in vivo injection. Considering that hemolymph volumes are estimated to be approximately 27% of body mass [29], the dosage of PtCrz injection (3–4.2 × 10−4 M in 50 μL) was calculated to maintain a hemolymph concentration of added Crz at 10−6 M. The control group received an equivalent volume of crab saline. Crabs at premolt D0 were utilized for in vivo RNA interference, with groups corresponding to those used in the in vitro experiments, including dsGFP, dsPtCrzR, and dsPtCrzR + Crz groups. The dosage of dsRNA was standardized at 3 μg/g bodyweight. All injections were administered at the base of the last walking foot using a 1 mL syringe. Hemolymph and tissue samples were collected 24 h post-injection for further analysis of gene expression and ecdysteroid levels.

2.4. Determination of Ecdysteroid Levels

The ecdysteroid levels in culture medium and hemolymph samples were quantified using the 20-Hydroxyecdysone Enzyme Immunoassay Kit (ARBOR ASSAYS, Ann Arbor, MI, USA). Briefly, 0.5 mL of culture medium and hemolymph was extracted, added to 1.5 mL of methanol, vortexed thoroughly, and then centrifuged at 4 °C for 15 min at 12,000× g. The resulting supernatant was transferred to a new sterile centrifuge tube, dried using a nitrogen blower, and stored at −80 °C. Prior to use, the dried powder was reconstituted in diluted Assay Buffer (1:5 with sterile water) and analyzed according to the provided kit protocols.

2.5. Gene Expression Analysis

The relative gene expression levels were determined using quantitative reverse-transcription PCR (qRT-PCR) with specific primers (Table 1). The qRT-PCR was performed on the ABI 7500 qPCR instrument (Thermofisher, Waltham, MA, USA) following the manufacturer’s instructions of the SYBR® Premix Ex Taq™ II Kit (Takara). PCR conditions included an initial denaturation at 95 °C for 2 min, followed by 40 cycles of amplification at 95 °C for 15 s and extension at 56 °C for 20 s. Additional melting curve analysis was conducted to confirm product specificity, with temperature increasing from 55 to 95 °C at a rate of 0.2 °C/s. Amplification efficiencies were assessed using standard curve analysis based on a five-point, tenfold dilution series of cDNA. Each sample was analyzed in triplicate for technical replicates. Normalization of target gene expression was achieved using β-actin, and relative mRNA expression levels were calculated utilizing the comparative Ct (2−ΔΔCt) method [30].

2.6. Statistical Analysis

The data were subjected to normality testing using the Kolmogorov–Smirnov and Cochran tests prior to all statistical analyses. Non-normally distributed data were assessed using the nonparametric Mann–Whitney test, while normally distributed data were analyzed using one-way ANOVA followed by Tukey’s test or the student’s t-test (SPSS 24.0 software, IBM, Armonk, NY, USA). Statistical significance was considered at p < 0.05 and denoted with letters or asterisks in all cases.

3. Results

3.1. Expression Profiles of PtCrz and PtCrzR during the Molt Cycle

Based on previous reports of tissue distribution [10], we conducted an analysis of the variations in PtCrz expression levels in the eyestalk, brain, and thoracic ganglion, as well as PtCrzR expression in the Y-organ and eyestalk throughout the molt cycle. While the expression patterns of PtCrz in these three nerve tissues were not identical, they all exhibited a gradual increase from postmolt (stage A), reaching a peak at premolt D2 substage, followed by a rapid decline to a minimum at premolt D4 (Figure 1A). A similar trend was observed for PtCrzR expression in the Y-organ; however, the peak of PtCrzR expression in the eyestalk occurred at premolt D1 (Figure 1B).

3.2. Effects of PtCrz Peptide and dsPtCrzR on Ecdysteroid Synthesis In Vitro

We investigated the effects of varying concentrations (10−7 M, 10−6 M, and 10−5 M) of PtCrz peptide on ecdysteroid synthesis in the Y-organ cultured in vitro. Our findings revealed that exposure to 10−6 M and 10−5 M PtCrz resulted in significantly elevated levels of ecdysteroids (124.2 ± 2.5 pg/mL and 125.2 ± 2.0 pg/mL, respectively) in the culture medium compared to the control group (97.1 + 2.5 pg/mL) (Figure 2A). By contrast, the ecdysteroids levels in 10−7 M PtCrz treatment (102.8 + 1.4 pg/mL) showed no significant difference with the control group. Furthermore, these treatments effectively stimulated the expression of PtCrzR and induced the expression of two ecdysteroid synthesis pathway genes (PtSpo and PtSad), while showing no discernible effect on another ecdysteroidogenesis gene, PtDib (Figure 2B). On the other hand, treatment with dsPtCrzR led to a marked decrease in PtCrzR within the Y-organ, resulting in opposing effects on ecdysteroid levels (98.0 ± 2.3 pg/mL for dsGFP and 67.3 ± 1.2 pg/mL for dsCrzR) and PtSpo and PtSad expression compared to PtCrz treatments (Figure 2C,D). However, it was observed that such effects could be recovered by administration of PtCrz peptide.

3.3. Effects of PtCrz Peptide and dsPtCrzR on Ecdysteroid Synthesis In Vivo

Similar to the findings observed in in vitro experiments, PtCrz peptide was found to stimulate hemolymph ecdysteroid levels (Figure 3A). The hemolymph ecdysteroid titer increased from 827.5 ± 120.6 pg/mL of the crab saline group to 1179.0 ± 141.5 pg/mL of the Crz injection group in the premolt D0 stage, and from 1198.8 ± 92.3 pg/mL to 2855.7 ± 409.9 pg/mL in the premolt D2 stage. In addition, the expression of PtCrzR, PtSpo, and PtSad during both premolt D0 and premolt D2 stages were also upregulated after Crz treatment (Figure 3B). Notably, the upregulation of PtCrzR was more pronounced during premolt D2, exhibiting an approximately 6-fold increase compared to the crab saline group, while only showing an approximately 2-fold increase during premolt D0. Treatment with dsPtCrzR in premolt D0 resulted in contrasting effects on ecdysteroid levels (764.4 ± 93.0 pg/mL for dsGFP and 457.9 ± 88.4 pg/mL for dsCrzR) and associated gene expression, which could be rescued by administration of PtCrz (Figure 4).

3.4. Effects of PtCrz/PtCrzR Signaling on PtETH Expression

The expression of PtETH in nerve tissues, including the brain, eyestalk, and thoracic ganglion, was detected in the aforementioned in vivo experiments. It was observed that PtETH expression in these three tissues was upregulated by PtCrz peptide (Figure 5) and downregulated by dsPtCrzR (Figure 6). Furthermore, the inhibitory effects of dsPtCrzR could be rescued by PtCrz injection.

4. Discussion

In this study, we investigated the effect of PtCrz on ecdysteroid synthesis during the molting period of P. trituberculatus through neuropeptide treatments and RNA silencing of its receptor. Combined with our previous research [10], we suggest that PtCrz plays a regulatory role in ecdysteroidogenesis in P. trituberculatus, both during ovarian development and molting process. While our results indicate the involvement of PtCrzR in mediating the effects of PtCrz, it is plausible to consider the potential involvement of other Crz receptors, as evidenced by the recovery of dsPtCrzR effects following PtCrz treatment. Notably, there are two types of CrzRs expressed in the Y-organ of the blackback crab Gecarcinus lateralis, belonging to GPCR A6 and A7, respectively [24]. Further phylogenetic analysis showed that PtCrzR is more closely related to GPCR A6 type (Supplementary Material), while the A7 type of CrzR was not found in our transcriptomic data. Certainly, given that the dsRNA utilized in this investigation is designed for gene knockdown rather than gene knockout, it is also plausible that the impact of Crz may not be fully attenuated. Consequently, further research is warranted to validate the aforementioned hypothesis.
Our findings are in contrast with the observed effects of Crz in the green shore crab, C. maenas, where the Crz peptide only weakly stimulated ecdysteroid synthesis during early postmolt [3]. As previously mentioned, the function of the Crz peptide may vary between species. However, this inconsistency is intriguing considering that CrzR was highly expressed in the Y-organ of both species and that both PtCrzR and CmCrzR clustered together in phylogenetic analysis (Supplementary Material). It should be noted that the concentration of Crz administered in our study was substantially higher (10−6 M in this study vs. 5 × 10−8 M in C. maenas), but both levels exceeded their respective EC50 values for CrzR activation in each species. Thus, the discrepancy cannot be readily attributed to the amount of Crz applied.
Instead, the variation in responses may be attributed to intrinsic functional disparities within the receptors themselves. For instance, PtCrzR is clustered together with GlCrzR-A6, but their expression patterns differ throughout the molt cycle: PtCrzR is significantly upregulated in premolt D2, while GlCrzRA6 shows high expression only in postmolt stages [24], indicating potential divergent functional roles for the same type of CrzR across species. In fact, although not examined, the expression of CmCrzR is high, at least in the intermolt, the period from which its tissue distribution was analyzed [3]. This is very different from the expression pattern of GlCrzRA6 and possibly also PtCrzR. On the other hand, the expressions of PtCrz and PtCrzR during the molt cycle exhibit a strong correlation with ecdysteroidogenesis, as hormone levels peak in premolt D3 [31] following the peak expressions of PtCrz and PtCrzR.
To the best of our knowledge, this study represents the first documentation of a neuropeptide’s involvement in promoting ecdysteroid synthesis in crustaceans. PtCrz may work in conjunction with classical molt-inhibiting hormone (MIH), which belongs to the crustacean hyperglycemic hormone (CHH) family of neuropeptides [32]. It is generally accepted that MIH signaling suppresses ecdysteroidogenesis through the cyclic nucleotide second messengers cAMP and cGMP [33]. Therefore, PtCrz/PtCrzR may potentially utilize alternative GPCR mediated pathways, such as the phospholipase C (PLC)/PKC pathway, which has been suggested to promote ecdysteroid synthesis and secretion by the Y-organ [11]. The decrease in hemolymph levels of MIH during late intermolt triggers ecdysteroid synthesis in the Y-organ, while high levels of MIH reappear during mid-premolt, where it is no longer sensitive to the Y-organ [33]. In contrast, the Y-organ appears to be more sensitive to PtCrz during premolt D2, as evidenced by PtCrz inducing greater fold changes in PtCrzR expression and ecdysteroid levels compared to premolt D0. However, given the expression of multiple neuropeptide receptors in the crustacean Y-organ [24,34], it is still open for discussion whether Crz serves as the primary regulator in stimulating ecdysteroidogenesis. It is worth noting that ecdysteroid synthesis in Drosophila is governed by a complex network of multiple neuropeptides [35], and a similar scenario can be anticipated in crustaceans.
In order to stimulate ecdysteroid levels, the Crz signaling system may target the genes that encode enzymes involved in the ecdysteroid biosynthetic pathway. This is supported by the altered expression of two such genes, PtSpo and PtSad, in both Crz treatment and CrzR RNAi. The classical ecdysteroid biosynthesis pathway involves seven enzymes, five of which are cytochrome P450 monooxygenases (CYPs). Their coding genes are collectively known as the Halloween genes, including neverland (nvd), non-molting glossy/shroud (sro), spook (spo, CYP307A1), phantom (phm, CYP306A1), disembodied (dib, CYP302A1), shadow (sad: CYP315A1), and shade (shd: CYP314A1) [36]. PtSpo, PtDib, and PtSad were selected for expression analysis in this study because their dsRNA can downregulate hemolymph ecdysteroid levels [37]. In contrast to PtSpo and PtSad, PtDib expression was not sensitive to Crz treatment or CrzR RNAi, suggesting that Crz/CrzR signaling only targets certain Halloween genes. Interestingly, eyestalk ablation, a common method to induce hemolymph ecdysteroid levels, induces the expression of PtDib and PtSad but not PtSpo [37]. This again suggests a complex neuropeptide system in the control of crustacean ecdysteroid synthesis.
In the tobacco hornworm Manduca sexta, Crz was able to stimulate early secretion of the ecdysis-triggering hormone (ETH), which in turn initiated the onset of the ecdysis behavioral sequence [5]. Crz may play a similar role in crustaceans, as demonstrated in the redclaw crayfish Cherax quadricarinatus, where Crz injection induced typical molting responses, albeit in a slower and more asynchronous manner than that observed with ETH injection. Our results showed that Crz treatments at two premolt stages significantly promoted PtETH expression in three neural tissues, suggesting a potential function in controlling ETH action. However, neither PtCrz nor PtETH induced any putative molting responses in vivo (data is being prepared and scheduled for future published). Therefore, the physiological significance of this result remains to be investigated. It has recently been proposed that ETH may possess functions beyond behavioral regulation, as evidenced by its RNA silencing in the mud crab Scylla paramamosain leading to widespread mortality and perturbations in numerous metabolic pathways-related genes [38,39].

5. Conclusions

In conclusion, the current study demonstrated that PtCrz plays a stimulatory role in ecdysteroid synthesis and may be involved in the regulation of PtETH expression. CrzR is involved in both actions of Crz, but may not be the only Crz receptor. Our results provide new insights into the understanding of Crz function in crustaceans.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology13080630/s1, Figure S1: Phylogenetic analysis of CrzRs with RPCHR and ACPR. The following sequences were used: Portunus trituberculatus CrzR (PtCrzR, OL694706), Rhodnius prolixus CrzR1 and CrzR2 (RpCrzR1 and RpCrzR2, AND99324 and AND99325), Carcinus maenas CrzR and RPCHR (CmCrzR and CmRPCHR, AVA26879 and MF974387), Daphnia pulex RPCHR (DpRPCHR, ACD75498), Ixodes scapularis APCR1-4 (IsACPR1-4, AHB51763, AHB51764, AHB51765, AHB51766). Tribolium castaneum ACPR (TcACPR, NP001280549), Nasonia vitripennis ACPR and ACPRX1-X4 (NvACPR and NvACPRX1-4, NP001164571, XP031779949, XP031779950, XP031779951, XP031779952).

Author Contributions

Conceptualization, X.X.; Data curation, S.T.; Formal analysis, J.Z.; Funding acquisition, D.Z.; Investigation, J.Z.; Methodology, S.T.; Software, Q.Z.; Supervision, D.Z.; Validation, J.Z. and Q.Z.; Writing—original draft, X.X.; Writing—review & editing, X.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National natural Science Foundation of China (Nos. 32373124 and U23A20248), and the K. C. Wong Magna Fund in Ningbo University.

Institutional Review Board Statement

In China, ethical approval is not required for experiments on crabs. All the experiments comply with the requirements of the governing regulation for the use of experimental animals in Zhejiang Province (Zhejiang provincial government order No. 263, released on 17 August 2009, effective from 1 October 2010) and the Animal Care and Use Committee of Ningbo University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Veenstra, J.A. Isolation and structure of Corazonin, a cardioactive peptide from the American cockroach. FEBS Lett. 1989, 250, 231–234. [Google Scholar] [CrossRef]
  2. Hillyer, J.F.; Estévez-Lao, T.Y.; Funkhouser, L.J.; Aluoch, V.A. Anopheles gambiae Corazonin: Gene structure, expression and effect on mosquito heart physiology. Insect. Mol. Biol. 2012, 21, 343–355. [Google Scholar] [CrossRef]
  3. Alexander, J.L.; Oliphant, A.; Wilcockson, D.C.; Audsley, N.; Down, R.E.; Lafont, R.; Webster, S.G. Functional characterization and signaling systems of Corazonin and red pigment concentrating hormone in the green shore crab, Carcinus maenas. Front. Neurosci. 2018, 11, 752. [Google Scholar] [CrossRef] [PubMed]
  4. Veenstra, J.A. Does Corazonin signal nutritional stress in insects? Insect. Biochem. Mol. Biol. 2009, 39, 755–762. [Google Scholar] [CrossRef] [PubMed]
  5. Kim, Y.J.; Spalovská-Valachová, I.; Cho, K.H.; Zitnanova, I.; Park, Y.; Adams, M.E.; Žitňan, D. Corazonin receptor signaling in ecdysis initiation. Proc. Natl. Acad. Sci. USA 2004, 101, 6704–6709. [Google Scholar] [CrossRef]
  6. Gospocic, J.; Shields, E.J.; Glastad, K.M.; Lin, Y.; Penick, C.A.; Yan, H.; Mikheyev, A.S.; Linksvayer, T.A.; Garcia, B.A.; Berger, S.L.; et al. The Neuropeptide Corazonin controls social behavior and caste identity in ants. Cell 2017, 170, 748–759. [Google Scholar] [CrossRef]
  7. Varga, K.; Nagy, P.; Arsikin Csordás, K.; Kovács, A.L.; Hegedűs, K.; Juhász, G. Loss of Atg16 delays the alcohol-induced sedation response via regulation of Corazonin neuropeptide production in Drosophila. Sci. Rep. 2016, 6, 34641. [Google Scholar] [CrossRef] [PubMed]
  8. Ben-Menahem, D. GnRH-Related Neurohormones in the fruit fly Drosophila melanogaster. Int. J. Mol. Sci. 2021, 22, 5035. [Google Scholar] [CrossRef]
  9. Cheng, J.; Zhao, P.; Zhu, L.; Zhu, F.; Tian, Z.; Shen, Z.; Liu, X.; Liu, X. Corazonin signaling modulates the synthetic activity of male accessory gland in Grapholita molesta. Int. J. Biol. Macromol. 2022, 216, 446–455. [Google Scholar] [CrossRef]
  10. Tu, S.; Ge, F.; Han, Y.; Wang, M.; Xie, X.; Zhu, D. Putative role of corazonin in the ovarian development of the swimming crab Portunus trituberculatus. Front. Mar. Sci. 2022, 9, 976754. [Google Scholar] [CrossRef]
  11. Mykles, D.L. Signaling pathways that regulate the crustacean molting gland. Front. Endocrinol. 2021, 12, 674711. [Google Scholar] [CrossRef] [PubMed]
  12. Predel, R.; Neupert, S.; Russell, W.K.; Scheibner, O.; Nachman, R.J. Corazonin in insects. Peptides 2007, 28, 3–10. [Google Scholar] [CrossRef] [PubMed]
  13. Veenstra, J.A. Similarities between decapod and insect neuropeptidomes. PeerJ 2016, 4, e2043. [Google Scholar] [CrossRef]
  14. Kubrak, O.I.; Lushchak, O.V.; Zandawala, M.; Nässel, D.R. Systemic Corazonin signalling modulates stress responses and metabolism in Drosophila. Open Biol. 2016, 6, 160152. [Google Scholar] [CrossRef]
  15. Sha, K.; Choi, S.-H.; Im, J.; Lee, G.G.; Loeffler, F.; Park, J.H. Regulation of ethanol-related behavior and ethanol metabolism by the Corazonin neurons and Corazonin receptor in Drosophila melanogaster. PLoS ONE 2014, 9, e87062. [Google Scholar] [CrossRef]
  16. Buckley, S.J.; Nguyen, T.V.; Cummins, S.F.; Elizur, A.; Fitzgibbon, Q.P.; Smith, G.S.; Mykles, D.L.; Ventura, T. Evaluating conserved domains and motifs of decapod gonadotropin-releasing hormone G protein-coupled receptor superfamily. Front. Endocrinol. 2024, 15, 1348465. [Google Scholar] [CrossRef] [PubMed]
  17. Cazzamali, G.; Saxild, N.P.E.; Grimmelikhuijzen, C.J.P. Molecular cloning and functional expression of a Drosophila Corazonin receptor. Biochem. Biophys. Res. Commun. 2002, 298, 31–36. [Google Scholar] [CrossRef]
  18. Belmont, M.; Cazzamali, G.; Williamson, M.; Hauser, F.; Grimmelikhuijzen, C.J.P. Identification of four evolutionarily related g protein-coupled receptors from the malaria mosquito Anopheles gambiae. Biochem. Biophys. Res. Commun. 2006, 344, 160–165. [Google Scholar] [CrossRef]
  19. Yang, J.; Huang, H.; Yang, H.; He, X.; Jiang, X.; Shi, Y.; Alatangaole, D.; Shi, L.; Zhou, N. Specific activation of the g protein-coupled receptor bngr-a21 by the neuropeptide Corazonin from the silkworm, Bombyx mori, dually couples to the Gq and Gs signaling cascades. J. Biol. Chem. 2013, 288, 11662–11675. [Google Scholar] [CrossRef] [PubMed]
  20. Oryan, A.; Wahedi, A.; Paluzzi, J.P.V. Functional characterization and quantitative expression analysis of two GnRH-related peptide receptors in the mosquito, Aedes aegypti. Biochem. Biophys. Res. Commun. 2018, 497, 550–557. [Google Scholar] [CrossRef]
  21. Sha, K.; Conner, W.C.; Choi, D.Y.; Park, J.H. Characterization, expression, and evolutionary aspects of Corazonin neuropeptide and its receptor from the house fly, Musca domestica (Diptera: Muscidae). Gene 2012, 497, 191–199. [Google Scholar] [CrossRef] [PubMed]
  22. Buckley, S.J.; Fitzgibbon, Q.P.; Smith, G.G.; Ventura, T. In silico prediction of the G-Protein coupled receptors expressed during the metamorphic molt of Sagmariasus Verreauxi (Crustacea: Decapoda) by mining transcriptomic data: RNA-Seq to repertoire. Gen. Comp. Endocrinol. 2016, 228, 111–127. [Google Scholar] [CrossRef] [PubMed]
  23. Tu, S.; Xu, R.; Wang, M.; Xie, X.; Bao, C.; Zhu, D. Identification and characterization of expression profiles of neuropeptides and their GPCRs in the swimming crab, Portunus trituberculatus. PeerJ 2021, 9, 12179. [Google Scholar] [CrossRef] [PubMed]
  24. Tran, N.M.; Mykles, D.L.; Elizur, A.; Ventura, T. Characterization of G-Protein coupled receptors from the blackback land crab Gecarcinus lateralis Y organ transcriptome over the molt cycle. BMC Genom. 2019, 20, 74. [Google Scholar] [CrossRef] [PubMed]
  25. Nguyen, T.V.; Rotllant, G.E.; Cummins, S.F.; Elizur, A.; Ventura, T. Insights into sexual maturation and reproduction in the norway lobster (Nephrops norvegicus) via in silico prediction and characterization of neuropeptides and G protein-coupled receptors. Front. Endocrinol. 2018, 9, 430. [Google Scholar] [CrossRef] [PubMed]
  26. Porras, M.G.; De Loof, A.; Breuer, M.; Aréchiga, H. Corazonin promotes tegumentary pigment migration in the crayfish Procambarus clarkii. Peptides 2003, 24, 1581–1589. [Google Scholar] [CrossRef] [PubMed]
  27. Minh Nhut, T.; Mykles, D.L.; Elizur, A.; Ventura, T. Ecdysis triggering hormone modulates molt behaviour in the redclaw crayfish Cherax quadricarinatus, providing a mechanistic evidence for conserved function in molt regulation across pancrustacea. Gen. Comp. Endocrinol. 2020, 298, 113556. [Google Scholar] [CrossRef]
  28. Shen, J.; Zhu, D.; Hu, Z.; Qi, Y.; Wang, C. Molt staging in the swimming crab Portunus trituberculatus. J. Fish. China 2011, 35, 1481–1487. [Google Scholar] [CrossRef]
  29. Reddy, P.R.; Nagaraju, G.P.C.; Reddy, P.S. Involvement of methyl farnesoate in the regulation of molting and reproduction in the freshwater crab Oziotelphusa senex senex. J. Crus. Biol. 2004, 24, 511–515. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  31. Wang, C.J.; Zhu, D.F.; Qi, Y.Z.; Hu, Z.H.; Xie, X.; Shen, J. Molt-Inhibiting hormone levels and ecdysteroid titer during a molt cycle of Portunus trituberculatus. Acta Hydrobio. Sin. 2013, 37, 22–28. [Google Scholar] [CrossRef]
  32. Webster, S.G.; Keller, R.; Dircksen, H. The CHH-Superfamily of multifunctional peptide hormones controlling crustacean metabolism, osmoregulation, moulting, and reproduction. Gen. Comp. Endocrinol. 2012, 175, 217–233. [Google Scholar] [CrossRef]
  33. Mykles, D.L.; Chang, E.S. Hormonal control of the crustacean molting gland: Insights from transcriptomics and proteomics. Gen. Comp. Endocrinol. 2020, 294, 113493. [Google Scholar] [CrossRef] [PubMed]
  34. Techa, S.; Thongda, W.; Bunphimpapha, P.; Ittarat, W.; Boonbangyang, M.; Wilantho, A.; Ngamphiw, C.; Pratoomchat, B.; Nounurai, P.; Piyapattanakorn, S. Isolation and functional identification of secretin family G-Protein coupled receptor from Y-organ of the mud crab, Scylla Olivacea. Gene 2023, 848, 146900. [Google Scholar] [CrossRef] [PubMed]
  35. Kannangara, J.R.; Christen, K.M.; Warr, C.G. Regulation of ecdysone production in Drosophila by neuropeptides and peptide hormones. Open Biol. 2021, 11, 200373. [Google Scholar] [CrossRef]
  36. Mykles, D.L. Ecdysteroid metabolism in crustaceans. J. Steroid. Biochem. Mol. Biol. 2011, 127, 196–203. [Google Scholar] [CrossRef] [PubMed]
  37. Xie, X.; Liu, Z.; Liu, M.; Tao, T.; Shen, X.; Zhu, D. Role of Halloween genes in ecdysteroids biosynthesis of the swimming crab (Portunus trituberculatus): Implications from RNA interference and eyestalk ablation. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2016, 199, 105–110. [Google Scholar] [CrossRef]
  38. Zhao, Y.F.; Wen, Q.Q.; Ao, C.M.; Wang, W.; Shi, L.L.; Wang, C.G.; Chan, S.F. Ecdysis triggering hormone, eclosion hormone, and crustacean cardioactive peptide play essential but different roles in the molting process of mud crab, Scylla paramamosain. Front. Mar. Sci. 2022, 9, 855391. [Google Scholar] [CrossRef]
  39. Chan, S.F.; Wen, Q.Q.; Ao, C.M.; Wang, W.; Wang, C.G.; Zhao, Y.F. Transcriptome responses of RNAi-mediated ETH knockdown in Scylla paramamosain at different premolt substages. Front. Endocrinol. 2022, 13, 917088. [Google Scholar] [CrossRef]
Biology 13 00630 g001
Figure 1. Expression profiles of PtCrz (A) and PtCrzR (B) during the molt cycle of P. trituberculatus. The relative mRNA levels of PtCrz were examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG), while PtCrzR were examined in Y-organ (YO) and eyestalk (Es). The molting stages includes postmolt (stage A and B), intermolt (stage C), and premolt (stage D0, D1, D2, D3, and D4). Bars represent mean + SEM (n = 5). Different letters indicate statistically significant differences within each tissue (p < 0.05).
Figure 1. Expression profiles of PtCrz (A) and PtCrzR (B) during the molt cycle of P. trituberculatus. The relative mRNA levels of PtCrz were examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG), while PtCrzR were examined in Y-organ (YO) and eyestalk (Es). The molting stages includes postmolt (stage A and B), intermolt (stage C), and premolt (stage D0, D1, D2, D3, and D4). Bars represent mean + SEM (n = 5). Different letters indicate statistically significant differences within each tissue (p < 0.05).
Biology 13 00630 g001
Biology 13 00630 g002
Figure 2. Effects of PtCrz peptide and dsPtCrzR on ecdysteroid synthesis in vitro. The ecdysteroid levels in Y-organ culture medium (A) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (B) when treated with different concentrations of Crz peptides. The ecdysteroid levels in Y-organ culture medium (C) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (D) when treated with different dsGFP, dsCrzR, and dsCrzR supplemented with PtCrz at 10–6 M. Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with control or dsGFP group (p < 0.05), while “ns” means no significant difference.
Figure 2. Effects of PtCrz peptide and dsPtCrzR on ecdysteroid synthesis in vitro. The ecdysteroid levels in Y-organ culture medium (A) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (B) when treated with different concentrations of Crz peptides. The ecdysteroid levels in Y-organ culture medium (C) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (D) when treated with different dsGFP, dsCrzR, and dsCrzR supplemented with PtCrz at 10–6 M. Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with control or dsGFP group (p < 0.05), while “ns” means no significant difference.
Biology 13 00630 g002
Biology 13 00630 g003
Figure 3. Effects of PtCrz peptide injection on ecdysteroid synthesis in vivo. (A) Induced hemolymph ecdysteroid levels by injection with PtCrz peptide in premolt D0 and D2, respectively. (B) The change in expression levels of PtCrzR, PtSpo, PtSad, and PtDib in Y-organ after PtCrz peptide treatments in two stages. Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with crab saline group (p < 0.05).
Figure 3. Effects of PtCrz peptide injection on ecdysteroid synthesis in vivo. (A) Induced hemolymph ecdysteroid levels by injection with PtCrz peptide in premolt D0 and D2, respectively. (B) The change in expression levels of PtCrzR, PtSpo, PtSad, and PtDib in Y-organ after PtCrz peptide treatments in two stages. Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with crab saline group (p < 0.05).
Biology 13 00630 g003
Biology 13 00630 g004
Figure 4. Effects of dsPtCrzR on ecdysteroid synthesis in vivo. The hemolymph ecdysteroid levels (A) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (B) when treated with different dsGFP, dsCrzR, and dsCrzR supplemented with PtCrz at 10−6 M. Bars represent mean ± SEM (n = 4). The asterisk indicates statistically significant different when compared with control group (p < 0.05), while “ns” means no significant difference.
Figure 4. Effects of dsPtCrzR on ecdysteroid synthesis in vivo. The hemolymph ecdysteroid levels (A) and the PtCrzR, PtSpo, PtSad, and PtDib expression levels (B) when treated with different dsGFP, dsCrzR, and dsCrzR supplemented with PtCrz at 10−6 M. Bars represent mean ± SEM (n = 4). The asterisk indicates statistically significant different when compared with control group (p < 0.05), while “ns” means no significant difference.
Biology 13 00630 g004
Biology 13 00630 g005
Figure 5. Effects of PtCrz peptide on PtETH expression. The PtETH expression was examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG) in treatments including PtCrz injection in premolt D0 (A) and premolt D2 (B). Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with crab saline group (p < 0.05).
Figure 5. Effects of PtCrz peptide on PtETH expression. The PtETH expression was examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG) in treatments including PtCrz injection in premolt D0 (A) and premolt D2 (B). Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with crab saline group (p < 0.05).
Biology 13 00630 g005
Biology 13 00630 g006
Figure 6. Effects of dsPtCrzR injection on PtETH expression. The PtETH expression was examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG). Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with dsGFP group (p < 0.05).
Figure 6. Effects of dsPtCrzR injection on PtETH expression. The PtETH expression was examined in brain (Br), eyestalk (Es), and thoracic ganglion (TG). Bars represent mean ± SEM (n = 4). The asterisk indicates a statistically significant difference when compared with dsGFP group (p < 0.05).
Biology 13 00630 g006
Table 1. The qRT-PCR primers used in this study.
Table 1. The qRT-PCR primers used in this study.
GenePrimer (5′-3′)GenBank Accession No.
PtCrzForward: CAGTTGTGGTGCTCGTTGCCOL694705
Reverse: GCTCAGCGGACCTTTTTCG
PtCrzRForward: GTCATCTGCTGGACTCCCTACTACOL694706
Reverse: CGGGTTGACGAGACTGTTGG
PtSpoForward: GTTTTGGCTCCCGCAACTAKM030021
Reverse: TGTCGTCGGTGAGGCTTGT
PtSadForward: CAGATATGGGCAGATTCATCGKM596851
Reverse: AAGGCGTCATCCAGGCAC
PtDibForward: GGCAAACACTGGTGGGAACTKM880023
Reverse: ACCCTTCACGCCTCATCTTG
PtETHForward: ATGCTCTCTGTTCTGGACTCAAGMT890695
Reverse: TCACTTCTGCAGGTAACGCA
β-actinForward: CGAAACCTTCAACACTCCCGFI641977
Reverse: CGGGTTGACGAGACTGTTGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xie, X.; Zhang, J.; Tu, S.; Zhou, Q.; Zhu, D. Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus. Biology 2024, 13, 630. https://doi.org/10.3390/biology13080630

AMA Style

Xie X, Zhang J, Tu S, Zhou Q, Zhu D. Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus. Biology. 2024; 13(8):630. https://doi.org/10.3390/biology13080630

Chicago/Turabian Style

Xie, Xi, Jun Zhang, Shisheng Tu, Qi Zhou, and Dongfa Zhu. 2024. "Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus" Biology 13, no. 8: 630. https://doi.org/10.3390/biology13080630

APA Style

Xie, X., Zhang, J., Tu, S., Zhou, Q., & Zhu, D. (2024). Corazonin Stimulates Ecdysteroid Synthesis during the Molting Process of the Swimming Crab, Portunus trituberculatus. Biology, 13(8), 630. https://doi.org/10.3390/biology13080630

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop