Next Article in Journal
Evaluating Guayule (Parthenium argentatum A. Gray) Germplasm Grown in Spain: Rubber and Resin along Three Production Cycles
Next Article in Special Issue
Towards Pathogen-Free Coconut Germplasm Exchange
Previous Article in Journal
Response of Phyllosphere and Rhizosphere Microbial Communities to Salt Stress of Tamarix chinensis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 8
10.3390/plants13081089
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Collection for the Safe Storage of Grapevine Hybrids and Identification of the Presence of Plasmopara viticola Resistance Genes

by
Natalya V. Romadanova
1,*,
Moldir M. Aralbayeva
1,
Alina S. Zemtsova
1,*,
Alyona M. Alexandrova
2,
Saule Zh. Kazybayeva
3,
Natalya V. Mikhailenko
1,
Svetlana V. Kushnarenko
1 and
Jean Carlos Bettoni
4,*
1
Institute of Plant Biology and Biotechnology, 45 Timiryazev St., Almaty 050040, Kazakhstan
2
M.A. Aitkhozhin Institute of Molecular Biology and Biochemistry, Almaty 050012, Kazakhstan
3
Kazakh Scientific Research Institute of Fruit Growing and Viticulture, Almaty 050060, Kazakhstan
4
Independent Researcher, 35 Brasil Correia Street, Videira 89560510, Brazil
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(8), 1089; https://doi.org/10.3390/plants13081089
Submission received: 22 March 2024 / Revised: 3 April 2024 / Accepted: 11 April 2024 / Published: 13 April 2024
(This article belongs to the Special Issue In Vitro Systems and Virus Elimination in Horticultural Plants and Rare Endangered Species)
Browse Figure
Versions Notes

Abstract

:
This paper focuses on the creation of an in vitro collection of grapevine hybrids from the breeding program of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture and investigates the presence of Plasmopara viticola resistance mediated by Rpv3 and Rpv12 loci. We looked at the optimization of in vitro establishment using either shoots taken directly from field-grown plants or from budwood cuttings forced indoors. We further screened for the presence of endophyte contamination in the initiated explants and optimized the multiplication stage. Finally, the presence of the resistance loci against P. viticola was studied. The shoots initiated from the field-sourced explants were the more effective method of providing plant sources for in vitro initiation once all plant accessions met the goal of in vitro establishment. The concentration of phytohormones and the acidity of the culture medium have a great effect on the multiplication rate and the quality of in vitro stock cultures. Out of 17 grapevine accessions, 16 showed the presence of single or combined resistance loci against P. viticola. The grapevine accessions identified as carrying Rpv3 and Rpv12 alleles represent important genetic resources for disease resistance breeding programs. These accessions may further contribute to the creation of new elite cultivars of economic interest.

1. Introduction

Grapevines (Vitis spp.) are among the most economically important temperate fruit crops cultivated and consumed throughout the world. In 2022, the planted area of grapevines, globally, reached 7.3 M hectares, producing over 70 Mt of fruit, of which 47.4% were wine grapes, 45.4% were table grapes, and 8% were grapes for drying [1]. The genus Vitis has a rich genetic diversity of about 80 species, with many of the commercially important cultivars assigned to Vitis vinifera [2,3]. Other Vitis species, as well as Muscadinia rotundifolia, provide valuable genes or traits for breeding programs focused on developing new cultivars and rootstocks that are resistant/tolerant to abiotic and biotic stresses [4,5]. Conserving the genetic diversity of grape genetic resources is essential for advancing breeding programs to ensure continued access to potentially valuable traits [6,7,8].
In Kazakhstan, industrial viticulture began in the 1930s, and currently, grapes are grown on about 16,000 ha and have production levels of 82.7 thousand t annually [9,10]. Kazakh viticulture is characterized by a concentrated production zone in the southern regions of the republic; 98% of its grapes are grown in the Almaty, Zhambyl, and Kyzylorda regions [10,11,12,13,14]. In 2022, imports of grapes (67 thousand t) to Kazakhstan were 15 times higher than exports and amounted to USD 50 M per year [15]. In order to reduce the dependence on imported grapes, it is necessary to ensure the progressive development of the grape and wine industry by increasing the area and productivity of grape plantations within Kazakhstan. The strategies employed for these aims are the production and supply of healthy planting material for the grape industry as well as the breeding and introduction of genotypes, including our own varieties, that are resistant/tolerant to pests and diseases and are soil climate analogues [6,13,14,16,17].
A fairly wide range of grape varieties allows for the breeding and introduction of modern highly productive varieties. Kazakhstan has a very promising level of genetic diversity in wine grapes (V. vinifera) and their wild relatives, including both economically and culturally valuable species [13,17,18]. This genetic biodiversity of natural populations provides a pool of genes that can confer traits for disease resistance—in particular, the genetic basis for cultivars with improved cold resistance [13,17,18]. The breeding of novel grape genotypes using DNA markers can be an effective and practical approach to accelerate the breeding process, allowing for the combination of a number of genes that confer traits of interest, such as tolerance to biotic and abiotic stresses [19,20]. Hybridization is a common method used to create new, improved grape varieties [21]. The process begins with the careful selection of both parents based on the desired traits to be incorporated into the next generation of vines [20]. The accurate characterization of plant accesses is a critical factor in the identification of suitable parents for breeding crosses [22,23,24]. Molecular methods enhance the accuracy and speed of breeding processes and are important tools for identifying and mapping resistance genes in grape breeding programs [17,25], but they have not been widely used for grapes in Kazakhstan.
Plasmopara viticola [(Berk. and Curt.) Berl. and de Toni], the causal agent of downy mildew, is one of the most damaging pathogens in viticulture worldwide [26]. Grape production systems rely heavily on fungicide use due to the high susceptibility of V. vinifera cultivars to downy mildew. Under favorable humidity and temperature conditions, downy mildew causes significant production losses by infecting young, tender green leaf, twig, and fruit tissues [26,27,28,29]. Considerable efforts have been made internationally to identify genetic sources of resistance to downy mildew in order to limit the damage caused by this pathogen. Grapevine breeding therefore aims to introduce genetic loci that mediate resistance to P. viticola from Vitis wild species into the next generation of grapevines [28,30,31,32,33]. To date, 27 loci of resistance to P. viticola (Rpv1-Rpv27) have been identified. The Rpv3 and Rpv12 loci, derived from North American, Eurasian, and Asian grapevines (Vitis spp.), respectively, are the most widely used Rpvs for resistance to P. viticola and are currently of relevance in viticultural breeding programs [34,35,36,37,38]. Resistance to downy mildew is thought to involve more than one gene [36,37,38,39]. Therefore, to breed mildew-resistant grape varieties, it is highly desirable to combine as many resistance genes as possible, known as pyramiding, to provide not only effective but also durable resistance. DNA-marker-assisted selection is a powerful tool for plant breeders [36,39,40]. Combining multiple resistance genes into one genotype makes it possible to create highly resistant progeny, and the use of DNA markers accelerates this process [40,41,42,43,44,45].
This paper focuses on the creation of an in vitro collection for the safe storage of grapevine hybrids from the breeding program of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture (KSRIFGV) and investigates the presence of P. viticola resistance mediated by Rpv3 and Rpv12 in F1 progenies derived from crosses between North American, European, and Asian grapevines. Once micropropagation systems are established, progeny showing resistance to P. viticola diseases will be in vitro propagated and subjected to agronomic evaluation in the field. In addition, the development of successful micropropagation systems is critical for further efforts to cryopreserve these plant accessions. These initiatives will greatly support the progressive development of viticulture in Kazakhstan. Another benefit of these selected progenies obtained through P. viticola resistance is a significant reduction in pesticide applications. This will reduce production costs, increase profits, and protect the environment and farmers.

2. Results and Discussion

2.1. In Vitro Establishment of Grapevine Accessions

The in vitro propagation of grapevines can be divided into four stages: establishment, shoot multiplication, the rooting of micro-shoots, and the acclimatization (transfer from in vitro to ex vitro conditions) of in vitro plantlets [46,47]. The initial stage of micropropagation procedures is the most critical step in plant tissue culture [48,49]. A successful protocol is influenced by several parameters, such as the selection of the right explant, proper sterilization, and the inhibition of any hypersensitivity of the explants [46,47,48,49,50,51,52]. In this study, 18 grapevine accessions were established in vitro using either shoots taken directly from field-grown plants or from budwood cuttings forced indoors. We found that the optimal sterilization time in 0.1% mercuric chloride (HgCl2) for cultures initiated from shoots harvested directly from the field was 5 to 7 min, resulting in moderate viable culture efficiencies averaging 17% to 21% across genotypes, respectively (Table 1). While longer exposure to mercuric chloride reduced the number of infected shoots, it increased necrosis and significantly reduced the number of viable shoots, leaving 5 out of 18 accessions without viable shoots after 10 min of treatment (Table 1). Overall, the V-7/17, KV-2/9, and VII-6/72 accessions responded less positively to the HgCl2 treatment than did the other accessions. For the initiations using shoots harvested directly from the field, the highest percentage of viable shoots, 40%, was obtained in accessions DV-10/11 and V-7/9 after 7 min of HgCl2 exposure (Table 1).
For the shoots that were initiated from sprouted budwood cuttings in the laboratory, the average viability levels were 25%, 12%, and 7% for 5, 7, and 10 min of HgCl2 exposure, respectively (Table 2). Similarly to the field-initiated shoots, there were significant differences among the accessions regarding the level of viable shoots following HgCl2 exposure. The shorter sterilization time used was sufficient to produce a moderate level of viable shoots, with the highest percentages of viable shoots being obtained after 5 min of exposure to HgCl2, with the exception of accession V-7/9, which showed 100% contamination. The accessions DV-10/11 (50% viable shoots) and III-02/22 (50% viable shoots) had the highest percentage of viable shoots (Table 2). The procedure of sprouting shoots from cuttings in the laboratory was not effective for the initiation of the accessions KV-2/9, KV-1/10, and VII-6/72; the shoots failed to regenerate regardless of the extent of HgCl2 treatment. While contamination was drastically reduced with prolonged exposure to HgCl2 (65% at 5 min and 6% at 10 min), most shoots were necrotic (10% at 5 min and 87% at 10 min) or showed no evidence of continued growth and failed to regenerate (Table 2).
In general, the shoots initiated from the field-sourced explants, although having higher levels of contamination regardless of the HgCl2 exposure time used, were more effective in providing plant sources for in vitro initiation once all plant accessions had met the goal of in vitro establishment (Table 1). While the HgCl2 treatments appeared to be beneficial in reducing shoot contamination, we found that the shoots sprouted in the laboratory were more tender than those sourced from the field, making the plant tissue more sensitive to the surface sterilization process.

2.2. Screening for Endophytes Using Bacteriological Growth Media

The contamination of plant tissue cultures by different microorganisms such as bacteria and fungi is one of the major concerns in micropropagation protocols [53,54,55]. Sometimes, even apparently healthy-looking cultures may harbor endogenous contaminants (endophytes) that may not always be apparent in the early stages of tissue cultures [56,57,58]. Some plants are hosts for a wide range of endophytes, which may only arise in tissue cultures after several rounds of subcultures and/or after the cultures have undergone some stress [56,59,60]. Therefore, given the high levels of contaminants we experienced during in vitro initiation, and to minimize the risk of endophyte contamination, we further screened for the presence of these contaminants in apparently clean tissue culture-initiated explants using a specialized medium that encourages the proliferation of endogenous contaminants. On average, 45% of all the apparently clean cultures were found to harbor endophytic pathogens that had not previously been detected in the standard plant tissue culture media (Table 3, Supplementary Figure S1). The highest levels of contamination were observed in accessions VII-6/72 (73%), III-7/15 (67%), XII-17/2 (64%), and V-7/9 (60%), while the lowest levels were observed in accessions KV-2/35 (10%), DV-10/11 (15%), and IV-14/9 (17%) (Table 3). Among the accessions evaluated, the highest percentages of clean shoots were observed in KV-2/35 (90%) and DV-10/11 (85%) (Table 3). All shoots corresponding to the infected tissue were discarded as potentially contaminated. Clean cultures of accessions KV-2/35 and DV-10/11 were used for further in vitro propagation experiments.

2.3. In Vitro Multiplication

Plant tissue culture media have a profound effect on both the induction of adventitious shoot formation and the promotion of axillary shoot proliferation [53,62]. MS medium [63] is often used with success to grow grapevines in in vitro culture [64,65,66], and its exogenous supplementation with phytohormones serves as a tool to regulate various processes in plant tissue cultures. Auxins and cytokinins are the most commonly used phytohormones and are often used in combination [53,67,68]. It has been reported that the addition of cytokinin in combination with auxin to the multiplication medium enhanced the proliferation efficiency of grapevine shoots [65]. Auxins are involved in all plant physiological processes, including root and callus initiation and growth [67,68,69], while cytokinins affect cell division and also stimulate axillary and adventitious shoot formation and growth [62,67,68]. Gibberellic acid is used to interrupt plant dormancy, as well as to stimulate cell division and elongate shoots [70]. The combination of cytokinin and gibberellic acid has also been shown to stimulate shoot proliferation in grapevine cultures [71]. Herein, we focused on finding an ideal phytohormone balance in an MS-based medium for grapevine in vitro propagation. Clean cultures of the accessions KV-2/35 and DV-10/11 were used for our in vitro propagation experiments using ten different MS-based media supplemented with different combinations of phytohormones. Our input parameters included different concentrations of 6-benzylaminopurine (BAP), indolylbutyric acid (IBA), gibberellic acid (GA), and thidiazuron (TDZ) at different pH levels. We also included Plant Preservative MixtureTM (PPM) in a medium to control for any endophyte escape and to check for any negative impact on the growth of the in vitro cultures.
During the multiplication phase, tissue culture plants are multiplied to produce a sufficient number of progeny plants. Shoot multiplication is achieved by promoting axillary shoot growth or the induction of adventitious shoots. The effectiveness of a propagation protocol depends largely on the rate of shoot multiplication [52]. The shoot multiplication rate (MR) reflects the number of new progeny plants produced from a single explant [56,72]. We found that the concentration of phytohormones and the acidity of the culture medium have a great effect on the MR and the quality of in vitro stock cultures (Table 4). MS basal medium supplemented with 1 mg L−1 BAP, 0.1 mg L−1 IBA, and 0.1 mg L−1 GA at a pH of 5.7 (medium no. 7) resulted in the highest MR for both the DV-10/11 and KV-2/35 accessions, producing 4.4 and 4.1 shoots per initial explant, respectively (Table 4). The cultures grown on medium no. 7 exhibited leaves with an intense green color, no vitrified or necrotic shoots, and no abnormal plant growth (Supplementary Figure S2).
For both accessions, the decrease in the number of shoots produced by each initial explant occurred when the BAP concentration used was 0.5 mg L−1 in the presence of 0.2% PPMTM (medium no. 6). There was no evidence of contamination during the propagation phase, which is an indication that the pre-screening for the presence of potential contaminants was effective. Therefore, these results suggest that it is not necessary to supplement the culture medium with PPMTM during the multiplication phase. Although the use of PPMTM can be effective in controlling endophyte contamination [56,73,74], it also has been shown to have a negative impact on in vitro plant growth, and the tolerance levels and response to PPMTM vary greatly with species [75,76,77]. In order to evaluate its potential for controlling microbial contaminants, future research may include PPMTM only during the in vitro establishment of grapevine cultures.
The hydrogen ion (pH) concentration of the medium, in addition to the type and concentration of phytohormones, is another determinant of successful plant micropropagation [62]. The pH of the culture medium affects the availability and uptake of nutrients and therefore has a direct effect on plant development and growth [78,79,80,81,82,83]. To access the effect of medium pH on grapevine shoot proliferation, we compared the same medium formulation within two pH ranges, i.e., medium no. 2 at a pH of 5.3 versus medium no. 7 at a pH of 5.7, which are commonly used in grapevine micropropagation [84,85,86,87]. The pH range used had no significant effect on the MR increase for either the DV-10/11 or KV-2/35 accessions. Although not significant, a slight increase in MR, 4.4 for DV-10/11 and 4.1 for KV-2/35, was observed when the pH of the medium was 5.7 compared to 3.9 for both the DV-10/11 and KV-2/35 accessions grown on the medium at a pH of 5.3 (Table 4).
For the establishment of an in vitro collection at the Kazakh Scientific Research Institute of Fruit and Viticulture, cultures of the remaining grapevine crosses will be grown and propagated on medium no. 7. The development of optimized micropropagation systems, such as the one developed in this study, will further facilitate future efforts for the long-term conservation of grapevine plant genetic resources [6,88,89,90,91,92,93,94,95].

2.4. Presence of Plasmopara viticola Resistance Genes in Grape Accessions

Grapevines are highly susceptible to fungal infections, and P. viticola has long been a threat to grape production worldwide, especially in areas with relatively warm and humid climate conditions [26,96,97,98]. Considerable efforts have been made internationally to identify genetic resources for resistance to P. viticola [42,96,99,100,101,102,103,104]. The development of grapevines with such a level of resistance to this threat is a highly desirable and sustainable strategy to overcome this problem [26], and it would also contribute to reducing the massive use of pesticides in orchards. In order to introduce this trait into new cultivars, KSRIFGV plant breeders have made crosses between Vitis species known for their variable levels of resistance to P. viticola, with the aim of developing a new cultivar resistant to this pathogen and adapted to local growing conditions.
In grapevines, global programs to breed cultivars resistant to P. viticola have introduced resistance genes into many progenies since the mid-1800s [98]. Here, the presence of the resistance loci Rpv3 and Rpv12 against P. viticola was studied in the 17 grapevine accessions developed for the breeding program of the KSRIFGV and used in this study. Plant accessions with a single or combined allele linked to the resistance alleles Rpv3 and/or Rpv12 on one of the microsatellite markers for each locus were considered to have the resistance loci against P. viticola. Out of the 17 grapevine accessions, 16 showed the presence of one resistance locus (Rpv3 or Rpv12) or multiple loci in combination (Rpv3 + Rpv12) (Table 5, Supplementary Figure S3). None of the resistance alleles screened were found in accession KV-2/35 (Table 5, Supplementary Figure S3). This suggests that this accession either is susceptible to the disease or represents new sources of resistance against P. viticola.
According to the results of our PCR analysis using the microsatellite marker UDV-737, which is closely related to the Rpv3 resistance loci, accessions DV-10/11, KII-1/29, KVI-1/10, XII-9/3, III-7/15, III-02/22, V-7/9, XI-13/90, and IV-4/74 were identified, as well as small amounts in accession XII-17/2 (Table 5, Supplementary Figure S3). The use of the UDV-305 microsatellite marker was less effective in the detection of the presence of the Rpv3 resistance loci; its presence was only detected in accession III-02/22 (Table 5, Supplementary Figure S3). The resistance locus Rpv12, which was identified by the marker UDV-343, was observed in 13 accessions: KV-2/9, DV-10/11, IV-6/9, KII-1/29, KVI-1/10, XII-17/2, VII-6/72, VII-3/15, XI-14/9, III-02/22, V-7/9, XI-13/90, and KIY-1/64 (Table 5, Supplementary Figure S3).
Both resistance alleles Rpv3 and Rpv12 were carried by accessions DV-10/11, KII-1/29, KVI-1/10, XII-17/2, III-02/22, V-7/9, and XI-13/90 (Table 5, Supplementary Figure S3). It is now widely accepted that the breeding of plant accessions carrying multiple disease resistance genes is a more sustainable strategy for the broad-spectrum control of pathogen strains and can also increase resistance durability [35,39,40,41,42,105,106,107,108,109]. Previous studies have demonstrated the additive effects of P. viticola resistance by pyramiding the Rpv12 and Rpv3 loci. The sporulation of P. viticola isolates in leaf discs of V. vinifera cultivars was reduced by the introgression of Rpv12 + Rpv3 resistance loci [109]. Likewise, in V. amurensis, Rpv3 and Rpv12 conferred significantly enhanced resistance to pathogen infection in comparison to single resistance alleles [35]. The grapevine accessions identified in this study as carrying Rpv3 and Rpv12 alleles represent important genetic resources for future breeding purposes in Kazakhstan. These accessions may further contribute to the creation of new elite cultivars of economic interest. Work is currently underway to propagate these accessions to plant them in the KSRIFGV experimental area, followed by an agronomic evaluation and testing for their resistance to P. viticola under field conditions.

3. Materials and Methods

3.1. Plant Material

In the breeding program of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture (KSRIFGV), crosses were made between North American, European, and Asian grapevines with the aim of carrying different resistance genes to P. viticola. This work has been carried out by the Institute’s breeders over the years, and the varieties were selected for their economically and agronomically valuable traits and included some of the most important cultivars of current or historical importance in Kazakhstan. Plants were managed and grown in the experimental field according to the regular practical recommendations of the KSRIFGV [13,14,110]. Cuttings of 18 selected hybrids of grapevines grown for three years in the experimental area of KSRIFGV in Almaty (Kazakhstan) were used as a source of plant material for in vitro initiation. Table 6 provides detailed information on the grape varieties used in this study and their background.

3.2. In Vitro Establishment and Maintenance of Grapevine Accessions

Cultures were initiated with shoots taken directly from the field or by sprouting new shoots from cuttings taken from dormant mother plants and sprouted in an indoor laboratory environment (Figure 1), as described below.
Cuttings, approximately 40–50 cm long containing 6–8 buds were harvested in November from three-year-old grapevines. Then, they were washed with soapy water, rinsed, and treated with 50% commercial bleach (Belizna, 5–15% sodium hypochlorite, alkaline components ≤ 5%) for 5 min. Cuttings were immediately placed in a container with water where the base of the cutting was submerged in water and the upper part of the cutting was covered with a dense, light-proof fabric to prevent premature sprouting of the buds during stratification. The stratification was performed in a refrigerator at 4 °C for 2 months, before moving to laboratory conditions (24 ± 1 °C and a of photoperiod of 10 h 30 min) for bud sprouting. The water at the base of the cuttings was replaced daily.
Young shoots that were 1–2 cm in size containing a single bud were harvested from sprouted cuttings in the laboratory (in January) or directly from the field (harvested in April), washed with soapy water, rinsed, and treated with 0.1% mercuric chloride (HgCl2) solution for 5, 7, or 10 min. Afterwards, shoots were placed in test tubes of MS medium [63] containing 30 g L−1 sucrose, 0.5 mg L−1 6-benzylaminopurine (BAP), 0.1 mg L−1 indolyl butyric acid (IBA), 0.1 mg L−1 gibberellic acid (GA), 1.5 g L−1 Gelrite™ (PhytoTechnology Laboratories®, Lenexa, KS, USA), and 4 g L−1 agar (PhytoTechnology Laboratories®, Lenexa, KS, USA) at pH of 5.7. Cultures were grown at 24 ± 1 °C during a photoperiod of 16 h of daylight with light intensity of 40 mM·m–2·s–1 with two types of OPPLE tubular fluorescent lamps: YK 21RR 16/G 21W 6500K RGB and YK 21RL 16/G 21W 4000K RGB, supplied by ElectroComplex in Corporation (Almaty, Kazakhstan). Cultures were subcultured every 3–5 weeks in glass culture vessels (237 mL) (PhytoTechnology Laboratories®, Lenexa, KS, USA).
Necrotic, viable, and infected shoots were assessed visually within 28 days of in vitro initiation (Supplementary Figure S4). In addition, screening for endophytes was performed using bacteriological growth media, as plants may harbor endogenous pathogens that cannot be visually detected using standard plant tissue culture media.

3.3. Screening for Endophytes Using Bacteriological Growth Media

After 4 weeks of in vitro initiation, the bases of the healthy-looking shoots (3–5 mm) were cut off and placed in Petri dishes (100 mm × 15 mm) containing bacteriological growth medium 523. Medium 523, a general medium for growth of bacteria, is composed 8 g L−1 casein hydrolysate (Sigma-Aldrich, St. Louis, MO, USA), 10 g L−1 sucrose, 4 g L−1 yeast extract, 2 g L−1 monopotassium phosphate (KH2PO4), 0.15 g L−1 magnesium sulfate (MgSO4 7H2O), and 6 g L−1 Gelrite™ at pH of 6.9 [61]. Plates were incubated at room temperature to encourage proliferation of endogenous pathogens [56]. Therefore, cloudiness of the medium or growth of colonies on medium 523 after 2 weeks indicates contamination of the accessions. Plants showing contamination were discarded and the percentages of clean and infected shoots were recorded. Healthy looking shoots were used for further propagation experiments.

3.4. In Vitro Multiplication

DV-10/11 and KV-2/35 accessions were used to optimize the culture medium during the in vitro multiplication phase. Nodal sections were obtained from 6-week-old successfully initiated in vitro plants and placed in glass culture vessels (237 mL) (PhytoTechnology Laboratories®, Lenexa, KS, USA) with the 10 media formulations (MS-based formulations) described in Table 7 with a density of 5 nodal sections (1–2 cm) per vessel. Cultures were grown under the same conditions as the initiation phase.
The multiplication rate (MR) was calculated in shoots grown for 5 weeks on one of the ten culture media. Cultures were subcultured two to three times every 5 weeks on the same medium formulation. MR was determined using the formula: MR = a/bc, where a is the number of new shoots, b is the number of initial shoots, and c is the number of subcultures.

3.5. Testing Grape Hybrids for the Presence of Plasmopara viticola Resistance Genes

3.5.1. DNA Extraction

In vitro collection of 17 grapevine hybrids grown for 5 weeks provided material for screening for the presence of fungal resistance genes. DNA was extracted using a modified cetyltrimethyl ammonium bromide procedure (CTAB), as described by Doyle and Doyle [112]. Frozen leaves (2–4 cm2) were ground in ceramic mortars with the addition of 1.5 mL of CTBA extraction buffer (2% CTAB, 2% PVP, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl (pH of 8.0), 2% β-MET), heated to 65 °C. Further, 2 mL of 10 mg mL−1 RNase was added to the sample with incubation at 65 °C for 15 min. After which, an equal volume of chloroform was added to the samples, followed by shaking for 5 min and centrifugation for 10 min at 14,000 rpm. The upper phase was transferred to a new 2 mL centrifuge tube, and DNA was deposited in 2/3 of the volume of isopropanol. After incubation for 5 min at room temperature, the samples were centrifuged, in the same manner as before, and washed with 70% ethanol before being centrifuged again. The sediment was dried in the air. Next, the DNA was dissolved in 150 µL of sterile deionized water and re-precipitated with an equal volume of 4M NaCl and two volumes of 96% ethanol. After incubation at 20 °C for 15 min, the samples were centrifuged for 15 min at 13,000 rpm, and the precipitate was washed with 70% ethanol and air-dried, after which it was dissolved in 100 µL of deionized sterile water.

3.5.2. PCR Analysis

PCR analysis of 17 grapevine DNA preparations was carried out using Thermo Fisher reagents. For the reaction (20 µL), 0.5 µL of a DNA preparation pre-diluted with 1:10 water, 2 pmol of each primer, 1x buffer for Taq polymerase, 25 mM MgCl2, 25 mM dNTP, and 0.2 µL of Taq polymerase (0.5 u) (Thermo Fisher Scientific Inc., Vilnius, Lithuania) were used. Specific primers Giop F (TCCTGCAATTCGCATTACGT) and Giop R (GGTTGCAGCTAATGGATTCCTA) were used for investigating the presence of resistance genes (Rpv1 and Rpv3) to Plasmopara viticola in grapevine accessions derived from the crosses [113]. The following set of associated SSR markers were used: UDV-737 and UDV-305 for Rpv3 and UDV-343 for Rpv12. The following program was used for the GeneAmp PCR System 9700 amplifier (“Applied Biosystems”, Waltham, MA, USA): 5 min at 94 °C—1 cycle; 30 s at 94 °C, 30 s at 57 °C, and 1 min at 72 °C—30 cycles; and 5 min at 72 °C—1 cycle. The reaction products were analyzed by electrophoresis using 1.2% agarose gel in 0.5 x TBE (Tris, borate, EDTA). The amplified fragments were visualized using the QUANTUM-CX5/EPI UV-WL gel electrophoresis system (Vilber Smart Imaging, Collégien, France)

3.6. Statistical Analysis

A minimum of 10 shoots were used per replicate with three replicates per treatment in a randomized block design during the in vitro initiation experiments. The total number of shoots indexed using bacterial growth medium 523 ranged from 15 to 30, depending on the availability of samples obtained in each accession after initiation. The in vitro multiplication experiment was performed with two replicates of 15 shoots for each treatment. Means and standard error (SE) were calculated across experimental replicates and analyzed using analysis of variance, and Tukey’s mean separation test was performed. p ≤ 0.05 was considered significantly different. All analyses were performed using SYSTAT 12.0 software package [114].

4. Conclusions

Our study established and safely stored an in vitro collection of 18 grapevine hybrids developed in the breeding program of the KSRIFGV, as well as identified 16 accessions with the presence of P. viticola resistance mediated by Rpv3 and Rpv12 loci. The availability and safe storage of these genetic resources are essential for future advances in breeding programs to develop new elite cultivars of economic interest in Kazakhstan. Furthermore, optimized micropropagation systems, such as the one developed in this study, will further facilitate future efforts for the long-term conservation of grapevine plant genetic resources.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13081089/s1, Figure S1: Indexing in vitro grape shoots for the presence of contamination on bacteriological growth medium 523 (A); Clean cultures of grape hybrid KV-2/35 grown for three weeks on culture medium no. 7 (B); Figure S2: In vitro multiplication of grapevine accessions KV-2/35 (A) and DV-10/11 (B) on culture medium no. 7 grown for 5 weeks; Figure S3: Representative electrophoretic analysis of PCR products from micropropagated grapevine accessions to test for the presence of Plasmopara viticola resistance genes Rpv3 and Rpv12; Figure S4: Shoots were contaminated (A), necrotic (B) or well developed (C,D). Shoots of grapevine accession DV-10/11 grown on initiation medium for 28 days.

Author Contributions

Conceptualization, N.V.R.; experimental design and performed the experiments, N.V.R., M.M.A., A.S.Z., and N.V.M.; collected the data and conducted the statistical analysis, N.V.R.; Diagnosis of fungal diseases of grapes using molecular markers, A.M.A.; field research of grape hybrids, S.Z.K.; writing—original draft preparation, N.V.R. and J.C.B.; writing—review and editing, N.V.R., S.V.K., and J.C.B.; funding acquisition and project administration, N.V.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of Kazakhstan Republic (BR 18574149, Project No 0123РК00028).

Data Availability Statement

The datasets presented in the study are either included in the article or in the Supplementary Material. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors would like to express their gratitude to the staff of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture for their many years of work towards the creation and breeding of new grapevine hybrids to support viticulture in Kazakhstan.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. OIV (International Organisation of Vine and Wine). World Statistics in 2022; International Organisation of Vine and Wine: Paris, France, 2020; Available online: https://www.oiv.int/what-we-do/global-report?oiv (accessed on 23 January 2024).
  2. This, P.; Lacombe, T.; Thomas, M.R. Historical origins and genetic diversity of wine grapes. Trends Genet. 2006, 22, 511–519. [Google Scholar] [CrossRef] [PubMed]
  3. Li, B.; Jiang, J.; Fan, X.; Zhang, Y.; Sun, H.; Zhang, G.; Liu, C. Molecular characterization of Chinese grape landraces (Vitis L.) using microsatellite DNA markers. HortScience 2017, 52, 533–540. [Google Scholar] [CrossRef]
  4. Smith, B.P.; Morales, N.B.; Thomas, M.R.; Smith, H.M.; Clingeleffer, P.R. Grapevine rootstocks resistant to the root-knot nematode Meloidogyne javanica. Aust. J. Grape Wine Res. 2017, 23, 125–131. [Google Scholar] [CrossRef]
  5. Buck, K.; Worthington, M. Genetic diversity of wild and cultivated Muscadine grapes (Vitis rotundifolia Michx.). Front. Plant Sci. 2022, 13, 852130. [Google Scholar] [CrossRef] [PubMed]
  6. Bettoni, J.C.; Marković, Z.; Bi, W.; Volk, G.M.; Matsumoto, T.; Wang, Q.-C. Grapevine shoot tip cryopreservation and cryotherapy: Secure storage of disease-free plants. Plants 2021, 10, 2190. [Google Scholar] [CrossRef] [PubMed]
  7. Carra, A.; Carimi, F.; Bettoni, J.C.; Pathirana, R. Progress and challenges in the application of synthetic seed technology for ex situ germplasm conservation in grapevine (Vitis spp.). In Synthetic Seeds; Faisal, A., Alatar, A.A., Eds.; Springer Nature: Cham, Switzerland, 2019; pp. 439–467. [Google Scholar] [CrossRef]
  8. Bettoni, J.; Kretzschmar, A.A.; Bonnart, R.; Shepherd, A.; Volk, G.M. Cryopreservation of 12 Vitis species using apical shoot tips derived from plants grown in vitro. HortScience 2019, 54, 976–981. [Google Scholar] [CrossRef]
  9. FAO (Food and Agriculture Organization of the United Nations). Crops and Livestock Products. Production in 2022. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 23 January 2024).
  10. Chupradit, S.; Huy, D.T.N.; Hachem, K.; Shichiyakh, R.A.; Bokov, D.; Mahmudiono, T.; Al-Rekaby, H.Q.; Kadhim, M.M.; Thangavelu, L. Agrobiological evaluations of newly introduced grapes varieties under climatic conditions of the south of Kazakhstan. Braz. J. Biol. 2022, 84, e258275. [Google Scholar] [CrossRef]
  11. Syrgabek, Y.A.; Alimzhanova, M.; Amandykova, A.; Akylbekova, T.N. Soil fauna of vineyards of Southeast Kazakhstan. Soil Sci. Agrochem. 2020, 4, 57–65. [Google Scholar]
  12. Committee on Land Resources Management of the Ministry of Agriculture on the Condition and Use of Land for 2020. Available online: https://www.gov.kz/memleket/entities/land?lang=ru (accessed on 23 November 2023).
  13. Kulzhanov, S.N.; Kazybayeva, S.Z.; Tazhibaev, T.S.; Azhitaeva, L.A.; Yessenaliyeva, A. Effect of climatic conditions on the productive and biochemical characteristics of grape varieties grown on sierozem soil. Eurasian J. Soil Sci. 2022, 11, 174–183. [Google Scholar] [CrossRef]
  14. Yefremova, Y.M.; Urazayeva, M.V.; Kazybaeva, S.S. Rootstocks and varieties of fruits, berry crops, and grapes, used for intensive gardening in Kazakhstan. In Apple Cultivation—Recent Advances; Küden, A., Ed.; IntechOpen Limited: London, UK, 2023; pp. 1–22. [Google Scholar] [CrossRef]
  15. FAO (Food and Agriculture Organization of the United Nations). Crops and Livestock Products. Import and Export Quantity and Import Value in 2022. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 23 January 2024).
  16. Kazybayeva, S.; Dolgikh, S.; Kulshanov, S.; Urazayeva, M.; Ushkempirova, G. The organization of the virus-tested planting material production for the grape varieties of the local and foreign selection in Kazakhstan. Bioengineering 2020, 25, 01002. [Google Scholar] [CrossRef]
  17. Pozharskiy, A.S.; Aubakirova, K.P.; Gritsenko, D.A.; Tlevlesov, N.I.; Karimov, N.Z.; Galiakparov, N.N.; Ryabushkina, N.A. Genotyping and morphometric analysis of Kazakhstani grapevine cultivars versus Asian and European cultivars. Genet. Mol. Res. 2020, 19, gmr18482. [Google Scholar] [CrossRef]
  18. Ministry of Ecology and Natural Resources of the Republic of Kazakhstan. The Fifth National Report on Progress in Implementation of the Convention on Biological Diversity. Available online: https://www.cbd.int/doc/world/kz/kz-nr-05-en.pdf (accessed on 24 January 2024).
  19. This, P.; Jung, A.; Boccacci, P.; Borrego, J.; Botta, R.; Costantini, L.; Crespan, M.; Dangl, G.S.; Eisenheld, C.; Ferreira-Monteiro, F.; et al. Development of a standard set of microsatellite reference alleles for identification of grape cultivars. Theor. Appl. Genet. 2004, 109, 1448–1458. [Google Scholar] [CrossRef]
  20. Sefc, K.M.; Lefort, F.; Grando, M.S.; Scott, K.D.; Steinkellner, H.; Thomas, M.R. Microsatellite markers for grapevine: A state of the art. In Molecular Biology & Biotechnology of the Grapevine; Roubelakis-Angelakis, K.A., Ed.; Springer: Amsterdam, The Netherlands, 2001; pp. 407–438. [Google Scholar] [CrossRef]
  21. Atack, A. New perspectives in grapevine (Vitis spp.) breeding. In Case Studies of Breeding Strategies in Major Plant Species; Wang, H., Ed.; IntechOpen Limited: London, UK, 2022; pp. 1–35. [Google Scholar] [CrossRef]
  22. Chung, P.-Y.; Liao, C.-T. Selection of parental lines for plant breeding via genomic prediction. Front. Plant Sci. 2022, 13, 934767. [Google Scholar] [CrossRef]
  23. López-Caamal, A.; Tovar-Sánchez, E. Genetic, morphological, and chemical patterns of plant hybridization. Rev. Chil. De Hist. Nat. 2014, 87, 16. [Google Scholar] [CrossRef]
  24. Egorov, E.A. Grape breeding is a key link in the development of the grapes and wine-making industry. Vavilovskii Zh. Genet. 2021, 25, 408–413. [Google Scholar] [CrossRef]
  25. Pérez-de-Castro, A.M.; Vilanova, S.; Cañizares, J.; Pascual, L.; Blanca, J.M.; Díez, M.J.; Prohens, J.; Picó, B. Application of genomic tools in plant breeding. Curr. Genomics 2012, 13, 179–195. [Google Scholar] [CrossRef]
  26. Koledenkova, K.; Esmaeel, Q.; Jacquard, C.; Nowak, J.; Clément, C.; Ait Barka, E. Plasmopara viticola the causal agent of downy mildew of grapevine: From its taxonomy to disease management. Front. Microbiol. 2022, 13, 889472. [Google Scholar] [CrossRef] [PubMed]
  27. Fröbel, S.; Zyprian, E. Colonization of different grapevine tissues by Plasmopara viticola—A histological study. Front. Plant Sci. 2019, 10, 951. [Google Scholar] [CrossRef] [PubMed]
  28. Gessler, C.; Pertot, I.; Perazzolli, M. Plasmopara viticola: A review of knowledge on downy mildew of grapevine and effective disease management. Phytopathol. Mediterr. 2011, 50, 3–44. [Google Scholar] [CrossRef]
  29. Gindro, K.; Alonso-Villaverde, V.; Voinesco, F.; Spring, J.-L.; Viret, O.; Dubuis, P.-H. Susceptibility to downy mildew in grape clusters: New microscopical and biochemical insights. Plant Physiol. Biochem. 2012, 52, 140–146. [Google Scholar] [CrossRef]
  30. Fawke, S.; Doumane, M.; Schornack, S. Oomycete interactions with plants: Infection strategies and resistance principles. Microbiol. Mol. Biol. Rev. 2015, 79, 263–280. [Google Scholar] [CrossRef] [PubMed]
  31. Bavaresco, L. Impact of grapevine breeding for disease resistance on the global wine industry. Acta Hortic. 2018, 1248, 7–14. [Google Scholar] [CrossRef]
  32. Díez-Navajas, A.M.; Wiedemann-Merdinoglu, S.; Greif, C.; Merdinoglu, D. Nonhost versus host resistance to the grapevine downy mildew, Plasmopara viticola, studied at the tissue level. Phytopathology 2008, 98, 776–780. [Google Scholar] [CrossRef]
  33. Cadle-Davidson, L. Variation within and between Vitis spp. for foliar resistance to the downy mildew pathogen Plasmopara viticola. Plant Dis. 2008, 92, 1577–1584. [Google Scholar] [CrossRef]
  34. Welter, L.J.; Göktürk-Baydar, N.; Akkurt, M.; Maul, E.; Eibach, R.; Töpfer, R.; Zyprian, E.M. Genetic mapping and localization of quantitative trait loci affecting fungal disease resistance and leaf morphology in grapevine (Vitis vinifera L.). Mol. Breed. 2007, 20, 359–374. [Google Scholar] [CrossRef]
  35. Venuti, S.; Copetti, D.; Foria, S.; Falginella, L.; Hoffmann, S.; Bellin, D.; Cindrić, P.; Kozma, P.; Scalabrin, S.; Morgante, M.; et al. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties. PLoS ONE 2013, 8, e61228. [Google Scholar] [CrossRef]
  36. Ilnitskaya, E.T.; Makarkina, M.V.; Tokmakov, S.V.; Naumova, L.G. DNA marker based identification of the Rpv3 gene determining downy mildew resistance in grapevines. Vavilovskii Zhurnal Genet. Selektsii. 2018, 22, 703–707. [Google Scholar] [CrossRef]
  37. Schiff, C.L.; Wilson, I.W.; Somerville, S.C. Polygenic powdery mildew disease resistance in Arabidopsis thaliana: Quantitative trait analysis of the accession Warschau-1. Plant Pathol. 2001, 50, 690–701. [Google Scholar] [CrossRef]
  38. Merdinouglu, D.; Scheider, C.; Prado, E.; Wiedemann-Merdinoglu, S.; Mestre, P. Breeding for durable resistance to downy and powdery mildew in grapevine. OENO One 2018, 52, 203–209. [Google Scholar] [CrossRef]
  39. Dalbó, M.A.; Ye, G.N.; Weeden, N.F.; Wilcox, W.F.; Reisch, B.I. Marker-assisted selection for powdery mildew resistance in grapes. J. Am. Soc. Hort. Sci. 2001, 126, 83–89. [Google Scholar] [CrossRef]
  40. Eibach, R.; Diehl, H.; Alleweldt, G. Investigations on the heritability of resistance to Oidium tuclceri, Pasmopara viticola and Botrytis cinerea in grapes. Vitis 1989, 28, 209–228. [Google Scholar] [CrossRef]
  41. Eibach, R.; Zyprian, E.; Welter, L.; Töpfer, R. The use of molecular markers for pyramiding resistance genes in grapevine breeding. Vitis 2007, 46, 120–124. [Google Scholar] [CrossRef]
  42. Saifert, L.; Sánchez-Mora, F.D.; Assumpção, W.T.; Zanghelini, J.A.; Giacometti, R.; Novak, E.I.; Dal Vesco, L.L.; Nodari, R.O.; Eibach, R.; Welter, L.J. Marker-assisted pyramiding of resistance loci to grape downy mildew. Pesqui. Agropecu. Bras. 2018, 53, 602–610. [Google Scholar] [CrossRef]
  43. Sánchez-Mora, F.D.; Saifert, L.; Zanghelini, J.; Assumpção, W.T.; Guginski-Piva, C.A.; Giacometti, R.; Novak, E.I.; Klabunde, G.H.; Eibach, R.; Dal Vesco, L.; et al. Behavior of grape breeding lines with distinct resistance alleles to downy mildew (Plasmopara viticola). Crop Breed. Appl. Biotechnol. 2017, 17, 141–149. [Google Scholar] [CrossRef]
  44. Foria, S.; Monte, C.; Testolin, R.; Di Gaspero, G.; Cipriani, G. Pyramidizing resistance genes in grape: A breeding program for the selection of elite cultivars. Acta Hortic. 2019, 1248, 549–554. [Google Scholar] [CrossRef]
  45. Collard, B.C.Y.; Jaufer, M.Z.Z.; Brouwer, J.B.; Pang, E.C.K. An introduction to markers, quantitative trait locus (QTL) mapping and marker-assisted selection for crop improvement: The basic concepts. Euphytica 2005, 142, 169–196. [Google Scholar] [CrossRef]
  46. Bhojwani, S.S.; Dantu, P.K. Micropropagation. In Plant Tissue Culture: An Introductory Text; Bhojwani, S.S., Dantu, P.K., Eds.; Springer: New Delhi, India, 2013; pp. 245–274. [Google Scholar] [CrossRef]
  47. Macedo, T.A.; Fagherazzi, A.; Bettoni, J.C.; Feldberg, N.P.; Kretzschmar, A.A. Propagação da Videira. In A Cultura da Videira: Vitivinicultura de Altitude; Rufato, L., Marcon Filho, J.L., Brighenti, A.F., Bogo, A., Kretzschmar, A.A., Eds.; UDESC: Florianópolis, Brazil, 2021; pp. 134–158. [Google Scholar] [CrossRef]
  48. Cassells, A.C. Pathogen and Biological Contamination Management in Plant Tissue Culture: Phytopathogens, Vitro Pathogens, and Vitro Pests. In Plant Cell Culture Protocols; Loyola-Vargas, V.M., Ochoa-Alejo, N., Eds.; Humana Press: Totowa, NJ, USA, 2012; pp. 57–80. [Google Scholar] [CrossRef]
  49. Ahloowalia, B.S. Tissue culture—Clonal Propagation, In Vitro. In Encyclopedia of Applied Plant Sciences; Thomas, B., Ed.; Academic Press: Cambridge, MA, USA, 2003; pp. 1360–1364. [Google Scholar] [CrossRef]
  50. Loberant, B.; Altman, A. Micropropagation of plants. In Encyclopedia of Industrial Biotechnology: Bioprocess, Bioseparation, and Cell Technology; Flickinger, M.C., Ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2010; pp. 1–17. [Google Scholar] [CrossRef]
  51. Kaur, K.; Dolker, D.; Behera, S.; Pati, P.K. Critical factors influencing in vitro propagation and modulation of important secondary metabolites in Withania somnifera (L.) dunal. Plant Cell Tissue Organ. Cult. 2022, 149, 41–60. [Google Scholar] [CrossRef] [PubMed]
  52. Dobránszki, J.; Teixeira da Silva, J.A. Micropropagation of apple—A review. Biotechnol. Adv. 2010, 28, 462–488. [Google Scholar] [CrossRef] [PubMed]
  53. Bonnart, R.M.; Chen, K.Y.; Volk, G.M. Plant Tissue Culture Media Preparation. In Training in Plant Genetic Resources: Cryopreservation of Clonal Propagules; Volk, G.M., Ed.; Colorado State University: Fort Collins, CO, USA, 2022; Available online: https://colostate.pressbooks.pub/clonalcryopreservation/chapter/media/ (accessed on 11 March 2024).
  54. Cassells, A.C. Problems in tissue culture: Culture contamination. In Micropropagation—Technology and Application; Debergh, P.C., Zimmerman, R.H., Eds.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 1991; pp. 31–44. [Google Scholar]
  55. Herman, E.B. Plant tissue culture contamination: Challenges and opportunities. Acta Hortic. 2017, 1155, 231–238. [Google Scholar] [CrossRef]
  56. Romadanova, N.V.; Tolegen, A.B.; Kushnarenko, S.V.; Zholdybayeva, E.V.; Bettoni, J.C. Effect of Plant Preservative MixtureTM on endophytic bacteria eradication from in vitro-grown apple shoots. Plants 2022, 11, 2624. [Google Scholar] [CrossRef]
  57. Orlikowska, T.; Nowak, K.; Reed, B. Bacteria in the plant tissue culture environment. Plant Cell Tissue Organ. Cult. 2016, 128, 487–508. [Google Scholar] [CrossRef]
  58. Gunson, H.E.; Spencer-Phillips, P.T.N. Latent bacterial infections: Epiphytes and endophytes as contaminants of micropropagated plants. In Physiology, Growth and Development of Plants in Culture; Lumsden, P.J., Nicholas, J.R., Davies, W.J., Eds.; Springer Nature: Cham, Switzerland, 1994; pp. 379–396. [Google Scholar] [CrossRef]
  59. Volk, G.M.; Bonnart, R.; Araújo de Oliveira, A.C.; Henk, A.D. Minimizing the deleterious effects of endophytes in plant shoot tip cryopreservation. Appl. Plant Sci. 2022, 10, e11489. [Google Scholar] [CrossRef] [PubMed]
  60. Ogbe, A.A.; Finnie, J.F.; Van Staden, J.V. The role of endophytes in secondary metabolites accumulation in medicinal plants under abiotic stress. S. Afr. J. Bot. 2020, 134, 126–134. [Google Scholar] [CrossRef]
  61. Kado, C.I.; Heskett, M.G. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas, and Xanthomonas. Phytopathology 1970, 60, 969–976. [Google Scholar] [CrossRef] [PubMed]
  62. Pasternak, T.P.; Steinmacher, D. Plant growth regulation in cell and tissue culture in vitro. Plants 2024, 13, 327. [Google Scholar] [CrossRef] [PubMed]
  63. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
  64. Kim, S.-H.; Zebro, M.; Jang, D.-C.; Sim, J.-E.; Park, H.-K.; Kim, K.-Y.; Bae, H.-M.; Tilahun, S.; Park, S.-M. Optimization of Plant Growth Regulators for In Vitro Mass Propagation of a Disease-Free ‘Shine Muscat’ Grapevine Cultivar. Curr. Issues Mol. Biol. 2023, 45, 7721–7733. [Google Scholar] [CrossRef] [PubMed]
  65. Abido, A.I.A.; Sabah, M.A.M.A.; Hassanen, S.A.; Rayan, G.A. In vitro Propagation of Grapevine (Vitis vinifera L.) Muscat of Alexandria cv. For Conservation of Endangerment. Middle East J. Sci. Res. 2013, 13, 328–337. [Google Scholar] [CrossRef]
  66. Bettoni, J.C.; Bonnart, R.; Shepherd, A.; Kretzschmar, A.A.; Volk, G.M. Modifications to a Vitis shoot tip cryopreservation procedure: Effect of shoot tip size and use of cryoplates. Cryo Lett. 2019, 40, 103–112. [Google Scholar]
  67. Magyar-Tábori, K.; Dobránszki, J.; Teixeira da Silva, J.A.; Bulley, S.M.; Hudák, I. The role of cytokinins in shoot organogenesis in apple. Plant Cell Tissue Organ. Cult. 2010, 101, 251–267. [Google Scholar] [CrossRef]
  68. Sosnowski, J.; Truba, M.; Vasileva, V. The impact of auxin and cytokinin on the growth and development of selected crops. Agriculture 2023, 13, 724. [Google Scholar] [CrossRef]
  69. Souza, J.A.; Bettoni, J.C.; Dalla Costa, M.; Baldissera, T.C.; dos Passos, J.F.M.; Primieri, S. In vitro rooting and acclimatization of ‘Marubakaido’ apple rootstock using indole-3-acetic acid from rhizobacteria. Commun. Plant Sci. 2022, 12, 16–23. [Google Scholar] [CrossRef]
  70. Gupta, R.; Chakrabarty, S.K. Gibberellic acid in plant: Still a mystery unresolved. Plant Signal. Behav. 2013, 8, e25504. [Google Scholar] [CrossRef] [PubMed]
  71. Khan, N.; Ahmed, M.; Hafiz, I.; Abbasi, N.; Ejaz, S.; Anjum, M. Optimizing the concentrations of plant growth regulators for in vitro shoot cultures, callus induction and shoot regeneration from calluses of grapes. OENO One 2015, 49, 37–45. [Google Scholar] [CrossRef]
  72. Bettoni, J.C.; Costa, M.D.; Gardin, J.P.P.; Kretzschmar, A.A.; Souza, J.A.; Passos, J.F.M. Free culture media of growth regulators on micropropagation of grapevine (Vitis labrusca L.) ‘Bordô’ cultivar through nodal segments. Evidência 2016, 16, 59–70. [Google Scholar] [CrossRef]
  73. Huh, Y.S.; Lee, J.K.; Kim, I.J.; Kang, B.G.; Lee, K.Y. Effect of biocide addition on plantlet growth and contamination occurrence during the in vitro culture of blueberry. J. Plant Biotechnol. 2015, 42, 111–116. [Google Scholar] [CrossRef]
  74. Bettoni, J.C.; Bonnart, R.; Shepherd, A.; Kretzschmar, A.; Volk, G.M. Cryopreservation of grapevine (Vitis spp.) shoot tips from growth chamber-sourced plants and histological observations. Vitis 2019, 58, 71–78. [Google Scholar] [CrossRef]
  75. Orlikowska, T.; Zawadzka, M.; Zenkteler, E.; Sobiczewski, P. Influence of the biocides PPMTM and vitrofural on bacteria isolated from contaminated plant tissue cultures and on plant microshoots grown on various media. J. Hortic. Sci. Biotechnol. 2015, 87, 223–230. [Google Scholar] [CrossRef]
  76. Kushnarenko, S.; Aralbayeva, M.; Rymkhanova, N.; Reed, B.M. Initiation pretreatment with Plant Preservative MixtureTM increases the percentage of aseptic walnut shoots. In Vitro Cell. Dev. Biol.-Plant 2022, 58, 964–971. [Google Scholar] [CrossRef]
  77. Paul, A.L.; Semer, C.; Kucharek, T.; Ferl, R.J. The fungicidal and phytotoxic properties of benomyl and PPM in supplemented agar media supporting transgenic arabidopsis plants for a Space Shuttle flight experiment. Appl. Microbiol. Biotechnol. 2001, 55, 480–485. [Google Scholar] [CrossRef]
  78. Ostrolucká, M.G.; Gajdošová, A.; Ondrušková, E.; Lateèková, M.; Libiaková, G. Effect of medium pH on axillary shoot proliferation of selected Vaccinium vitis-idaea L. cultivars. Acta Biol. Cracov. 2010, 52, 92–96. [Google Scholar] [CrossRef]
  79. Ramage, C.M.; Williams, R.R. Mineral nutrition and plant morphogenesis. In Vitro Cell. Dev. Biol.-Plant. 2002, 38, 116–124. [Google Scholar] [CrossRef]
  80. Chen, C.-C.; Bates, R.; Carlson, J. Effect of environmental and cultural conditions on medium pH and explant growth performance of Douglas-fir (Pseudotsuga menziesii) shoot cultures. F1000Research 2014, 3, 298. [Google Scholar] [CrossRef] [PubMed]
  81. Guo, G.; Xiao, J.; Jeong, B.R. Iron source and medium pH affect nutrient uptake and pigment content in Petunia hybrida ‘Madness Red’ cultured in vitro. Int. J. Mol. Sci. 2022, 23, 8943. [Google Scholar] [CrossRef] [PubMed]
  82. Sági-Kazár, M.; Solymosi, K.; Solti, Á. Iron in leaves: Chemical forms, signalling, and in-cell distribution. J. Exp. Bot. 2022, 73, 1717–1734. [Google Scholar] [CrossRef] [PubMed]
  83. Laulhere, J.P.; Briat, J.F. Iron release and uptake by plant ferritin: Effects of pH, reduction and chelation. Biochem. J. 1993, 290, 693–699. [Google Scholar] [CrossRef] [PubMed]
  84. Wong, K.-Y.I. In Vitro Culture of ‘Dog Ridge’ Grapevine. Senior Scholars Thesis, Texas A&M University, College Station, TX, USA, 2009. [Google Scholar]
  85. Kryukov, L.A.; Vodolazhsky, D.I.; Kamenetsky-Goldstein, R. Micropropagation of grapevine and strawberry from south Russia: Rapid production and genetic uniformity. Agronomy 2022, 12, 308. [Google Scholar] [CrossRef]
  86. Bettoni, J.C.; Costa, M.D.; Gardin, J.P.P.; Kretzschmar, A.A.; Souza, J.A. In vitro propagation of grapevine cultivars with potential for the south of Brazil. Am. J. Plant Sci. 2015, 6, 1806–1815. [Google Scholar] [CrossRef]
  87. Capriotti, L.; Ricci, A.; Molesini, B.; Mezzetti, B.; Pandolfini, T.; Piunti, I.; Sabbadini, S. Efficient protocol of de novo shoot organogenesis from somatic embryos for grapevine genetic transformation. Front. Plant Sci. 2023, 14, 1172758. [Google Scholar] [CrossRef]
  88. Bettoni, J.C.; Bonnart, R.; Volk, G.M. Challenges in implementing plant shoot tip cryopreservation technologies. Plant Cell Tissue Organ. Cult. 2021, 144, 21–34. [Google Scholar] [CrossRef]
  89. Bettoni, J.C.; Chen, K.; Volk, G.M. An Overview of Shoot Tip Cryopreservation. In Training in Plant Genetic Resources: Cryo-preservation of Clonal Propagules; Volk, G.M., Ed.; Colorado State University: Fort Collins, CO, USA, 2024; Available online: https://colostate.pressbooks.pub/clonalcryopreservation/chapter/an-overview-of-shoot-tip-cryopreservation/ (accessed on 13 March 2024).
  90. Romadanova, N.V.; Mishustina, S.A.; Matakova, G.N.; Kuhsnarenko, S.V.; Rakhimbaev, I.R.; Reed, B.M. In vitro collection of Malus shoot cultures for cryogenic bank development in Kazakhstan. Acta Hortic. 2016, 1113, 271–277. [Google Scholar] [CrossRef]
  91. Romadanova, N.V.; Kushnarenko, S.V. Conservation of plant biodiversity by biotechnology methods. Proc. Appl. Bot. Genet. Breed. 2023, 184, 239–248. [Google Scholar] [CrossRef]
  92. Kulak, V.; Longboat, S.; Brunet, N.D.; Shukla, M.; Saxena, P. In vitro technology in plant conservation: Relevance to biocultural diversity. Plants 2022, 11, 503. [Google Scholar] [CrossRef] [PubMed]
  93. Volk, G.M.; Walters, C. Preservation of genetic resources in the national plant germplasm clonal collections. Plant. Breed. Rev. 2003, 23, 291–344. [Google Scholar] [CrossRef]
  94. Wang, M.R.; Chen, L.; Teixeira da Silva, J.A.; Volk, G.M.; Wang, Q.C. Cryobiotechnology of apple (Malus spp.): Development, progress and future prospects. Plant Cell Rep. 2018, 37, 689–709. [Google Scholar] [CrossRef] [PubMed]
  95. Volk, G.M.; Shepherd, A.N.; Bonnart, R. Successful cryopreservation of Vitis shoot tips: Novel pre-treatment combinations applied to nine species. Cryo Lett. 2018, 39, 322–330. [Google Scholar]
  96. Peng, J.; Wang, X.; Wang, H.; Li, X.; Zhang, Q.; Wang, M.; Yan, J. Advances in understanding grapevine downy mildew: From pathogen infection to disease management. Mol. Plant Pathol. 2024, 25, e13401. [Google Scholar] [CrossRef] [PubMed]
  97. Yu, Y.; Zhang, Y.; Yin, L.; Lu, J. The mode of host resistance to Plasmopara viticola infection of grapevines. Phytopathology 2012, 102, 1094–1101. [Google Scholar] [CrossRef] [PubMed]
  98. Di Gaspero, G.; Copetti, D.; Coleman, C.; Castellarin, S.D.; Eibach, R.; Kozma, P.; Lacombe, T.; Gambetta, G.; Zvyagin, A.; Cindric, P.; et al. Selective sweep at the Rpv3 locus during grapevine breeding for downy mildew resistance. Theor. Appl. Genet. 2012, 124, 277–286. [Google Scholar] [CrossRef]
  99. Marone Fassolo, E.; Lecchi, B.; Marcianò, D.; Maddalena, G.; Toffolatti, S.L. Pathogen Adaptation to American (Rpv3-1) and Eurasian (Rpv29) Grapevine Loci Conferring Resistance to Downy Mildew. Plants 2022, 11, 2619. [Google Scholar] [CrossRef]
  100. Frommer, B.; Müllner, S.; Holtgräwe, D.; Viehöver, P.; Huettel, B.; Töpfer, R.; Weisshaar, B.; Zyprian, E. Phased grapevine genome sequence of an Rpv12 carrier for biotechnological exploration of resistance to Plasmopara viticola. Front. Plant Sci. 2023, 14, 1180982. [Google Scholar] [CrossRef] [PubMed]
  101. Foria, S.; Magris, G.; Jurman, I.; Schwope, R.; De Candido, M.; De Luca, E.; Ivanišević, D.; Morgante, M.; Di Gaspero, G. Extent of wild-to-crop interspecific introgression in grapevine (Vitis vinifera) as a consequence of resistance breeding and implications for the crop species definition. Horticult. Res. 2022, 9, uhab010. [Google Scholar] [CrossRef] [PubMed]
  102. Ricciardi, V.; Crespan, M.; Maddalena, G.; Migliaro, D.; Brancadoro, L.; Maghradze, D.; Failla, O.; Toffolatti, S.L.; De Lorenzis, G. Novel loci associated with resistance to downy and powdery mildew in grapevine. Front. Plant Sci. 2024, 15, 1386225. [Google Scholar] [CrossRef] [PubMed]
  103. Sakiroglu, M.; Brummer, E.C. Identification of loci controlling forage yield and nutritive value in diploid alfalfa using GBS-GWAS. Theor. Appl. Genet. 2017, 130, 261–268. [Google Scholar] [CrossRef] [PubMed]
  104. Delmotte, F.; Mestre, P.; Schneider, C.; Kassemeyer, H.H.; Kozma, P.; Richart-Cervera, S.; Rouxel, M.; Delière, L. Rapid and multiregional adaptation to host partial resistance in a plant pathogenic oomycete: Evidence from European populations of Plasmopara viticola, the causal agent of grapevine downy mildew. Infect. Genet. Evol. 2014, 27, 500–508. [Google Scholar] [CrossRef] [PubMed]
  105. Dinglasan, E.; Periyannan, S.; Hickey, L.T. Harnessing adult-plant resistance genes to deploy durable disease resistance in crops. Essays Biochem. 2022, 66, 571–580. [Google Scholar] [CrossRef] [PubMed]
  106. Zhao, Y.; Zhu, X.; Chen, X.; Zhou, J.-M. From plant immunity to crop disease resistance. J. Genet. Genom. 2022, 49, 693–703. [Google Scholar] [CrossRef] [PubMed]
  107. Zini, E.; Dolzani, C.; Stefanini, M.; Gratl, V.; Beltinelli, P.; Nicolini, D.; Betta, G.; Dorigatti, C.; Velasco, R.; Letschka, T.; et al. R-Loci Arrangement Versus Downy and PowderyMildew Resistance Level: A Vitis Hybrid Survey. Int. J. Mol. Sci. 2019, 20, 3526. [Google Scholar] [CrossRef] [PubMed]
  108. Schwander, F.; Eibach, R.; Fechter, I.; Hausmann, L.; Zyprian, E.; Töpfer, R. Rpv10: A new locus from the Asian Vitis gene pool for pyramiding downy mildew resistance loci in grapevine. Theor. Appl. Genet. 2012, 124, 163–176. [Google Scholar] [CrossRef]
  109. Wingerter, C.; Eisenmann, B.; Weber, P.; Dry, I.; Bogs, J. Grapevine Rpv3-, Rpv10- and Rpv12-mediated defense responses against Plasmopara viticola and the impact of their deployment on fungicide use in viticulture. BMC Plant Biol. 2021, 21, 470. [Google Scholar] [CrossRef]
  110. Rybakov, A.A.; Ostroukhova, S.A.; Gorbach, V.I. Viticulture: Allowance for Agricultural Works Institute, 2nd ed.; Ukituvchi: Tashkent, Uzbekistan, 1975; p. 136. (In Russian) [Google Scholar]
  111. Plant Preservative Mixture. Available online: https://www.plantcelltechnology.com/plant-preservative-mixture-ppm-1/ (accessed on 3 April 2024).
  112. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  113. Valsesia, G.; Gobbin, D.; Patocchi, A.; Vecchione, A.; Pertot, I.; Gessler, C. Development of a high-throughput method for quantification of Plasmopara viticola DNA in grapevine leaves by means of quantitative real-time polymerase chain reaction. Phytopathology 2005, 95, 672–678. [Google Scholar] [CrossRef] [PubMed]
  114. SYSTAT. SYSTAT 12.0, Statistics Software; SYSTAT Software, Inc.: San Jose, CA, USA, 2007; Available online: https://systatsoftware.com/ (accessed on 3 January 2024).
Plants 13 01089 g001
Figure 1. Field collection of grapevine hybrids grown in the experimental area of Kazakh Scientific Research Institute of Fruit Growing and Viticulture in Almaty (A). Cuttings of grapevine hybrids harvested in November (B) and cold-treated in a refrigerated room at 4 °C for 2 months (C) before moving to laboratory conditions at 24 ± 1 °C and with a photoperiod of 10 h 30 min for bud sprouting (D,E). Bar in E = 1 cm.
Figure 1. Field collection of grapevine hybrids grown in the experimental area of Kazakh Scientific Research Institute of Fruit Growing and Viticulture in Almaty (A). Cuttings of grapevine hybrids harvested in November (B) and cold-treated in a refrigerated room at 4 °C for 2 months (C) before moving to laboratory conditions at 24 ± 1 °C and with a photoperiod of 10 h 30 min for bud sprouting (D,E). Bar in E = 1 cm.
Plants 13 01089 g001
Table 1. Effects of different durations of surface sterilization with mercuric chloride (HgCl2) on shoots taken directly from the field.
Table 1. Effects of different durations of surface sterilization with mercuric chloride (HgCl2) on shoots taken directly from the field.
Plant AccessionHgCl2 Exposure Duration (min)
5710
InfectedNecroticViableInfectedNecroticViableInfectedNecroticViable
IV-4/7465 ± 9ab5 ± 5d30 ± 17bc70 ± 17ab10 ± 5cd20 ± 10c35 ± 13bc50 ± 18b15 ± 9cd
X-13/9055 ± 14b20 ± 17cd25 ± 20bc65 ± 9ab20 ± 18c15 ± 9cd56 ± 14b44 ± 10bc0 ± 0d
IV-6/987 ± 5ab7 ± 3d7 ± 3d60 ± 19ab15 ± 17cd25 ± 20bc50 ± 14b50 ± 14b0 ± 0d
IV-14/950 ± 14b5 ± 5d5 ± 5d65 ± 11ab15 ± 17cd20 ± 18c50 ± 14b45 ± 13bc5 ± 5d
V-7/1775 ± 17ab15 ± 9cd10 ± 5cd70 ± 17ab20 ± 17bc10 ± 0cd40 ± 9bc60 ± 14b0 ± 0d
DV-10/1170 ± 12a5 ± 5d25 ± 10bc35 ± 13bc25 ± 10bc40 ± 9b30 ± 22bc40 ± 5b30 ± 14bc
KV-2/3580 ± 17ab0 ± 0d20 ± 18c70 ± 10ab20 ± 10cd10 ± 9cd45 ± 13bc50 ± 14b5 ± 5d
III-02/2265 ± 9ab5 ± 5d30 ± 17bc50 ± 14b30 ± 17bc20 ± 18c37 ± 15bc53 ± 12b10 ± 4cd
KV-2/980 ± 17ab20 ± 18cd0 ± 0d75 ±14ab10 ± 4cd15 ± 9cd55 ± 14b45 ± 14bc0 ± 0d
III-7/1570 ± 14ab10 ± 4cd20 ± 12c65 ±13ab20 ± 10c15 ± 10cd35 ± 14bc60 ± 14b5 ± 5d
KV-1/1080 ± 14ab7 ± 3c13 ± 9cd60 ± 15b20 ± 10c20 ± 10c40 ± 10bc55 ± 13b5 ± 5d
KII-1/2987 ± 5a0 ± 0d13 ± 13cd70 ± 8a5 ± 5d25 ± 16bc35 ± 14bc50 ± 14b15 ± 9cd
VIII-3/4590 ± 12a0 ± 0d10 ± 9cd60 ± 23ab20 ± 8cd20 ± 17c35 ± 13bc60 ± 15b5 ± 5d
V-7/990 ± 7a10 ± 9cd0 ± 0d60 ± 15b0 ± 0d40 ± 5b50 ± 14b45 ± 22bc5 ± 5d
XII-17/260 ± 5b10 ± 17cd25 ± 15bc60 ± 12b35 ± 13bc5 ± 5d32 ± 16bc58 ± 15b10 ± 4cd
XII-9/360 ± 15b10 ± 5c30 ± 17bc50 ± 14b15 ± 9cd35 ± 9bc25 ± 20bc45 ± 14bc30 ± 17bc
VII-6/7290 ± 8a0 ± 0d10 ± 9cd45 ± 10bc45 ± 10bc10 ± 9cd45 ± 13bc55 ± 13b0 ± 0d
KIV-1/6475 ± 15ab10 ± 6cd15 ± 9cd65 ± 9ab10 ± 4cd25 ± 20bc50 ± 14b45 ± 13bc5 ± 5d
Mean75 ± 12 8 ± 6 17 ± 11 61 ± 10 18 ± 11 21 ± 11 41 ± 9 51 ± 6 8 ± 8
Data represent mean ± SE. Values followed by different letters within each section were significantly different at p ≤ 0.05 using Tukey’s mean separation test. HgCl2, mercuric chloride.
Table 2. Effects of different durations of surface sterilization with mercuric chloride (HgCl2) on shoots sprouted in an indoor laboratory environment.
Table 2. Effects of different durations of surface sterilization with mercuric chloride (HgCl2) on shoots sprouted in an indoor laboratory environment.
Plant AccessionHgCl2 Exposure Duration (min)
5710
InfectedNecroticViable InfectedNecroticViable InfectedNecroticViable
IV-4/7460 ± 19ab0 ± 0d40 ± 10bc30 ± 21bc60 ± 15b10 ± 9cd20 ± 17c80 ± 11a0 ± 0d
X-13/9050 ± 14b20 ± 18c30 ± 14bc25 ± 20bc67 ± 17ab8 ± 5cd9 ± 6cd82 ± 12a9 ± 6cd
IV-6/950 ± 14b0 ± 0d10 ± 10cd30 ±22bc80 ± 12a0 ± 0d0 ± 0d100 ± 0a0 ± 0d
IV-14/980 ± 17ab10 ± 12cd10 ± 12cd30 ±22bc70 ± 10ab0 ± 0d0 ± 0d90 ± 16a10 ± 14cd
V-7/1740 ± 9bc20 ± 18c40 ± 21bc8 ± 7cd83 ± 14a8 ± 11cd8 ± 8cd83 ± 4a8 ± 8cd
DV-10/1140 ± 5bc10 ± 3cd50 ± 21b0 ± 0d60 ± 10b40 ± 23bc0 ± 0d83 ± 14a17 ± 7cd
KV-2/3530 ± 14bc30 ± 14bc40 ± 22bc8 ± 13cd80 ± 16a15 ± 7cd0 ± 0d91 ± 17a9 ± 15cd
III-02/2240 ± 20bc10 ± 12cd50 ± 20b0 ± 0d58 ± 24b42 ± 18bc0 ± 0d83 ± 14a8 ± 7cd
KV-2/965 ± 16ab35 ± 21bc0 ± 0d14 ± 17cd86 ± 14a0 ± 0d10 ± 16cd90 ± 17a0 ± 0d
III-7/1550 ± 14b10 ± 10cd40 ± 22bc20 ± 13c67 ± 20ab13 ± 7cd8 ± 8cd92 ± 9 a0 ± 0d
KV-1/1090 ±17a10 ± 8cd0 ± 0d20 ± 10c80 ± 12a0 ± 0d10 ± 3 cd90 ± 16a0 ± 0d
KII-1/2975 ± 12a0 ± 0d25 ± 20bc33 ± 11bc50 ± 20b17 ± 8cd8 ± 6cd83 ± 12a8 ± 8cd
VIII-3/4580 ± 12a0 ± 0d20 ± 13c14 ± 17cd79 ± 10a7 ± 6cd0 ± 0d92 ± 19a8 ± 6cd
V-7/9100 ± 0a0 ± 0d0 ± 0d20 ± 18c70 ± 13ab10 ± 9cd0 ± 0d90 ± 17a10 ± 5cd
XII-17/257 ± 14b14 ± 8cd29 ± 13bc0 ± 0d79 ± 20a21 ± 7c0 ± 0d92 ± 14a8 ±12cd
XII-9/350 ± 9b10 ± 7cd40 ± 18bc10 ± 10cd60 ± 15b30 ± 20bc9 ± 9cd64 ± 17ab27 ± 20bc
VII-6/72100 ± 0a0 ± 0d0 ± 0d26 ± 5bc75 ± 22a0 ± 0d8 ± 8cd92 ± 14a0 ± 0d
KIV-1/6490 ± 10a0 ± 0d10 ± 10cd30 ± 14bc70 ± 12ab0 ± 0d10 ± 10cd90 ± 17a0 ± 0d
Mean65 ± 22 10 ± 10 25 ± 18 17 ± 11 71 ± 10 12 ± 11 6 ± 5 87 ± 7 7 ± 5
Values followed by different letters were significantly different at p ≤ 0.05 using Tukey’s mean separation test. HgCl2, mercuric chloride.
Table 3. Percentage of infected and clean shoots of in vitro grapevines grown for 4 weeks and indexed using the bacterial growth medium 523.
Table 3. Percentage of infected and clean shoots of in vitro grapevines grown for 4 weeks and indexed using the bacterial growth medium 523.
Plant AccessionShootsN
Infected (%)Clean (%)
IV-4/7450 ± 9b50 ± 14b28
X-13/9059 ± 14b41 ± 6b27
IV-6/945 ± 17bc55 ± 24b20
IV-14/917 ± 7cd83 ± 18ab24
V-7/1739 ± 14bc61 ± 14b18
DV-10/1115 ± 8cd85 ± 15a30
KV-2/3510 ± 6.cd90 ± 7a38
III-02/2241 ± 12bc59 ± 14b30
KV-2/933 ± 14bc67 ± 10ab19
III-7/1567 ± 14ab33 ± 13bc27
KV-1/1056 ± 16b44 ± 12bc16
KII-1/2950 ± 12b50 ± 18b26
VIII-3/4544 ± 17bc56 ± 14b18
V-7/960 ± 14ab40 ± 5b20
XII-17/264 ± 13ab36 ± 8bc25
XII-9/327 ± 14bc73 ± 6ab27
VII-6/7273 ± 12ab27 ± 20bc15
KIV-1/6463 ± 14ab37 ± 15bc16
Mean45 ± 12 55 ± 11
Values followed by different letters were significantly different at p ≤ 0.05 using Tukey’s mean separation test. N, number of shoots used for each treatment. Medium 523 is a general medium for the growth of bacteria [61].
Table 4. Influence of the composition of the nutrient medium on the multiplication rate of in vitro grapevines DV-10/11 and KV-2/35.
Table 4. Influence of the composition of the nutrient medium on the multiplication rate of in vitro grapevines DV-10/11 and KV-2/35.
Culture MediaDV-10/11KV-2/35
Number of ShootsMultiplication RateNumber of ShootsMultiplication
Rate
InitialRegeneratedInitialRegenerated
115503.3 ± 0.3bc15513.4 ± 0.2bc
215583.9 ± 0.3ab15583.9 ± 0.3ab
315533.5 ± 0.2bc15543.6 ± 0.3b
415543.6 ± 0.3b15533.5 ± 0.3bc
515453.0 ± 0.2c15473.1 ± 0.2c
615392.6 ± 0.4dc15302.0 ± 0.4d
715664.4 ± 0.3a15624.1 ± 0.3a
815604.0 ± 0.1ab15593.9 ± 0.1ab
915573.8 ± 0.1ab15573.8 ± 0.1ab
1015573.8 ± 0.2ab15583.9 ± 0.2ab
Mean15543.6 ± 0.3 15533.5 ± 0.2
Data represent mean ± SE. Values followed by different letters within each section were significantly different at p ≤ 0.05 using Tukey’s mean separation test.
Table 5. Presence of Rpv3- and Rpv12-mediated resistance to Plasmopara viticola in 17 grapevine accessions of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture.
Table 5. Presence of Rpv3- and Rpv12-mediated resistance to Plasmopara viticola in 17 grapevine accessions of the Kazakh Scientific Research Institute of Fruit Growing and Viticulture.
Plant AccessionResistance Loci (Associated Markers)
Rpv3 (UDV-737)Rpv3 (UDV-305)Rpv12 (UDV-343)
KV-2/9 +
DV-10/11+ +
IV-6/9 +
KII-1/29+ +
KVI-1/10+ +
XII-17/2+ +
VII-6/72 +
VII-3/15 +
XII-9/3+
XI-14/9 +
III-7/15 +
III-02/22+++
V-7/9+ +
XI-13/90+ +
KIY-1/64 +
KV-2/35
IV-4/74+
Rpv3 and Rpv12— Plasmopara viticola resistance loci; UDV-737, UDV-305—microsatellite markers closely related to the resistance loci Rpv3; UDV-343—microsatellite marker closely related to the resistance loci Rpv12. + presence of resistance allele.
Table 6. List of grapevine accessions derived from crosses between North American, European, and Asian grapevines.
Table 6. List of grapevine accessions derived from crosses between North American, European, and Asian grapevines.
Breed
Product		Female ParentMale Parent
NameSpeciesNameSpecies
KV-2/9Nimrang MagarachaHybrid of Vitis berlandieri, V. rupestris and V. viniferaCardinalV. vinifera
DV-10/11Madeleine AngevineV. viniferaTaifi rozovyyV. vinifera
IV-6/9Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaMuscat AlmatinskiyV. vinifera
KII-1/29Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaCardinalV. vinifera
KVI-1/10Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaCardinalV. vinifera
XII-17/2Donskoy SkorospelyyHybrid of V. vinifera and V. amurensisPobedaV. vinifera
VII-6/72Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaZolotistyy ranniy (Irsai Oliver)V. vinifera
VII-3/15Muscat fleur d‘OrangeV. vinifera linné subsp. Sativa (De Candolle) HegiDetskiy ranniyV. vinifera
XII-9/3Madeleine AngevineV. viniferaPobedaV. vinifera
XI-14/9Madeleine AngevineV. viniferaPobedaV. vinifera
III-7/15 I-4|58V. viniferaGolden Chasselas + RieslingV. vinifera
III-02/22Donskoy SkorospelyyHybrid of V. vinifera and V. amurensisKönigin der weingartenV. vinifera subsp. vinifera
V-7/9No154V. viniferaMuscat AleksandriyskiyV. vinifera
XI-13/90Madeleine AngevineV. viniferaTarnauV. vinifera
KIY-1/64Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaCardinalV. vinifera
KV-2/35Nimrang MagarachaHybrid of V. berlandieri, V. rupestris and V. viniferaCardinalV. vinifera
IV-4/74PobedaV. viniferaZhemchug SaboV. vinifera
Table 7. Composition and concentration of phytohormones, Plant Preservative MixtureTM, and pH of the nutrient medium during the multiplication of grapevine hybrids.
Table 7. Composition and concentration of phytohormones, Plant Preservative MixtureTM, and pH of the nutrient medium during the multiplication of grapevine hybrids.
Culture MediaBAPIBAGATDZPPMTMpH
mg L−1% (v/v)
110.10.5--5.7
210.10.1--5.3
30.50.10.1--5.7
40.50.11--5.7
50.50.10.1--5.3
60.50.10.1-0.25.7
710.10.1--5.7
810.10.11-5.7
90.80.10.1--5.7
100.80.10.11-5.7
BAP, 6-benzylaminopurine; IBA, indolyl butyric acid; GA, gibberellic acid; pH, potential of hydrogen; PPMTM, Plant Preservative MixtureTM (Plant Cell Technology, Washington, DC, USA) [111]; TDZ, thidiazuron. All chemicals were supplied by SPF Mediland (Almaty, Kazakhstan), unless otherwise specified.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Romadanova, N.V.; Aralbayeva, M.M.; Zemtsova, A.S.; Alexandrova, A.M.; Kazybayeva, S.Z.; Mikhailenko, N.V.; Kushnarenko, S.V.; Bettoni, J.C. In Vitro Collection for the Safe Storage of Grapevine Hybrids and Identification of the Presence of Plasmopara viticola Resistance Genes. Plants 2024, 13, 1089. https://doi.org/10.3390/plants13081089

AMA Style

Romadanova NV, Aralbayeva MM, Zemtsova AS, Alexandrova AM, Kazybayeva SZ, Mikhailenko NV, Kushnarenko SV, Bettoni JC. In Vitro Collection for the Safe Storage of Grapevine Hybrids and Identification of the Presence of Plasmopara viticola Resistance Genes. Plants. 2024; 13(8):1089. https://doi.org/10.3390/plants13081089

Chicago/Turabian Style

Romadanova, Natalya V., Moldir M. Aralbayeva, Alina S. Zemtsova, Alyona M. Alexandrova, Saule Zh. Kazybayeva, Natalya V. Mikhailenko, Svetlana V. Kushnarenko, and Jean Carlos Bettoni. 2024. "In Vitro Collection for the Safe Storage of Grapevine Hybrids and Identification of the Presence of Plasmopara viticola Resistance Genes" Plants 13, no. 8: 1089. https://doi.org/10.3390/plants13081089

APA Style

Romadanova, N. V., Aralbayeva, M. M., Zemtsova, A. S., Alexandrova, A. M., Kazybayeva, S. Z., Mikhailenko, N. V., Kushnarenko, S. V., & Bettoni, J. C. (2024). In Vitro Collection for the Safe Storage of Grapevine Hybrids and Identification of the Presence of Plasmopara viticola Resistance Genes. Plants, 13(8), 1089. https://doi.org/10.3390/plants13081089

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop