Characterization, Genome Sequencing, and Development of a Rapid PCR Identification Primer for Fusarium oxysporum f. sp. crocus, a New forma specialis Causing Saffron Corm Rot

Abstract

Saffron corm rot (SCR), the most serious disease affecting saffron, has been confirmed to be caused by Fusarium oxysporum in previous studies. Compared to other fungal species, F. oxysporum exhibits host specialization, a special phenomenon associated with the secreted in xylem (SIX) genes. This study examined the pathogenicity specialization of F. oxysporum isolated from saffron corms with SCR disease. The results showed that this F. oxysporum strain was strongly pathogenic to saffron corms, causing SCR; weakly pathogenic to the corms of freesia, which is in the Iridaceae family along with saffron; and not pathogenic to watermelon, melon, and tomato. Other formae speciales of F. oxysporum were not pathogenic to saffron corms. This suggests that F. oxysporum saffron strains exhibit obvious pathogenicity specialization for Iridaceae spp. Subsequently, the F. oxysporum saffron strain (XHH35) genome was sequenced, and a comparative genomics study of XHH35 and three other formae speciales was conducted using OrthoVenn3. XHH35 contained 90 specific genes absent in the other three formae speciales. These genes are involved in certain key biological processes and molecular functions. Based on BLAST homology searching, the F. oxysporum saffron strain (XHH35) genome was predicted to contain seven SIX genes (SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14) highly homologous to F. oxysporum f. sp. lycopersici, which was verified using polymerase chain reaction (PCR) amplification. The corresponding individual phylogenetic tree indicated that the F. oxysporum saffron strain (XHH35) showed a separate branch with different formae speciales. This study is the first-ever report of F. oxysporum f. sp. crocus, a new forma specialis. Based on the specificity of its SIX genes, the SIX 10 gene was selected to further establish a rapid identification technique for F. oxysporum f. sp. crocus, which will be useful in future research.

1. Introduction

Saffron (Crocus sativus L.) is a medicinal plant [1]. In China, saffron is recognized as a rare Chinese herbal medicine that improves blood circulation, cools the blood, detoxifies, relieves depression, improves immunity, and prevents cardiovascular disease [2]. Hangzhou, specifically Sandu Town in Jiande City (29°54′ N, 119°57′ E), is considered the birthplace of saffron and is the main saffron production area in China. Sandu Town is known as the “hometown of saffron in China” and accounts for 80% of the national saffron yield [3].

Saffron corm rot (SCR) has become the most common and serious disease in saffron production in recent years. SCR directly reduces the quality and yield of stigma and affects the production of corms [1]. The typical symptoms of SCR in the field include leaf yellowing and wilting on the ground, as well as atrophied rotting corms underground. Although a variety of fungi, including Fusarium [4], Aspergillus [5], and Penicillium [6], have been isolated from saffron corms with SCR, research has confirmed that Fusarium oxysporum is the pathogenic fungus causing SCR [4].

F. oxysporum is a widely distributed soil-borne pathogenic fungus that causes root and corm rot in hundreds of cultivated plants, resulting in significant economic losses [7]. Compared with other Fusarium species, the pathogenicity of F. oxysporum varies in different types of crops and different varieties of the same crop, exhibiting a high degree of host specificity [8]. For example, the pathogen forms of F. oxysporum have distinct host specialization on watermelon and melon, both of which are members of the cucurbit family [9]. F. oxysporum f. sp. freesia infects freesia, which belongs to Iridaceae, the iris family [10], as does saffron. However, the causal agent of SCR, F. oxysporum, has an unknown host specialization in saffron.

The identification of pathogenic fungi host specialization has traditionally relied on pure culture methods. However, traditional methods are sometimes unable to accurately identify pathogenic fungi due to the influence of factors such as the culture medium and culture conditions [11]. The secreted in xylem (SIX) genes have been utilized for the identification of F. oxysporum host specializations. The first SIX protein reported was a 12-KDa cysteine-rich protein named SIX 1, identified by Rep et al. in the xylem of tomato plants [12]. F. oxysporum can secrete a number of cysteine-rich SIX proteins encoded by SIX genes to initiate pathogenicity when it infests the xylem of the host [13]. Although 14 SIX genes have been described in the F. oxysporum f. sp. lycopersici (Fol) lineages to date, not all 14 SIX genes are carried by other host specializations [14,15]. In fact, as demonstrated by van Dam et al., the host specializations of F. oxysporum each harbor a unique combination of effectors that can be employed to distinguish different host-specialized lineages [16].

This study aimed to experimentally determine the existence of a host specialization of F. oxysporum in saffron. Moreover, this work developed a rapid identification method for the potential host specialization, providing a theoretical basis for the subsequent identification of host specializations in saffron.

2. Results

2.1. Pathogenicity Specialization

A pathogenicity test was conducted of the F. oxysporum saffron strain XHH35 (strain number) on melon seedlings, cucumber seedlings, tomato seedlings, saffron corms, and freesia corms (Figure 1). The test showed that melon, cucumber, and tomato seedlings did not develop disease in the root system after root dipping treatment, the leaf growth was healthy, and no significant differences were noted compared with the control group, indicating that F. oxysporum was not pathogenic to melon, cucumber, or tomato. In contrast, the inoculation sites of both saffron and freesia corms inoculated with the spore solution exhibited lesions; F. oxysporum was strongly pathogenic to saffron corms, in which it caused SCR and weakly pathogenic to freesia corms.

The pathogenicity test of the other host-specialized strains of F. oxysporum (F. oxysporum f. sp. lycopersici, F. oxysporum f. sp. niveum, and F. oxysporum f. sp. melonis) on saffron corms (Figure 2). The results showed that none of the saffron corms inoculated with the spore solutions of the other host-specialized strains showed lesions at the inoculation site, and there was no significant difference from the non-inoculated group. This indicates that the other host-specialized strains of F. oxysporum are not pathogenic to saffron corms.

In conclusion, F. oxysporum saffron strains are pathogenicity specialized to Iridaceae spp.

2.2. Genome Sequencing

The de novo genome assembler suites NextDenovo v2.4.0 and NextPolish v1.3.1 (both developed by NextOmics; https://github.com/Nextomics, accessed on 10 May 2024.) were employed to generate a genome assembly of high accuracy and continuity. First, a draft genome assembly was assembled using NextDenovo based on PacBio long reads; then, it was polished using NextPolish based on both PacBio long reads and Illumina short reads. Finally, a 56.89-Mb genome assembly (GC content 48%) was obtained that consisted of 34 contigs with a contig N50 of 4.24 Mb and a contig N90 of 2.23 Mb (

Table 1. Genome features of the Fusarium oxysporum saffron strains (XHH35).

Genome Assembly Info	Count
Sequencing technology	PacBio + Illumina
Scaffold number	34
N50 (bp)	4,241,186
N90 (bp)	2,232,100
GC content (%)	48
Genome size (bp)	56,897,855
Protein-coding genes	15,461
Transcript number	15,684
exon number	43,958

).

Using OrthoVenn3 (https://orthovenn3.bioinfotoolkits.net, accessed on 16 August 2024.), the genomes of XHH35, Fusarium oxysporum f. sp. lycopersici, Fusarium oxysporum f. sp. melonis and Fusarium oxysporum f. sp. cubense genomes for protein clustering analysis (based on the OrthoMCL algorithm and e-value of 1 × 10⁻² was used). A comparative study of the protein clustering analysis revealed there are 12,330 highly conserved orthologous clusters in XHH35, F. oxysporum f. sp. lycopersici, F. oxysporum f. sp. melonis and F. oxysporum f. sp. cubense. (Figure 3a). Notably, XHH35 contained 90 specific protein clusters (including 245 genes) that were absent in the other three host-specialized strains. After GO clustering analysis of these 90 specific protein clusters, we found that seven genes each were clustered into the transmembrane transport and transcription (DNA-templated); six genes were clustered into the oxidoreductase activity (acting on paired donors, with incorporation or reduction of molecular oxygen); five genes were clustered into the polyketide biosynthetic process; three genes were clustered into the regulation of transcription (DNA-templated); two genes each were clustered into the sporulation resulting in formation of a cellular spore, carbohydrate transport, positive regulation of transcription from RNA polymerase II promoter and carbohydrate metabolic process. These included genes involved in critical biological processes and affect critical molecular functions (

Table 2. GO Enrichment result (p-value of 1 × 10⁻²).

GO Term Category	Name	Count	p-Value
Biological process	Transmembrane transport	7	1.01 × 10−63
Biological process	Transcription (DNA-templated)	7	1.79 × 10−50
Biological process	Sporulation resulting in formation of a cellular spore	2	2.41 × 10−17
Molecular function	Oxidoreductase activity (acting on paired donors, with incorporation or reduction of molecular oxygen)	6	4.29 × 10−7
Biological process	Regulation of transcription (DNA-templated)	3	1.45 × 10−5
Biological process	Carbohydrate transport	2	1.94 × 10−5
Biological process	Positive regulation of transcription from RNA polymerase II promoter	2	1.02 × 10−4
Biological process	Polyketide biosynthetic process	5	1.82 × 10−4
Biological process	Carbohydrate metabolic process	2	2.76 × 10−4

, Figure 3b).

2.3. Amplification of the SIX Gene

Based on BLAST homology searching, the F. oxysporum saffron strain (XHH35) genome was predicted to contain seven SIX genes (the SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 genes) that are highly homologous to Fol (Supplementary Table S4).

Polymerase chain reaction (PCR) amplification to further confirm the presence of these genes in XHH35. The agarose gel electrophoresis gel plot results for the amplification of the F. oxysporum saffron strains of genes SIX 1 through SIX 14 genes are shown in Figure 4. It was found that the PCR products of the correct size were amplified from the DNA template of SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 genes. However, the PCR products of the correct size were not amplified from the DNA template of SIX 1, SIX 2, SIX 3, SIX 5, SIX 8, SIX 9, and SIX 13 genes.

2.4. SIX Homologous Gene Evolutionary Tree Analysis

The SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 gene sequences of the F. oxysporum saffron strain (XHH35) that amplified a single target band in PCR were collected separately, and the SIX gene sequences of F. oxysporum strains from different hosts were also categorized and downloaded according to SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 from the National Center for Biotechnology Information (NCBI) (Supplementary Table S1). A total of seven gene evolutionary tree images were obtained using the neighbor-joining, maximum likelihood, and maximum parsimony methods for gene evolutionary tree construction after sequence comparison using MEGA 11. The results are shown in Figure 5.

In the gene evolutionary trees of SIX 4, SIX 6, SIX 7, and SIX 11 genes, XHH35 was on a single branch, suggesting that the SIX 4, SIX 6, SIX 7, and SIX 11 genes of XHH35 are more distantly related than those of other host-specialization strains (Figure 5a–c,e).

In the gene evolutionary trees of SIX 10, SIX 12, and SIX 14 genes, XHH35 was clustered in the same branch as the F. oxysporum f. sp. freesia, suggesting that the SIX 10, SIX 12, and SIX 14 genes of XHH35 with F. oxysporum f. sp. freesia are closely related (Figure 5d,f,g).

2.5. Establishment of Rapid Detection Methods

The SIX 10 gene of F. oxysporum saffron strain was selected for the design of specific primers due to its high specificity compared to other host-specialized strains. Sequence comparison was performed of the amplified SIX 10 gene of F. oxysporum saffron strains with the SIX 10 genes of other host-specialized strains (Figure 6).

Based on the results of the comparison, eight pairs of specific primers were designed using Primer Premier v5.0 (

Table 3. Specific candidate primers for Fusarium oxysporum of saffron based on SIX 10. In the software Primer Premier v5.0, which is used to design primers, the rating indicates the degree of fit of the primers. The primers that were determined to be the most suitable based on the software’s design criteria are indicated in the table by the designation “Primers 1–8”.

Number	Primers (5’-3’)		Rating (%)	Product Size (bp)	Annealing Temperature (°C)
1	Primer 1-F	ATTGCGGACTCTGGTGTA	100	275	51.5
	Primer 1-R	TGAAAGCGTTGTAATGTTG
2	Primer 2-F	TGCGGACTCTGGTGTATC	100	277	51.8
	Primer 2-R	CCTCTGAAAGCGTTGTAAT
3	Primer 3-F	TGCGGACTCTGGTGTATC	98	273	51.6
	Primer 3-R	TGAAAGCGTTGTAATGTTG
4	Primer 4-F	TGCGGACTCTGGTGTATC	96	275	51.2
	Primer 4-R	TCTGAAAGCGTTGTAATGT
5	Primer 5-F	ATCCACTGGCACCAAAGA	96	334	52.5
	Primer 5-R	TCAGGGTAGACACCAAATCG
6	Primer 6-F	CCACTGGCACCAAAGACT	96	332	52.4
	Primer 6-R	TCAGGGTAGACACCAAATCG
7	Primer 7-F	GACCCGAACTTCCCTTAG	96	258	51.3
	Primer 7-R	TACTGGTTGTAGCCGTGA
8	Primer 8-F	ACGACCCGAACTTCCCTT	86	250	50.4
	Primer 8-R	AGCCGTGAGTAAATGTGA

). It was found that primer 4 could amplify all of the F. oxysporum saffron strains bands of about 275 bp in length but could not amplify the F. oxysporum f. sp. niveum, F. oxysporum f. sp. fragariae, F. oxysporum f. sp. melonis, and F. oxysporum f. sp. lycopersici; primers 1 and 3 could amplify some of the F. oxysporum saffron strains but could not amplify the F. oxysporum f. sp. niveum, F. oxysporum f. sp. fragariae, F. oxysporum f. sp. melonis, and F. oxysporum f. sp. lycopersici; and primers 2, 5, 6, 7, and 8 could amplify the F. oxysporum f. sp. niveum, F. oxysporum f. sp. fragariae, F. oxysporum f. sp. melonis, and F. oxysporum f. sp. lycopersici. This indicates that primer 4 can specifically screen out eight F. oxysporum saffron strains (Figure 7, Supplementary Figure S1).

This study further validated the specificity of primer 4 against other strains (Figure 8), which revealed that this primer could only specifically amplify F. oxysporum saffron strains and had no target bands for other strains. In conclusion, this primer can be employed as a specific primer for the rapid identification of F. oxysporum saffron strains.

3. Discussion

Fusarium oxysporum is a non-negligible pathogen that causes plant diseases and can infect a wide range of economically important plants around the world, including saffron [17,18,19], resulting in huge economic losses. A phenomenon has been observed in the pathogenic strains of F. oxysporum, namely “host specialization”. The pathogenicity of F. oxysporum strains varied among different crop species and among different varieties of the same crop [7,14,20]. The results of the pathogenicity experiments in this study also confirm this conclusion. The F. oxysporum strain isolated from saffron corms was strongly pathogenic to saffron corms and weakly pathogenic to the corms of freesia, which belongs to the Iridaceae family along with saffron but was not pathogenic to watermelon, melon, and tomato. Other formae speciales of F. oxysporum (F. oxysporum f. sp. lycopersici, F. oxysporum f. sp. niveum, and F. oxysporum f. sp. melonis) are not pathogenic to saffron corms. This suggests that F. oxysporum saffron strains have obvious pathogenicity specialization for Iridaceae spp.

Subsequently, the genome of F. oxysporum saffron strain (XHH35) was sequenced and a comparative genomics study was conducted on XHH35 and three additional host-specialized strains of F. oxysporum (F. oxysporum f. sp. lycopersici, F. oxysporum f. sp. cubense, and F. oxysporum f. sp. melonis) using OrthoVenn3. The results showed that there are 12,330 highly conserved orthologous clusters in XHH35 and three additional host-specialized strains of F. oxysporum. In particular, there were 90 orthologous groups identified that were specific in XHH35, which contained 245 genes. These genes involved the function of oxidoreductase activity (acting on paired donors, with incorporation or reduction of molecular oxygen) and involved the transmembrane transport, transcription (DNA-templated), sporulation resulting in the formation of a cellular spore, and so on biological process.

Because the SIX homologous genes in different host-specialized F. oxysporum strains are not identical, studies have further confirmed that there is a link between F. oxysporum host specificity and SIX genes [21,22]. Therefore, SIX genes were considered reliable marker genes to distinguish the host specialization of F. oxysporum. Thus, combining the results of the pathogenicity experiments, we predict that the F. oxysporum saffron strain has a unique combination of SIX genes. We searched for homology based on BLAST, and the genome of the F. oxysporum saffron strain (XHH35) was predicted to contain seven SIX genes (the SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 genes) highly homologous to F. oxysporum f. sp. lycopersici. This prediction was verified by PCR amplification: the correctly sized PCR products were amplified from DNA templates for the SIX 4, SIX 6, SIX 7, SIX 10, SIX 11, SIX 12, and SIX 14 genes. By constructing the corresponding single-gene evolutionary tree, it was found that in the single-gene evolutionary trees of SIX 4, SIX 6, SIX 7, and SIX 11, which did not contain the F. oxysporum f. sp. freesia, all of the F. oxysporum saffron strain (XHH35) genes were on a single branch; in the gene evolutionary trees containing SIX 10, SIX 12, and SIX 14 of F. oxysporum f. sp. freesia, XHH35 was clustered in the same branch as the F. oxysporum f. sp. freesia. Since the host plant of XHH35-saffron and the host plant of F. oxysporum f. sp. freesia-freesia are close to each other in terms of species evolutionary relationship, and both belong to the same family of Iridaceae spp., it suggests that the host specialization of F. oxysporum may be related to the evolutionary relationship of the host plant, and at the same time, such an association would be reflected in the SIX gene. However, the SIX genes possessed by the F. oxysporum saffron strain (XHH35) and F. oxysporum f. sp. freesia were different; therefore, the F. oxysporum saffron strain in this study was named “F. oxysporum f. sp. Crocus” in order to reflect its distinct characteristics.

Due to the complexity of F. oxysporum complex species, the traditional identification of F. oxysporum host specialization is generally complicated by the host crop pathogenicity test. In recent years, with the rapid progress of science and technology, many techniques for rapid detection of plant diseases have emerged. It has been reported that a recombinant recombinase polymerase amplification–lateral flow dipstick (RPA-LFD) has been established for the rapid detection of strawberry wilt [23], which is highly specific for F. oxysporum, the causal fungus of strawberry wilt, and can rapidly detect F. oxysporum in strawberry wilt samples. In addition, Wang et al. [24] have developed quantitative loop-mediated isothermal amplification (q-LAMP) rapid tests for hickory canker. These tests are of significant value in the detection and prevention of these and other plant diseases. In this study, the specificity of the F. oxysporum SIX gene was employed to design eight pairs of primers for PCR amplification, and a pair of primers specific for F. oxysporum f. sp. crocus was ultimately selected. Following verification of specificity against strains of other species, it was determined that the primers were specific for F. oxysporum f. sp. crocus strains. This study established a rapid detection and identification method for F. oxysporum f. sp. crocus, which will be useful in future analyses.

4. Materials and Methods

4.1. Isolation of Test Strains

This study was performed using the F. oxysporum saffron strains isolated and characterized by Ren et al. [4]. In addition, host-specialized strains for tomato, watermelon, and melon were obtained through laboratory isolation and conservation. The strain information is shown in Supplementary Table S1.

4.2. Pathogenicity Specialization Test

The tomato, melon, and cucumber plants used in the pathogenicity experiment were obtained from seed culture. The seeds of tomato, melon, and cucumber were germinated by moisturizing and germination, and the seedlings were raised on sterilized substrate. After the seedlings had grown several true leaves, the roots were washed with water. Three to five fibrous roots were pressed with sterilized sandpaper, rubbed gently to cause wounds, and then placed into the prepared F. oxysporum spore suspension (concentration of 1.0 × 10⁶ units/mL, and the spore suspensions were obtained using the static spore production method [25]) for root immersion treatment for 20 min. The roots were then transferred to the substrate. Immersion in sterile water for 20 min was utilized as a blank control. Each treatment was repeated three times [26]. For saffron and freesia (belonging to the same Iridaceae spp. as saffron), the treatment involved pricking the stems of healthy plants with sterilized insect needles. Prior to inoculation, healthy saffron corms and freesia corms were washed with water and disinfected by wiping the surface with 75% alcohol. Each corm was inoculated with 10 μL of spore suspension (concentration of 1.0 × 10⁶ units/mL). Sterile water was used as a negative control, and three bulbs were inoculated with each strain. Finally, all the above-treated plants were placed in an incubator at 80% humidity and treated at 25 °C under a 12 h light–dark cycle. The plant growth and root development were observed after 7 and 14 days, respectively.

4.3. Genome Sequencing and Prediction

After the F. oxysporum saffron strain (XHH35) was cultivated on potato dextrose agar (PDA) medium for 10 days, its genomic DNA and messenger RNA were extracted from the mycelium. Genome and transcriptome sequencing were performed using the PacBio and Illumina HiSeq4000 sequencing platforms, respectively, at Biomarker Technologies Co., Ltd. (Beijing, China). Finally, PacBio long reads were obtained for genome assembly, and Illumina short reads were obtained for genome assembly polishing and gene annotation [27].

The query sequence tblastn was used to compare the spliced genome with an E-value of 1 × 10⁻⁵ and alignment coverage of 35%, after which the macro genome was predicted using getorf X to obtain open reading frames (ORFs) from the spliced genome. The ORFs were compared with the results of the alignment comparison to obtain alignment-complete ORFs.

OrthoVenn3 (https://orthovenn3.bioinfotoolkits.net, accessed on 16 August 2024) was employed to conduct a comparative genomics study on XHH35. Genomic data for three additional host-specialized Fusarium oxysporum strains: Fusarium oxysporum f. sp. lycopersici (GCA_003315725.1), Fusarium oxysporum f. sp. cubense (GCA_027920445.1) and Fusarium oxysporum f. sp. melonis (GCA_025216565.1) were obtained from the NCBI. Analysis was conducted based on the OrthoMCL algorithm, and evalue of 1 × 10⁻² was used [28].

The whole genome sequence data for XHH35 have been deposited in the NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 14 August 2024) under accession number PRJNA1146213.

4.4. Amplification Validation and Phylogenetic Analysis of the SIX Gene

The pathogenic fungi were activated on PDA medium, and DNA was extracted from fungal hyphae using the Fungal Genomic DNA Rapid Extraction Kit (Sangon Biotech, Shanghai, China).

F. oxysporum 14 SIX protein genes. Saffron and freesia are both members of Iridaceae, the iris family. To determine whether the F. oxysporum strain isolated from saffron corms was F. oxysporum f. sp. freesia, the SIX genes were used as target genes for phylogenetic analysis. The primers selected for PCR amplification are displayed in Supplementary Table S2 [20,29]. The PCR reaction system consisted of a total volume of 50 μL, containing 2 μL of each upstream and downstream primer, 1 μL of template, 25 μL of 2×mix TaqDNA Mix, and 20 μL of ddH₂O. The PCR amplification procedure was as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s; annealing based on the temperatures shown in Table 1, with varied annealing times according to the clip length (1000 bp/1 min); and final extension for 10 min at 72 °C. The PCR products were identified on 1.0% agarose gel at 254 nm (ultraviolet) and further sequenced by Shanghai Sangon Biological (Shanghai, China).

The sequencing results were submitted to the NCBI database for comparison and identification to clarify the selection of standard strains. The accession numbers of the standard strains were obtained through a literature search, and their sequence information was downloaded from GenBank [29], as shown in Supplementary Table S1. The SIX gene sequences were collected from F. oxysporum saffron strains that amplified a single target band in PCR, and the SIX gene sequences of other strains from different hosts were classified and downloaded. After sequence alignment using MEGA 11, gene evolutionary trees were constructed using the neighbor-joining, maximum likelihood, and maximum resolution methods to map the evolutionary trees of the corresponding SIX genes.

4.5. Rapid Detection Based on the SIX Gene

Specific primers were designed and screened for the SIX gene, which is more specific to F. oxysporum saffron strains. PCR amplification of the SIX gene was performed using DNA from eight F. oxysporum saffron strains and four additional host-specialized strains, and the PCR-amplified products were sent to Shanghai Sangon Biological.

The PCR reaction system had a total volume of 50 μL, consisting of 25 μL of 2×Taq PCR Master Mix, 1 μL each of upstream and downstream primers, 2 μL of template DNA, and 21 μL of ddH₂O.

The PCR reaction conditions for the SIX gene were as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C, extension at 72 °C (with extension times varying according to the lengths of genes with different specificity) for 35 cycles, and final extension at 72 °C for 10 min. Then, 15 μL of PCR amplification products and standard DNA marker were added to 1% agarose gel spotting wells, subjected to electrophoresis at 130 V for 25 min, and then placed in a gel imager to check the electrophoretic bands. The results of specific primer screening were determined according to the agarose gel electrophoresis bands. Finally, strains of different genera were selected to validate the specific primers.