Next Article in Journal
Evaluation of the Carbohydrate Composition of Crabapple Fruit Tissues Native to Northern Asia
Next Article in Special Issue
Genetic Diversity of Barley Accessions from East Asia for Greenbug Resistance
Previous Article in Journal
Genetic Polymorphism in the Amaranthaceae Species in the Context of Stress Tolerance
Previous Article in Special Issue
Bread Wheat Landraces Adaptability to Low-Input Agriculture
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 19
10.3390/plants12193471
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resistance of Modern Russian Winter Wheat Cultivars to Yellow Rust

by
Elena Gultyaeva
* and
Ekaterina Shaydayuk
All Russian Institute of Plant Protection, Shosse Podbelskogo 3, St. Petersburg 1986608, Russia
*
Author to whom correspondence should be addressed.
Plants 2023, 12(19), 3471; https://doi.org/10.3390/plants12193471
Submission received: 29 August 2023 / Revised: 20 September 2023 / Accepted: 25 September 2023 / Published: 3 October 2023
(This article belongs to the Special Issue Genetic Resources of Cereal and Oilseed Crops for Sustainable Breeding and Food Security II)
Review Reports Versions Notes

Abstract

:
Over the last decade, the significance of yellow rust caused by Puccinia striiformis (Pst) has substantially increased worldwide, including in Russia. The development and cultivation of resistant genotypes is the most efficient control method. The present study was conducted to explore the yellow rust resistance potential of modern common winter wheat cultivars included in the Russian Register of Breeding Achievements in 2019–2022 using the seedling tests with an array of Pst races and molecular markers linked with Yr resistance genes. Seventy-two winter wheat cultivars were inoculated with five Pst isolates differing in virulence and origin. Molecular markers were used to identify genes Yr2, Yr5, Yr7, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr25 and Yr60. Thirteen cultivars were resistant to all Pst isolates. The genes Yr5, Yr10, Yr15 and Yr24 that are effective against all Russian Pst races in resistant cultivars were not found. Using molecular methods, gene Yr9 located in translocation 1BL.1RS was detected in 12 cultivars, gene Yr18 in 24, gene Yr17 in 3 and 1AL.1RS translocation with unknown Yr gene in 2. While these genes have lost effectiveness individually, they can still enhance genetic diversity and overall yellow rust resistance, whether used in combination with each other or alongside other Yr genes.

1. Introduction

Wheat is one of the most important crops worldwide, and it grows in various climatic zones [1]. Common (or bread) wheat (Triticum aestivum) is the one most dominant among cultivated Triticum spp. About 95% of wheat produced worldwide is common wheat [2], and in Russia it represents 36% of all grain crops produced [3]. In Russia, winter wheat predominates, and it is grown in the North Caucasus, Central Chernozem and central regions, whereas spring wheat is grown in the Volga region, western Siberia and the Urals [4]. The areas of winter wheat cultivation are characterized by high soil and climate diversity; in this regard, the requirements for wheat cultivars in each area are highly specific. In modern wheat breeding, special attention, along with the improvement of the main economically valuable traits, is given to increasing resistance to harmful organisms (pathogens and pests). Growing resistant cultivars is the most efficient and environmentally friendly method to reduce yield losses. The availability of commercial cultivars with various types of resistance and the corresponding controlling genes provides effective protection. One significant constraint for increasing wheat production is the rust pathogens, leaf rust (Puccinia triticina), stem rust (Puccinia graminis) and yellow (stripe) rust (Puccinia striiformis (Pst) [5]. Long-distance dispersal capacity, rapid development of virulence and climate adaptability make wheat rusts the most important threat to wheat production worldwide [6]. If any of these rusts reach epidemic proportions, devastating yield losses can occur, with total loss potentially occurring in fields with highly susceptible cultivars [7]. P. triticina is the most distributive rust species and is able to develop over a wide temperature range. Up until 2000, leaf rust caused serious epidemics throughout wheat-growing regions worldwide. Stem rust pathogens can also occur wherever wheat is grown [8], but it is a more thermophilic species. Maximum temperature for spore germination and sporulation is about 5.5 °C higher than for P. triticina. Stem rust differs from leaf rust in requiring a longer dew period [8].
The environmental requirements of Pst differ from P. triticina and P. graminis. Yellow rust is generally found in northern latitudes, highlands and wheat-growing regions with cooler temperatures during early growth stages. However, recent large-scale epidemics have occurred in warmer wheat-growing areas. This was ensured by the emergence of two closely related Pst strains with increased aggressiveness and tolerance to warm temperatures [7,9,10].
In 2000, repeated Pst epidemics occurred in the majority of wheat-growing areas in Western Europe [9,10,11,12], Central and East Asia [13,14], the Middle East, North and South Africa [13], North and South America [15] and Australia [16]. Notably, the rapid global emergence of more aggressive and genetically diverse Pst populations adapted to warmer temperatures had an impact on the yellow rust resistance ratings of many wheat cultivars [9]. Therefore, widening the genetic diversity of wheat cultivars in current use would be viewed as a strategy for greater yield stability.
Yellow rust epidemics in Russia were for the most part only frequent and destructive in the North Caucasus [17]. Over the last 5 years, the significance of Pst has increased markedly in other Russian regions. The disease has appeared in the regions North-West [18], West Siberia [19], Volga [20] and Central Chernozem regions [21]. Global climate changes contribute to changes in disease incidence and severity. There are many ways to manage rust diseases; however, the development and cultivation of resistant genotypes are the most efficient [7].
Resistance to rust in wheat is grouped into two broad categories. Seedling or all-stage resistance is often differentially expressed and is commonly designated as race-specific resistance. Race-specific resistance with a single resistance gene is often short-lived. The second type of resistance, often designated as adult plant resistance (APR), is effective at post-seedling or adult plant stages and is usually manifested by a slow disease progression (slow-rusting) despite a susceptible host reaction. However, some race-specific adult plant resistance genes have also been identified. Effective levels of slow-rusting resistance are more commonly controlled by a small number of minor genes with additive effects, and some have pleiotropic effects in conferring resistance to other diseases [22,23].
Presently, 84 yellow rust resistance genes (Yr genes) have been catalogued in wheat, with these mostly conferring to all-stage (or seedling) resistance [24]. This kind of resistance generally provides qualitative resistance to one or more Pst isolates [22]. Some of the catalogued seedling resistance Yr genes are alien and obtained from diploid and tetraploid wild and cultivated relatives: Yr15, Yr35 and Yr84 derived from Triticum dicoccoides, Yr8 from Aegilops comosa, Yr9 from Secale cereale, Yr10 from T. vavilovii, Yr17, Yr28 and Yr48 from Ae. ventricosa, Yr37 from Ae. kotschyi, Yr38 from Ae. sharonensis, Yr40 from Ae. geniculata, Yr42 from Ae. neglecta, Yr50 from Thinopyrum intermedium, Yr69 from Th. Ponticum, Yr70 from Ae. umbellulate and Yr5 from T. spelta [24,25,26]. Other genes came from hexaploid wheat landraces. Of the race-specific genes, Yr5, Yr10, Yr15 and Yr24 are still widely effective and can be used in breeding for yellow rust resistance [13,27]. APR confers quantitative or partial resistance. It is not typically race-specific, is consequently more durable than seedling resistance and is conditioned by genes with minor or partial effect. Some APR genes confer resistance against multiple biotrophic pathogens; this characteristic is a good indicator of durability. Examples include Yr18/Lr34/Sr67/Pm38, Yr29/Lr46/Sr58/Pm39, Yr30/Lr27/Sr2 and Yr46/Lr67/Sr55/Pm46 [28]. Pyramiding multiple resistance genes with additive effects into single genetic backgrounds should help prevent a rapid breakdown of wheat Pst field resistance [29].
In most countries, cultivars have been assessed for disease resistance for registration to the National Catalogue [22], but seedling resistance and characterization of the Yr genes are not performed. The field resistance of Russian wheat genotypes to more important diseases is also evaluated during preliminary state variety studies. The complementary monitoring of wheat at the seedling stage for resistance to Pst pathotypes has been essential for the detection of race-specific resistance. Assessment based on tests using a set of Pst isolates differenced for virulence and molecular markers used for the postulation of Yr genes’ molecular marker-assisted detection is the most convenient and reliable method to identify the presence of Yr genes. A wide range of markers are reported to be associated with Yr genes in wheat [30]. Distribution of Yr genes in commercial wheat cultivars and breeding lines using molecular markers is characterized in many countries [22,31,32,33]. Information about the postulation of Yr genes in Russian commercial cultivars using multi-pathogen tests and molecular markers is too limited.
The present study was conducted to explore the yellow rust resistance potential of modern common winter wheat cultivars included in the Russian Register of Breeding Achievements using the seedling tests with an array of Pst races and molecular markers linked with Yr resistance genes.

2. Results

2.1. Resistance Study at the Seedling Test

Virulence and avirulence spectra of Pst isolates on Avocet near-isogenic lines (NILs) and a set of differential cultivars are presented in Table 1. All isolates were avirulent to Avocet lines (AvYr) with genes Yr5, Yr10, Yr15, Yr24, Yr26 and YrSp and differential cultivars (cvs Moro, Spaldings Prolific and Nord Desprez). Avocet NILs with genes Yr8, Yr9 and Yr18 and cvs Lee, Heines Kolben, Vilmorin 23, Suwon 92/Omar, Jupateco S and Avocet S were susceptible. Pst isolates differed in their avirulence to Yr1, Yr7, Yr17 and Yr27, and cvs Chinese 166 (Yr1), Hybrid 46 (Yr4), Reichersberg 42 (Yr7) and Heines Peko (Yr2, Yr6, Yr25), Compair (Yr8 and Yr19) and Carstens V (Yr32, Yr25). Therefore, these genes could be used for gene postulation in multi-pathogen tests. Avirulence to Yr1 and cv. Chinese 166 (Yr1) was detected for North-Western Pst isolate; to Yr7 for North-Western, West Siberian and Derbent Pst isolates; to Yr7 for West Siberian, Krasnodar and Rostov Pst isolates; to Yr27 for Krasnodar and Rostov Pst isolates; to cv. Strubes Dickkopf for North-Western and Derbent Pst isolates; to cv. Hybrid 46 for North-Western and West Siberian isolates; to Reichersberg 42 for West Siberian Pst isolate; to Heines Peko for Derbent Pst isolate; to Compair for all North Caucasian Pst isolates (Derbent, Krasnodar and Rostov); and to Carstens V for North-Western and West Siberian Pst isolates.
Seedling infection type data for the 72 tested winter wheat cultivars inoculated with five Pst isolates are listed in Table 2. The resistance of the cultivars varied greatly when infected with various isolates (infection type (IT) from 0 to 2). Thirteen cultivars (cvs Timiryazevka 150, Akapella, Vol’nitsa, Yelanchik, Galateya, Polina, Khamdan, Sharm, Yubiley Dona, Pal’mira 18, Podruga, Sirena and Fyodor) were resistant to all Pst isolates tested and 30 were highly (IT 3–4) or moderately susceptible (IT 2+–3 and 3). The number of winter wheat cultivars resistant to the West Siberian Pst isolate was significantly higher (46%) than to North Caucasian and North-Western Pst isolates. North Caucasian Pst isolates used in the multi-pathogen tests were more virulent (virulence to 17 and 18 differentials from 30) than those from West Siberia and North-West (15).
According to McIntosh et al. [5], highly elevated levels of seedling resistance are almost invariably associated with high or acceptable levels of adult plant resistance under field conditions. Intermediate seedling responses may give variable responses in the field. This is consistent with the results obtained in these studies. Most of cultivars resistant to yellow rust at the seedling stage were resistant at the adult plant stage under field conditions in state-run cultivar tests [34,35,36,37,38] (Table 2).
A resistant reaction to only one of the used Pst isolates occurred in 15 cultivars. Cvs Arsenal, Al’bireo and Leo were resistant to the North-Western isolate, which differed from other isolates by avirulence to Yr1. According to multi-pathogen tests, it is possible to postulate the presence of the Yr1 gene in these cultivars. However, infection types of these cultivars under inoculation of North-Western Pst isolate was moderately resistant (IT 1–2; and 2;) in comparing to cv. Chinese 166 and AvYr1 (IT 0). Cvs Bodryy, Videya, Gerda, Stat’, Shef, Akhmat, Bogema, Partner, Rifey and Rossyp’ were resistant to a West Siberian isolate avirulent to cv. Reichersberg 42; cvs Etyud and En Mars to Derbent isolate avirulent to cv. Heines Peko (Yr2).
A resistant reaction to two Pst isolates characterized four cultivars. Cvs Bylina Dona, Volodya and Timiryazevskaya yubileynaya were resistant to Krasnodar and Rostov Pst isolates avirulent to Yr27 and cv. Bumba was resistant to North-Western and West Siberian Pst isolates avirulent to cvs Hybrid 46 and Carstens V. A resistant reaction to three Pst isolates characterized seven cultivars. Cvs Iridas, Markiz, Gomer, Moskovskaya 82 and Nemchinovskaya 85 were resistant to West Siberian and North Caucasian Pst isolates from Krasnodar and Rostov avirulent to Yr17; cv. V’yuga was resistant to three North Caucasian Pst isolates avirulent to cv. Compair and cv. Status were resistant to North-Western, West Siberian and Derbent Pst isolates avirulent to Yr7. Cvs Anastasiya and En Foton were resistant to West Siberian and all North Caucasian isolates.
The reaction type of 13 Russian cultivars resistant to all used Pst isolates varied from 0 to 2. At the same time, the Avocet NILs with genes Yr5, Yr10 Yr15 and YrSp and cv. Spalding Prolific were highly resistant (score 0) (Table 1). This indicates that the genes of the studied cultivars differ from the Yr5, Yr10 and Yr15 genes. Response to inoculation for Avocet NILs with genes Yr24 and Yr26 fluctuated from 0 to 2. Middle resistant types (2, 2;) were detected during inoculation by North-Western Pst isolate, resistant (0–1) by North Caucasian isolates and highly resistant (0) by West Siberian isolate. The type of reaction of the Russian resistant cultivars differed from Avocet NILs and supplemental wheat differentials, which indicates their differing genetic control of resistance.

2.2. Detecting Yellow Rust Resistance Genes Using Molecular Markers

Identification of genes Yr5, Yr10, Yr15 and Yr24 was conducted for twelve resistant cultivars (Timiryazevka 150, Akapella, Vol’nitsa, Yelanchik, Galateya, Polina, Sharm, Yubiley Dona, Pal’mira 18, Podruga, Sirena and Fyodor). These genes were highly effective to all Russian Pst isolates [39]. Markers STS7/8 and STS9/10 linked to Yr5 and markers Xpsp3000, Xbarc8 and Barc181 linked to Yr10, Yr15 and Yr24, respectively, were not amplified on the genomic DNA of any of the resistant cultivars indicating the absence of genes. The results of molecular studies are consistent with multi-pathogen tests, where was showed that the reaction type of these cultivars differed from Avocet NILs and differential cultivars with these genes.
Marker-assisted detection of genes Yr2, Yr7, Yr9, Yr17, Yr18, Yr25 and Yr60 was performed for all winter wheat cultivars. Some of these genes had lost their effectiveness for disease protection, but they could still play a role in multiple gene resistances in countries where the frequency of virulence is quite low or absent, or in combination with other Yr genes.
SSR marker Wmc364 was used for the identification of Yr2. Genetic distance among marker Wmc364 and resistance gene Yr2 was calculated as 5.6 cM [40]. A different size of amplified alleles for this marker is present in the publication. According to Rani et al. [32], Wmc364 was +200 bp/−190 bp for distinguishing gene positive and negative genotypes, but according to Feng et al. [40], it was −207 bp/+201 bp. In our study, the cv Heines Kolben had an amplicon of approximately 190 bp. Cvs Heines Peko, Heines VII and all Russian winter genotypes yielded a fragment of a low size (Figure S1a). It is assumed that Yr2 is absent in the wheat collection studied. However, the difference between positive and negative genotypes was too low. The reason for this may be the large distance between the marker and the gene.
Microsatellite marker CFD77 was used for the identification of Yr7 [32]. According to McIntosh et al. [5], Yr7 is allelic or closely linked with Yr5. In our Pst virulence surveys [39], the reaction of NILAvYr7 and cvs Lee and Reichersberg 42 having also Yr7 gene differs strongly from NILAv with gene Yr5. Of the infection types used in this study, Pst isolates varied from moderately resistant to susceptible for NILAvYr7 and cv Reichersberg 42 but were highly susceptible (IT 3 and 4) for cvs Lee. The reaction of NIL AvYr5 was always highly resistant (IT 0), which indicates the differences between these genes. SSR marker CFD77 amplified a 220-bp allele in genotypes with Yr7. This fragment was detected in all Russian cultivars and differentials (NIL AvYr7, Lee and Reichersberg 42). Similar results were reported by Rani et al. [32] from molecular studies of Indian wheat genotypes. However, in our study, this marker amplified an additional fragment in positive differentials with a size near 300 bp, but it was not detected in the wheat cultivars studied (Figure S1b).
Marker SCM9 was selected to identify Yr9. The rye microsatellite marker SCM9 was able to detect different sources of wheat-rye translocations involving 1BL.1RS with Yr9 gene and 1AL.1RS with unknown Yr gene. A band of 228 bp was associated with genotypes with 1AL.1RS, and a 207-bp band in those with Yr9 (Figure S1c) [41]. Twelve wheat cultivars (17%) had amplicon 228 bp indicating the presence of gene Yr9, and two cultivars had amplicon 207 bp (1AL.1RS translocation) (Table 2).
The presence of Yr17 was examined with the marker VENTRIUP/LN2 [42]. Positive wheat genotypes with Yr17 amplified a 259-bp fragment (Figure S1d). Three wheat cultivars (Markiz, Gomer and Nemchinovskaya 85) were postulated to have Yr17. These cultivars were resistant to the three Pst isolates avirulent to Yr17 and were susceptible to two isolates virulent to Yr17 (Table 1 and Table 2).
STS marker, csLV34, was used for the detection of the presence of Yr18 [43]. This marker is located 0.4 cM distal to Yr18 [44] and had two allelic variants. The 150- and 229-bp bands indicated the presence and absence of Yr18, respectively (Figure S1e). Twenty-five genotypes (35%) amplified 150-bp fragments (Table 2).
A microsatellite marker, Xgwm6, was used for the identification of Yr25 [32,45]. Cvs Strubes Dickkopf, Heines Peko, Carstens V and Heines VII were used as positive controls (Table 1). All positive controls and Russian cultivars produced amplicons with sizes near 150 bp (Figure S1f). Another allele was not detected in the positive genotypes. The reason for this could be the absence of gene Yr25 in the differential cultivars used or the low effectiveness of markers for the identification of Yr25. Also, no diagnosing ability of Xgwm6 was reported for molecular studies of an Indian wheat genotype [32].
Two microsatellite markers, Wmc313 and Wmc776, were used for the identification of Yr60. This gene confers moderate resistance at both the seedling and the adult plant stages [46]. A positive control for this gene was not included in our study. According to Rani et al. [32], Wmc313 amplifies 180- and 200-bp alleles in positive genotypes, and wmc776 amplifies three alleles of 150, 160 and 170 bp, respectively. During the testing of Russian wheat cultivars with marker Wmc313, we obtained either one amplicon with a size near 200 bp or nothing (Figure S1g). The presence of an allele of 150 bp was revealed with marker wmc776 (Figure S1i). It is, therefore, concluded that Yr60 is absent in Russian genotypes. The donor of this gene is the Mexican wheat line Almop [32], and genotypes with Yr60 have not been used in wheat breeding in Russia.
Many results (absence of certain Yr genes and presence of others) are consistent with the results reported for Western and Central Europe. However, the proportion of cultivars presenting some of the Yr is notably different.

3. Discussion

Over the last two decades, with the emergence of new Pst races, wheat yellow rust has been posing a serious threat to wheat production worldwide. To mitigate this threat, intensive global efforts are underway to carefully monitor the evolution and dispersal of Pst races, determine the pathotypes of isolates, screen disease-resistant germplasm and breed wheat cultivars with durable disease resistance [22].
In this study, 72 modern Russian commercial winter wheat cultivars were evaluated using Pst isolates. Multi-pathogen tests were combined with DNA marker data to postulate the presence of Yr genes. The disease reaction types of the cultivars differed significantly following inoculation with Pst isolates from geographically separated distant regions (North Caucasus, North-West and West Siberia); regions that are separated by thousands of kilometers. The number of winter wheat cultivars resistant to the West Siberian Pst isolate was significantly higher than to North Caucasian and North-West Pst isolates where disease outbreaks occur annually.
In the past five years, the significance of yellow rust has notably risen in all areas of the North Caucasus region. It is detected annually in spring from stem extension stages to heading, which results in the need to apply fungicidal treatments [47]. In the North-West region, disease appears in the last half of June at the flowering stage of winter wheat, and the maximum of the Pst development is detected at the ripening stage. A similar situation with yellow rust incidence has been observed in the region of Central Chernozem [21]. The disease is observed sporadically in the Western Siberia and Volga region on spring wheat [19,20].
Thirteen wheat cultivars had resistance to all Pst races tested at the seedling stage. According to the Russian State register [34,35,36,37] most of these are characterized as having field resistance. This indicates that these cultivars could contain (1) a single (or multiple) effective gene(s) to which all pathotypes are effective, (2) an effective combination of genes that have lost their effectiveness in their single form or (3) a very high durable resistance that may be a combination of race-specific genes inducing resistance at the seedling stage and/or genes with quantitative effects. When molecular markers were used to identify the highly effective resistance genes Yr5, Yr10, Yr15 and Yr24, indicative DNA fragments were observed only in the positive controls, indicating that none of the entries had these genes. Virulence to these genes is not known in Russia [39]. Resistance genes Yr5 and Yr15 remain effective against the predominant Pst races worldwide [13,33,48,49]. Virulence to Yr10 and Yr24 occurs in some regional populations around the globe, but at a low frequency [13,50]. Despite Yr5, Yr10, Yr15 and Yr24 not being detected in Russian cultivars, these genes are commonly deployed in some other countries [31,32].
In molecular analysis, the frequent presence of Yr9 and Yr18 was detected (17 and 35% of cultivars, respectively). The donors of seedling resistance gene Yr9 and partial resistance gene (or slow-rusting genes) Yr18 were first used in wheat breeding in 1970. The resistance breakdown of Yr9 has occurred since the late 1980s due to the widespread emergence of virulent Pst races worldwide. This has resulted in major epidemics of yellow rust that have challenged world wheat production [51,52]. Yr9 is closely linked with Sr31, Lr26 and Pm8, and it is located on the short arm of rye chromosome 1 (1RS). It has been widely used in wheat by means of wheat-rye translocation chromosomes [53]. The 1BL.1RS translocation in Russian winter wheat cultivars was derived from cv. Kavkaz. Currently, wheat cultivars worldwide with Yr9 are mostly susceptible to yellow rust. Despite this, donors of this translocation are still widely used in modern wheat breeding. The presence of this translocation may relate more to its connotation with widespread adaptability and higher wheat yield [54]. Two Russian genotypes had 1AL.1RS translocations of 1RS origin from the same rye cv. Insave. The 1RS translocation is derived from rye cv. Imperial has the stem rust resistance gene SrR but no known leaf or yellow rust or powdery mildew resistance genes [53].
Seedling resistance genes are detected during both the seedling and adult plant stages and as such constitute an all-stage resistance phenotype. The majority of genes that confer race-specific resistance to rusts and other biotrophic fungi (R genes) remain effective for only a few years when deployed at a larger scale. APR is commonly detected at the post-seedling stage and often as field resistance. A large proportion of seedling resistance genes exhibit phenotypes of major effect and with varying infection types, whereas most of the APR genes are partial in effect with varying levels of disease severity. Locus with genes Yr18, Lr34, Sr38, Pm38 and Bdv1 is globally used as a component of durable rust resistance in breeding programs. Flag leaves of many wheat cultivars containing this locus in certain environments develop a necrotic leaf tip. This morphological marker is referred to as leaf tip necrosis (Ltn1) [55,56]. The additive effects of these slow-rusting genes form the basis of durable resistance to rusts in wheat cultivars worldwide [44,57]. This gene was found either alone or in combination with Yr8 in the cultivars tested. In Russia specifically, Yr18 has lost effectiveness, but it still enhances resistance in combination with other resistance genes. Also, the same has been shown for leaf rust resistance [58,59]. Genotypes with three or more ineffective leaf rust genes (e.g., Lr1, Lr3, Lr10 and Lr20) in combination with Lr34 have higher resistance in the field than those with only one or two of these genes.
Molecular marker detection indicated that only 4% of the cultivars tested had Yr17. As indicated, Yr17 has long been demonstrated to be ineffective in Western Europe through many studies but remains present in the material despite the virulence of many current Pst pathotypes [22]. This gene originated from T. ventricosum and is tightly linked to leaf rust resistance gene Lr37, stem rust resistance gene Sr38 and yellow rust resistance gene Yr17 [5]. The Yr17 resistance gene has been incorporated into wheat cultivars in Northern Europe since the mid-1970s. Wheat cultivars with Yr17 were first grown in the UK, Denmark, France and Germany in 1980–1990 [60]. Virulence to Yr17 was detected in 1995, following intensive use of this single resistance gene in widely grown cultivars [61]. Currently, Yr17-virulence is common in northwestern European Pst populations. The Russian Pst isolates studied in 2019–2021 [39] were mostly avirulent to Yr17. Two isolates virulent to Yr17 from North-West and Derbent were used in this study.
The use of molecular markers in wheat breeding is a fast and efficient way to confirm and detect the presence of resistance genes. They have an edge over the standard phenotyping as these are not affected by plant growth stages or the environment [62]. In the present study, DNA markers were used to postulate the presence of Yr2, Yr5, Yr7, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr25 and Yr60. Mostly, these markers were highly effective for the identification of Yr genes. However, some of them gave inconclusive results, which could have been due to some lack of specificity of the markers (e.g., marker Wmc364 for Yr2, CFD77 for Yr7 and Xgwm6 for Yr25). A similar outcome for these markers was reported for other studies [32].

4. Materials and Methods

4.1. Plant Materials

Seventy-two winter wheat cultivars included in the Russian Register of Breeding Achievement (National List) and approved for use in seven geographically distant Russian regions (North-West, Central, Central Chernozem, Middle Volga, North Caucasus, Ural and West Siberia) in 2019–2022 were assessed in this study (Table 2). Of these, the North Caucasian cultivars dominated (63%). Disease epidemics in Russia have been frequent and destructive, mostly in the North Caucasus. The field resistance of this material to a range of diseases has been previously evaluated in state regional nurseries. Generalized characteristics of new wheat cultivars are presented in an official publication of the Russian Register [34,35,36,37,63].

4.2. Seedling Tests

Three to five seeds of each genotype were planted in 10 cm diameter plastic pots in a disease-free area. Twelve- to fifteen-day-old plants were used for yellow rust resistance assessments [54]. Urediniospores of a single isolate were suspended in Novec 7100 (3M, St. Paul, MN, USA) in a glass tube and connected to the airbrush spray gun. This suspension was sprayed onto seedlings (2-leaf stage) of each cultivar. The inoculated plants were incubated in a dark dew chamber at 10 °C for 24 h and then transferred to a growth chamber (Environmental Test Chamber MLR-352H, Sanyo Electric Co., Ltd., Osaka, Japan) with 16:8 h L:D photoperiod at 16 and 10 °C, respectively.
Five isolates of P. striiformis were used to inoculate the wheat cultivars at the seedling stage. These isolates were selected during virulence studies of Russian Pst populations in 2020–2022. The virulence–avirulence profiles are shown in Table 1. Cvs Jupateco S and Avocet S were used as susceptible controls.
Seedling infection type was scored after 16–18 days on a five-point scale [64]: 0, no visible uredia or necrotic areas without sporulation; 1, necrotic and chlorotic areas with restricted sporulation; 2, moderate sporulation with necrosis and chlorosis; 3, sporulation with chlorosis; and 4, abundant sporulation without chlorosis. More visual necrosis or chlorosis than the average for scores 1 to 3 are indicated by an appending a semicolon. Infection types 0 to 2 were considered resistant and 3 to 4 susceptible.

4.3. DNA Extraction, PCR Amplification and Electrophoresis

Genomic DNA was extracted by the method of Dorokhov and Klocke [65]. The DNA stock solution was adjusted to a concentration of 100–150 ng/mL with nuclease-free sterile water as the working concentration for the polymerase chain reaction (PCR) and stored at −20 °C. PCRs were performed using a thermocycler (C1000, BioRad, Hercules, CA, USA) in 20 mL of a PCR mixture containing 100–150 ng of genomic DNA, 2 units of Taq DNA polymerase, 1X PCR buffer (10 mM Tris HCL), 2.5 mM of MgCl2, 100 mM of each dNTP and 10 mM of each primer. The recommended PCR protocol was used in amplifications. PCR products were separated on 1.5 to 3% agarose gels (depending on gene product size) and visualized under UV light using the digital gel imaging system (GelDocGo, BioRad, Hercules, CA, USA).
All cultivars were evaluated with molecular markers (Table 3) linked to 11 known genes, Yr2, Yr5, Yr7, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr25 and Yr60.

5. Conclusions

The present study provides information on the resistance of modern Russian winter wheat cultivars to yellow rust and contributing diversity for Yr genes. Multi-pathogen tests were used for the determination of the resistance phenotype and molecular markers for the resistance gene presence (Yr2, Yr5, Yr7, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr25 and Yr60). Thirteen genotypes that were highly resistant to all used Pst isolates and resistant in the field were detected (17%). The resistance genes Yr5, Yr10, Yr15 and Yr24 were effective against all Russian Pst races. However, they were not found in these resistant cultivars. Consequently, these cultivars might have either a novel resistance gene(s) or an effective combination of other resistance genes.
The genes, Yr9, Yr17 and Yr18, and translocation 1AL.1RS, widely used in wheat cultivars worldwide were present in the Russian material. Although, they have lost their effectiveness when used alone, they can still be used together, or along with many other Yr genes, to enhance genetic diversity and the overall level and durability of yellow rust resistance.
The information obtained in this study will be important for managing yellow rust in wheat through the incorporation of the currently available resistant genotypes, genes and markers in breeding of new cultivars with resistance to yellow rust, and for the study and interpretation of possible changes in virulence of Pst population.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12193471/s1, Figure S1: Electrophoretogram for microsatellite markers of Yr2, Yr7, Yr9, Yr17, Yr18, Yr25 and Yr60 resistance genes.

Author Contributions

Conceptualization, E.G.; methodology, E.G. and E.S.; validation, E.G. and E.S.; formal analysis, E.G.; investigation, E.G. and E.S.; data curation, E.G.; writing—original draft preparation, E.G. and E.S.; writing—review and editing, E.G.; project administration, E.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Russian Science Foundation, grant No. 23-26-00042.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data are provided in the manuscript.

Acknowledgments

Editorial support of Ian Riley is highly appreciated.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Filip, E.; Woronko, K.; Stępień, E.; Czarniecka, N. An overview of factors affecting the functional quality of common wheat (Triticum aestivum L.). Int. J. Mol. Sci. 2023, 24, 7524. [Google Scholar] [CrossRef]
  2. The International Wheat Genome Sequencing Consortium (IWGSC). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 2014, 345, 1251788. [Google Scholar] [CrossRef]
  3. Medvedeva, A. Consumer Goods Production in Russia 2020: Crop Area Structure and Yields. AgroXXI Agro-Industrial Portal. 2021. Available online: https://www.agroxxi.ru/analiz-rynka-selskohozjaistvennyh-tovarov/proizvodstvo-zerna-v-rossii-2020-struktura-posevnyh-ploschadei-i-urozhainost.html (accessed on 22 August 2022). (In Russian).
  4. Afonin, A.N.; Greene, S.L.; Dzyubenko, N.I.; Frolov, A.N. (Eds.) Interactive Agricultural Ecological Atlas of Russia and Neighboring Countries. Economic Plants and Their Diseases, Pests and Weeds. 2008. Available online: http://www.agroatlas.ru (accessed on 22 August 2022). (In Russian).
  5. McIntosh, R.A.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO: Canberra, Australia, 1995. [Google Scholar]
  6. Ali, S.; Hodson, D. Wheat rust surveillance: Field disease scoring and sample collection for phenotyping and molecular genotyping. Methods Mol. Biol. 2017, 1659, 3–11. [Google Scholar] [CrossRef]
  7. Lan, C.; Randhawa, M.S.; Huerta-Espino, J.; Singh, R.P. Genetic analysis of resistance to wheat rusts genotyping. Methods Mol. Biol. 2017, 1659, 137–149. [Google Scholar] [CrossRef] [PubMed]
  8. Roelfs, A.P.; Singh, R.P.; Saari, E.E. Rust Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: México-Veracruz, Mexico, 1992. [Google Scholar]
  9. Mboup, M.; Bahri, B.; Leconte, M.; De Vallavieille-Pope, C.; Kaltz, O.; Enjalbert, J. Genetic structure and local adaptation of European wheat yellow rust populations: The role of temperature-specific adaptation. Evol. Appl. 2012, 5, 341–352. [Google Scholar] [CrossRef] [PubMed]
  10. Milus, E.A.; Kristensen, K.; Hovmøller, M.S. Evidence for increased aggressiveness in a recent widespread strain of Puccina striiformis f. sp. tritici causing stripe rust of wheat. Phytopathology 2009, 99, 89–94. [Google Scholar] [CrossRef] [PubMed]
  11. De Vallavieille-Pope, C.; Ali, S.; Leconte, M.; Enjalbert, J.; Delos, M.; Rouzet, J. Virulence dynamics and regional structuring of Puccinia striiformis f. sp. tritici in France between 1984 and 2009. Plant Dis. 2012, 96, 131–140. [Google Scholar] [CrossRef]
  12. Hovmøller, M.S.; Walter, S.; Bayles, R.A.; Hubbard, A.; Flath, K.; Sommerfeldt, N.; Leconte, M.; Czembor, P.; Rodriguez-Algaba, J.; Thach, T.; et al. Replacement of the European wheat yellow rust population by new races from the centre of diversity in the near-Himalayan region. Plant Pathol. 2016, 65, 402–411. [Google Scholar] [CrossRef]
  13. Sharma-Poudyal, D.; Chen, X.M.; Wan, A.M.; Zhan, G.M.; Kang, Z.S.; Cao, S.Q.; Jin, S.L.; Morgounov, A.; Akin, B.; Mert, Z.; et al. Virulence characterization of international collections of the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici. Plant Dis. 2013, 97, 379–386. [Google Scholar] [CrossRef]
  14. Kokhmetova, A.; Sharma, R.; Rsaliyev, S.; Galymbek, K.; Baymagambetova, K.; Ziyaev, Z.; Morgounov, A. Evaluation of Central Asian wheat germplasm for stripe rust resistance. Plant Genet. Resour. 2018, 16, 178–184. [Google Scholar] [CrossRef]
  15. Chen, X.; Wang, M.; Wan, A.; Bai, Q.; Li, M.; López, P.F.; Maccaferri, M.; Mastrangelo, M.; Barnes, C.; Fabricio, D.; et al. Virulence characterization of Puccinia striiformis f. sp. tritici collections from six countries in 2013 to 2020. Can. J. Plant Pathol. 2021, 43, 308–322. [Google Scholar] [CrossRef]
  16. Wellings, C.R. Puccinia striiformis in Australia: A review of the incursion, evolution, and adaptation of stripe rust in the period 1979–2006. Aust. J. Agric. Res. 2007, 58, 567–575. [Google Scholar] [CrossRef]
  17. Sanin, S.S. Agricultural plant disease control—The main factor of the crop production intensification. Plant Prot. News. 2010, 1, 3–14. (In Russian) [Google Scholar]
  18. Gultyaeva, E.; Shaydayuk, E.; Gannibal, P.H.; Kosman, E. Analysis of host-specific differentiation of Puccinia striiformis in the South and North-West of the European Part of Russia. Plants 2021, 10, 2497. [Google Scholar] [CrossRef]
  19. Ivanova, Y.N.; Rosenfread, K.K.; Stasyuk, A.I.; Skolotneva, E.S.; Silkova, O.G. Raise and characterization of a bread wheat hybrid line (Tulaykovskaya 10 × Saratovskaya 29) with chromosome 6Agi2 introgressed from Thinopyrum intermedium. Vavilov J. Genet. Breed. 2021, 25, 701–712. [Google Scholar] [CrossRef] [PubMed]
  20. Druzhin, A.E. Effect of climate change on the structure of populations of spring wheat pathogens in the Volga region. Agrar. Report. South-East 2010, 1, 31–36. (In Russian) [Google Scholar]
  21. Zeleneva, Y.V.; Sudnikova, V.P.; Buchneva, G.N. Immunological characteristics of soft winter wheat varieties in conditions of the CBR. Proc. Kuban State Agrar. Univ. 2022, 96, 95–99. [Google Scholar] [CrossRef]
  22. Perronne, R.; Dubs, F.; de Vallavieille-Pope, C.; Leconte, M.; du Cheyron, P.; Cadot, V.; Vidal, T.; Enjalbert, J. Spatiotemporal changes in varietal resistance to wheat yellow rust in France reveal an increase in field resistance level during the period 1985–2018. Phytopathology 2021, 111, 1602–1612. [Google Scholar] [CrossRef]
  23. Yang, R.C.; Peng, F.Y.; Hu, Z.Q. Inferring defense-related gene families in Arabidopsis and wheat. BMC Genom. 2017, 18, 980. [Google Scholar] [CrossRef]
  24. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Xia, X.C.; Raupp, W.J.V. Catalogue of Gene Symbols for Wheat: 2022 Supplement. Annu. Wheat Newsl. 2022, 68, 68–81. Available online: https://wheat.pw.usda.gov/ggpages/awn/68/AWN (accessed on 22 August 2023).
  25. McIntosh, R.A.; Yamazaki, Y.; Dubcovsky, J.; Rogers, J.; Morris, C.; Appels, R.; Xia, X.C. Catalogue of Gene Symbols for Wheat: 2013–2014 Supplement. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2013.pdf (accessed on 22 August 2022).
  26. McIntosh, R.A.; Dubcovsky, J.; Rogers, W.J.; Morris, C.; Xia, X.C. Catalogue of Gene Symbols for Wheat: 2017 Supplement. Available online: https://shigen.nig.ac.jp/wheat/komugi/genes/macgene/supplement2017.pdf (accessed on 22 August 2023).
  27. Brar, G.S.; Kutcher, H.R. Race characterization of Puccinia striiformis f. sp. tritici, the cause of wheat stripe rust, in Saskatchewan and Southern Alberta, Canada and virulence comparison with races from the United States. Plant Dis. 2016, 100, 1744–1753. [Google Scholar] [CrossRef] [PubMed]
  28. Bouvet, L.; Holdgate, S.; James, L.; Thomas, J.; Mackay, I.J.; Cockram, J. The evolving battle between yellow rust and wheat: Implications for global food security. Theor. Appl. Genet. 2022, 135, 741–753. [Google Scholar] [CrossRef] [PubMed]
  29. Ye, B.; Singh, R.P.; Yuan, C.; Liu, D.; Randhawa, M.S.; Huerta-Espino, J.; Bhavani, S.; Lagudah, E.; Lan, C. Three co-located resistance genes confer resistance to leaf rust and stripe rust in wheat variety Borlaug 100. Crop J. 2022, 10, 490–497. [Google Scholar] [CrossRef]
  30. MasWheat. Stripe Rust Resistance Genes. Available online: https://maswheat.ucdavis.edu/protocols (accessed on 22 August 2023).
  31. Kokhmetova, A.; Rsaliyev, A.; Malysheva, A.; Atishova, M.; Kumarbayeva, M.; Keishilov, Z. Identification of stripe rust resistance genes in common wheat cultivars and breeding lines from Kazakhstan. Plants 2021, 10, 2303. [Google Scholar] [CrossRef]
  32. Rani, R.; Singh, R.; Yadav, N.R. Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers. Comptes Rendus Biol. 2019, 342, 154–174. [Google Scholar] [CrossRef] [PubMed]
  33. Gangwar, P.; Kumar, S.; Bhardwaj, S.C.; Prasad, P.; Kashyap, P.L.; Khan, H.; Singh, G.P.; Savadi, S. Virulence and molecular diversity among Puccinia striiformis f. sp. tritici pathotypes identified in India between 2015 and 2019. Crop Prot. 2021, 148, 105717. [Google Scholar] [CrossRef]
  34. Characteristics of Plant Varieties Included in Public Register of Breeding Achievements in 2018 for the First Time and Approved for Use: Official Publication; FGBNU «Rosinformagrotekh»: Moscow, Russia, 2019; 460p, Available online: https://gossortrf.ru/publication/opisaniya-selektsionnykh-dostizheniy.php (accessed on 22 August 2023). (In Russian)
  35. Characteristics of Plant Varieties Included in Public Register of Breeding Achievements in 2020 for the First Time and Approved for Use: Official Publication; FGBNU «Rosinformagrotekh»: Moscow, Russia, 2020; 490p, Available online: https://gossortrf.ru/publication/opisaniya-selektsionnykh-dostizheniy.php (accessed on 22 August 2023). (In Russian)
  36. Characteristics of Plant Varieties Included in Public Register of Breeding Achievements in 2021 for the First Time and Approved for Use: Official Publication; FGBNU «Rosinformagrotekh»: Moscow, Russia, 2021; 404p, Available online: https://gossortrf.ru/publication/opisaniya-selektsionnykh-dostizheniy.php (accessed on 22 August 2023). (In Russian)
  37. Characteristics of Plant Varieties Included in Public Register of Breeding Achievements in 2022 for the First Time and Approved for Use: Official Publication; FGBNU «Rosinformagrotekh»: Moscow, Russia, 2022; 504p, Available online: https://gossortrf.ru/publication/opisaniya-selektsionnykh-dostizheniy.php (accessed on 22 August 2023). (In Russian)
  38. Catalogue of National Center of Grain Named, P.P. Lukyanenko; EDVI: Krasnodar, Russia, 2022; 152p. (In Russian) [Google Scholar]
  39. Gultyaeva, E.; Shaydayuk, E.; Kosman, E. Virulence diversity of Puccinia striiformis f. sp. tritici in common wheat in Russian regions in 2019–2021. Agriculture 2022, 12, 1957. [Google Scholar] [CrossRef]
  40. Feng, L.; Xu, S.; Zhang, L.; Miao, Q.; Zhai, Q.; Li, N. SSR marker of wheat stripe rust resistance gene Yr2. J. Trit. Crops 2005, 25, 17–19. [Google Scholar]
  41. Weng, Y.; Azhaguvel, P.; Devkota, R.N.; Rudd, J.C. PCR based markers for detection of different sources of 1AL.1RS and 1BL.1RS wheat-rye translocations in wheat background. Plant Breed. 2007, 126, 482–486. [Google Scholar] [CrossRef]
  42. Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong-qi, L.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop. Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
  43. Lagudah, E.S.; McFadden, H.; Singh, R.P.; Huerta-Espino, J.; Bariana, H.S.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21–30. [Google Scholar] [CrossRef] [PubMed]
  44. Singh, R.P.; Trethowan, R. Breeding spring bread wheat for irrigated and rainfed production systems of developing world. In Breeding Major Food Staples; Kang, M., Priyadarshan, P.M., Eds.; Blackwell: Ames, IA, USA, 2007; pp. 109–140. [Google Scholar]
  45. Chawla, V. Genetic diversity of bread wheat genotypes (Triticum aestivum L.) revealed by microsatellite SSR markers for leaf and stripe rust resistance. J. Pharmacogn. Phytochem. 2019, 8, 86–93. [Google Scholar] [CrossRef]
  46. Herrera-Foessel, S.A.; Singh, R.P.; Lan, C.X.; Huerta-Espino, J.; Calvo-Salazar, V.; Bansal, U.K.; Bariana, H.S.; Lagudah, E.S. Yr60, a gene conferring moderate resistance to stripe rust in wheat. Plant Dis. 2015, 99, 508–511. [Google Scholar] [CrossRef]
  47. Volkova, G.V.; Shulyakovskaya, L.N.; Kudinova, O.A.; Matveeva, I.P. Yellow rust of wheat on Kuban. Plant Prot. Quar. 2018, 4, 22. (In Russian) [Google Scholar] [CrossRef]
  48. Shahin, A.A. Occurrence of new races and virulence changes of the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) in Egypt. Arch. Phytopathol. Plant Prot. 2020, 53, 552–569. [Google Scholar] [CrossRef]
  49. Amil, R.E.; Ali, S.; Bahri, B.; Leconte, M.; de Vallavieille-Pope, C.; Nazari, K. Pathotype diversification in the invasive PstS2 clonal lineage of Puccinia striiformis f. sp. tritici causing yellow rust on durum and bread wheat in Lebanon and Syria in 2010–2011. Plant Pathol. 2020, 69, 618–630. [Google Scholar] [CrossRef]
  50. Hovmøller, M.S.; Patpour, M.; Rodriguez-Algaba, J.; Thach, T.; Sørensen, C.K.; Justesen, A.F.; Hansen, J.G. GRRC Report of Yellow and Stem Rust Genotyping and Race Analyses 2021. Available online: https://agro.au.dk/fileadmin/www.grcc.au.dk/International_Services/Pathotype_YR_results/GRRC_Annual_Report2021.pdf (accessed on 25 August 2022).
  51. Chen, W.; Wellings, C.; Chen, X.; Kang, Z.; Liu, T. Wheat stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici. Mol. Plant Pathol. 2014, 15, 433–446. [Google Scholar] [CrossRef]
  52. Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
  53. Mago, R.; Spielmeyer, W.; Lawrence, G.J.; Lagudah, E.S.; Ellis, J.G.; Pryor, A. Identification and mapping of molecular markers linked to rust resistance genes located on chromo-some 1RS of rye using wheat-rye translocation lines. Theor. Appl. Genet. 2002, 104, 1317–1324. [Google Scholar] [CrossRef]
  54. Li, J.; Shi, L.; Wang, X.; Zhang, N.; Wei, X.; Zhang, L.; Yang, W.; Liu, D. Leaf rust resistance of 35 wheat cultivars (lines). J. Plant Pathol. Microbiol. 2018, 9, 1. [Google Scholar] [CrossRef]
  55. Dyck, P.L. Inheritance of leaf rust and stem rust resistance in ‘Roblin’ wheat. Genome 1992, 36, 289–293. [Google Scholar] [CrossRef]
  56. Singh, R.P. Association between gene Lr34 for leaf rust resistance and leaf tip necrosis in wheat. Crop Sci. 1992, 32, 874–878. [Google Scholar] [CrossRef]
  57. Lagudah, E.S.; Krattinger, S.G.; Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; Spielmeyer, W.; Brown-Guedira, G.; Selter, L.L.; Keller, B. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor. Appl. Genet. 2009, 119, 889–898. [Google Scholar] [CrossRef] [PubMed]
  58. German, S.E.; Kolmer, J.A. Effect of gene Lr34 in the enhancement of resistance to leaf rust of wheat. Theor. Appl. Genet. 1992, 84, 97–105. [Google Scholar] [CrossRef]
  59. Dakouri, A.; McCallum, B.D.; Radovanovic, N.; Cloutier, S. Molecular and phenotypic characterization of seedling and adult plant leaf rust resistance in a world wheat collection. Mol. Breed. 2013, 32, 663–677. [Google Scholar] [CrossRef] [PubMed]
  60. Coriton, O.; Jahier, J.; Leconte, M.; Huteau, V.; Trotoux, G.; Dedryver, F.; de-Vallavieille-Pope, C. Double dose efficiency of the yellow rust resistance gene Yr17 in bread wheat lines. Plant Breed. 2019, 139, 263–271. [Google Scholar] [CrossRef]
  61. Bayles, R.A.; Flath, K.; Hovmøller, M.S.; de Vallavieille-Pope, C. Breakdown of the Yr17 resistance to yellow rust of wheat in northern Europe —A case study by the yellow rust sub-group of COST 817. Agronomie 2000, 20, 805–811. [Google Scholar] [CrossRef]
  62. Pal, D.; Kumar, S.; Bhardwaj, S.C.; Harikrishna; Devate, N.B.; Patial, M.; Parmeshwarappa, S.K.V. Molecular marker aided characterization of race specific and non-race specific rust resistance genes in elite wheat (Triticum spp.) germplasm. Australas. Plant Pathol. 2022, 51, 261–272. [Google Scholar] [CrossRef]
  63. State Register for Selection Achievements Admitted for Usage (National List). Vol. 1.“Plant Varieties” (Official Publication); (Gosreestr, 2020, 2021, 2022); Moscow; FGBNU «Rosinformagrotekh»: Moscow, Russia, 2022; 646p, Available online: https://reestr.gossortrf.ru/ (accessed on 25 August 2023). (In Russian)
  64. Gassner, G.; Straib, W. Untersuchungen Über die Infektions bedingungen von Puccinia glumarum und Puccinia graminis. Arb. Biol. Reichsanst. Land-Forst-Wirtsch Berl.-Dahl. 1932, 16, 609–629. [Google Scholar]
  65. Dorokhov, D.B.; Cloquet, E. A Rapid and economic technique for RAPD analysis of plant genomes Fast and economical technology of RAPD analysis of plant genomes. Russ. J. Genet. 1997, 33, 358–365. [Google Scholar]
  66. MasWheat. Stripe Rust Resistance Gene Yr5. Available online: https://maswheat.ucdavis.edu/protocols/Yr5 (accessed on 25 August 2023).
  67. Bariana, H.S.; Brown, G.N.; Ahmed, N.U.; Khatkar, S.; Conner, R.L.; Wellings, C.R.; Haley, S.; Sharp, P.J.; Laroche, A. Characterisation of Triticum vavilovii-derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. Theor. Appl. Genet. 2002, 104, 315–320. [Google Scholar] [CrossRef] [PubMed]
  68. MasWheat. Stripe Rust Resistance Gene Yr15. Available online: https://maswheat.ucdavis.edu/protocols/Yr15 (accessed on 25 August 2023).
  69. Zhang, X.; Han, D.; Zeng, Q.; Duan, Y.; Yuan, F.; Shi, J.; Wang, Q.; Wu, J.; Huang, L.; Kang, Z. Fine mapping of wheat stripe rust resistance gene Yr26 based on collinearity of wheat with Brachypodium distachyon and rice. PLoS ONE 2013, 8, e57885. [Google Scholar] [CrossRef] [PubMed]
Table 1. Characteristic of infection types of the Avocet NILs and wheat differentials during inoculation with Puccinia striiformis isolates from different Russian regions.
Table 1. Characteristic of infection types of the Avocet NILs and wheat differentials during inoculation with Puccinia striiformis isolates from different Russian regions.
Wheat AccessionYr GeneNWNC_DNC_KrNC_RWS
Yr1/6*Avocet SYr103333
Yr5/6*Avocet SYr500000
Yr6/6*Avocet SYr633333
Yr7/6*Avocet SYr72;1–2;2–3;32;
Yr8/6*Avocet SYr82–3;3333
Yr9/6*Avocet S Yr933333
Yr10/6*Avocet SYr1000000
Yr15/6*Avocet SYr1500000
Yr17/6*Avocet SYr172–330–1;1–2;0
Yr18/6*Avocet SYr1833333
Yr24/6*Avocet SYr242;0–1;0–1;0–1;0;
Yr26/6*Avocet SYr262;0–1;0–1;0–1;0;
YrSP/6*Avocet SYrSp00000
Yr27/6*Avocet SYr272–3;30;0–2;3
Chinese 166Yr103333
LeeYr7, Yr+33–4333
Heines KolbenYr6, Yr23–43–4333
Vilmorin 23Yr3, Yr+2–32–3333
MoroYr10, YrMor0;0000
Strubes DickkopfYrSD, Yr25, Yr+222–333
Suwon 92/OmarYrSu, Yr+3–433–433
Hybrid 46Yr4, Yr+233–432;
Reichersberg 42Yr7, Yr+32–33–432;
Heines PekoYr2, Yr6, Yr25, Yr+3–42;3–433
Nord DesprezYr3, YrND, Yr+0–1;02;2;2;
CompairYr8, Yr193–40–2;2;23
Carstens VYr32, Yr25, Yr+0–1;2–33–432;
Spaldings ProlificYrSP, Yr+00000
Heines VIIYr2, Yr25, Yr+2–32–32–332–3;
Jupateco S, Avocet Ssusceptible check3–43–43–43–43–4
Origin of P. striiformis isolates: NW, North-West; NC, North Caucasus: D, Derbent; Kr, Krasnodar; R, Rostov; WS, West Siberia. Infection type 0 (immune), no visible uredia; 1 (resistant), small uredia with necrosis; 2 (resistant to moderately resistant), small to medium sized uredia with green areas and surrounded by necrosis or chlorosis; 3 (moderately resistant/moderately susceptible), medium sized uredia with or without chlorosis; 4 (susceptible), large uredia without chlorosis. Symbols (;) is larch hypersensitive flecks [5].
Table 2. Characteristic of winter common wheat included in the Russian Register of Breeding Achievement in 2019–2022 for yellow rust resistance.
Table 2. Characteristic of winter common wheat included in the Russian Register of Breeding Achievement in 2019–2022 for yellow rust resistance.
CultivarProduction Region 1Field Resistance 2Puccinia striiformis Infection TypesYr Genes
NW 3NC_DNC_KrNC_RWS
2019
ArsenalNC, LVR2;3333Yr18
Bazal’t 2LV-3–432+–333Yr18
BodryyC-332+–330–2;
DonmiraNC-33333
EtyudNC, LVR2+–30–12+–32+–33−Yr18
FelitsiyaC-2–33333Yr18
GerdaNCR33331–2;
IridasNC-2–330;0–10Yr9
KavalerkaNCR33333
KoronaNC-33 333Yr9, Yr18
MarkizNCR3–4 3220–2;Yr17
ShefNC-2+–32+–32+–32+–30Yr18
Stat’LVR2–33330Yr18
STRG 8060 15CCh-32–3333
Timiryazevka 150CCh, NC, LVR21–2;1–2;22;Yr9
VideyaNCR 33330Yr9
2020
AkapellaCCh, NCMR2;0–1220Yr18
AkhmatCC, NCR332+–330Yr9
Al’ternativaMV-332–333
AnastasiyaLV-32221–2;
ArmadaCCh, NCR33332–3Yr9
BarynyaNC-32+–33–433
Bylina DonaNC-331–2;23−
Donskaya step’NC, LV-332+–333
GomerCCh, NCYR2;–330–1;0–10;Yr17
ParitetLV-33332+–3Yr9, Yr18
SekletiyaNC, LV-32+–3333–4Yr18
TsefeyCCh-32+–32+–333
Vol’nitsaNCMR02-0;–10–10–1;Yr18
Vol’nyy DonNC-333–433Yr18
V’yugaMV-2+–3 01–2;22+–3Yr18
YelanchikNC, LVR221–220–1;
YelanskayaLV-33333
ZhavoronokNC, LV-33333Yr18
2021
Al’bireoCCh-2;2+–332+–33–4Yr18
BogemaNC-2+–32+–332+–31;–2
BumbaNCMS2;32+–330;
GalateyaC-0;222;0–1
KhamdanNC, LVYR22222;Yr18
KlassikaCCh, NC, LVR3332;3–4
Krasnoobskaya ozimayaWSR33333–4
Moskovskaya 82VV, CCh-3322;0
Nemchinovskaya 85C, VV, CCh-330;0–1;0;Yr17
PartnerNC-2+–33332Yr18
PolinaNCMR0–1;2;2;1–2;0–2;Yr9
RifeyU-2+–32+–32+–32+–31–2;Yr18
Rossyp’NC, LVMS2+–332+–32+–31–2;Yr9
SharmNCR2;22;2+;2
StatusNC, LV-2;2;2+–3;2+–30Yr9, Yr18
Stil’ 18CCh, NC, LVR2+–332+–33–42+–3
TaygetaCCh, MV-2;32;22Yr18
Yubiley DonaNC, LVMR2;221–2;2
2022
Agrofak 100CCh, NCR3–43332+–3
AmbarCCh, NC-33333–4Yr9
BatyaCCh, NC, LV-3–4333–43
En FotonCCh-3–4200–12Yr18
En MarsCCh-3–41–2;333–4
EstafetaMV-3–42+–33-2+–32+–3
FyodorCCh, NCR: YR200–1;22;Yr9
LeoNC-1–2;2+–32+–32+–32+–3Yr9
MigCCh, NCMR:YR3–43333
MoretsNC, LVR332+–32+–33Yr18
Pal’mira 18CCh, NC, MVMR2000–1;2Yr18
PodrugaLV, U-2;02;2;2;Yr18
ShkolaCCh, NC, MV, LVMR332–332–31AL.1RS
SirenaCCh-2;00–1;20–1;
Studencheskaya nivaLV-3–4332+–32+–3Yr18
Timiryazevskaya yubileynayaCCh-3–430–1;1–2;3–4
VladiC, VV-3–4333–42–3
VolodyaCCh, NC, MV-3–4300–2;3
ZarechnayaCCh-3–4333–42–31AL.1RS
ZodiakNC-32+–3333
1 Regions of the Russian Federation: NW, North-West; C, Central; CCh, Central Chernozem; MV, Middle Volga; NC, North Caucasus; U, Ural; WS, West Siberia. 2 According to the characteristics presented in the official publications “Characteristics of plant varieties included in Public Register of Breeding Achievements” [34,35,36,37] and the catalogue of the National Center of Grain named P.P. Lukyanenko [38]. R—resistant; MR—moderately resistant; MS—moderately susceptible; - no information in the Russian Register of Breeding Achievement. 3 NW, North-Western P. striiformis isolate; NC_D, North Caucasian from Derbent; NC_Kr, North Caucasian from Krasnodar; NC_R, North Caucasian from Rostov; WS, West Siberian. Symbols (+) and (−) indicate slightly larger and smaller pustule sizes, respectively [5].
Table 3. Molecular markers used for identification of Yr genes.
Table 3. Molecular markers used for identification of Yr genes.
GeneMarkerPrimer SequenceReferences
Yr2Wmc364ATCACAATGCTGGCCCTAAAAC
CAGTGCCAAAATGTCGAAAGTC		[40]
Yr5STS7/8GTACAATTCACCTAGAGT
GCAAGTTTTCTCCCTATT		[66]
STS9/10AAAGAATACTTTAATGAA
CAAACTTATCAGGATTAC
Yr7CFD77CTGCTTCAGGGATTGGAGAG
GTTTCCTGGGCTAAACCACA		[32]
Yr9SCM9TGAСААСССССТТТСССТCGT
ТСАTCGACGСТАAGGAGGАССС		[41]
Yr10Xpsp3000GCAGACCTGTGTCATTGGTC
GATATAGTGGCAGCAGGATACG		[67]
Yr15Xbarc8GCGGGAATCATGCATAGGAAAACAGAA
GCGGGGGCGAAACATACACATAAAAACA		[68]
Yr17Ventriup
LN2		AGGGGCTACTGACCAAGGCT
TGCAGCTACAGCAGTATGTACACAAAA		[42]
Yr18csLV34GTTGGTTAAGACTGGTGATGG
TGCTTGCTATTGCTGAATAGT		[43]
Yr24Barc181CGCTGGAGGGGGTAAGTCATCAC
CGCAAATCAAGAACACGGGAGAAAGAA		[32,69]
Yr25Xgwm6CGTATCACCTCCTAGCTAAACTAG
AGCCTTATCATGACCCTACCTT		[32,45]
Yr60Wmc776CCATGACGTGACAACGCAG
ATTGCAGGCGCGTTGGTA		[46]
Wmc313GCAGTCTAATTATCTGCTGGCG
GGGTCCTTGTCTACTCATGTCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gultyaeva, E.; Shaydayuk, E. Resistance of Modern Russian Winter Wheat Cultivars to Yellow Rust. Plants 2023, 12, 3471. https://doi.org/10.3390/plants12193471

AMA Style

Gultyaeva E, Shaydayuk E. Resistance of Modern Russian Winter Wheat Cultivars to Yellow Rust. Plants. 2023; 12(19):3471. https://doi.org/10.3390/plants12193471

Chicago/Turabian Style

Gultyaeva, Elena, and Ekaterina Shaydayuk. 2023. "Resistance of Modern Russian Winter Wheat Cultivars to Yellow Rust" Plants 12, no. 19: 3471. https://doi.org/10.3390/plants12193471

APA Style

Gultyaeva, E., & Shaydayuk, E. (2023). Resistance of Modern Russian Winter Wheat Cultivars to Yellow Rust. Plants, 12(19), 3471. https://doi.org/10.3390/plants12193471

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop