Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus (Citrus sinensis) Trees
Abstract
:1. Introduction
2. Results
2.1. Field Experiment
2.2. Greenhouse Experiment
3. Discussion
4. Materials and Methods
4.1. Field Experiment
4.1.1. Plant Material, Experimental Design, and Treatments
4.1.2. Candidatus Liberibacter Asiaticus (CLas) Detection
4.1.3. CRM and ACP Samplings
4.2. Greenhouse Experiment
4.2.1. Plants and Insects
4.2.2. Diaphorina Citri Performance on HBr-Treated Plants
4.2.3. RNA Extraction and qRT PCR Analysis of Gene Expression
4.3. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Urbaneja, A.; Grout, T.G.; Gravena, S.; Wu, F.; Cen, Y.; Stansly, P.A. Citrus Pests in a Global World. In The Genus Citrus; Elsevier: Amsterdam, The Netherlands, 2020; pp. 333–348. [Google Scholar] [CrossRef]
- Ferrarezi, R.S.; Vincent, C.I.; Urbaneja, A.; Machado, M.A. Editorial: Unravelling Citrus Huanglongbing Disease. Front. Plant Sci. 2020, 11, 609655. [Google Scholar] [CrossRef]
- Bové, J.M. Huanglongbing: A Destructive Newly Emerging, Century-Old Disease of Citrus. J. Plant Pathol. 2006, 88, 7–37. Available online: https://www.jstor.org/stable/41998278 (accessed on 4 April 2024).
- Gottwald, T.R. Current Epidemiological Understanding of Citrus Huanglongbing. Annu. Rev. Phytopathol. 2010, 48, 119–139. [Google Scholar] [CrossRef]
- Hall, D.G.; Richardson, M.L.; Ammar, E.; Halbert, S.E. Asian Citrus Psyllid, Diaphorina citri, Vector of Citrus Huanglongbing Disease. Entomol. Exp. Appl. 2013, 146, 207–223. [Google Scholar] [CrossRef]
- Graham, J.; Gottwald, T.; Setamou, M. Status of Huanglongbing (HLB) Outbreaks in Florida, California and Texas. Trop. Plant Pathol. 2020, 45, 265–278. [Google Scholar] [CrossRef]
- Graham, J.; Morgan, K. Why Bicarbonates Matter for HLB Management. Citrus Ind. 2017, 98, 16–21. Available online: https://crec.ifas.ufl.edu/media/crecifasufledu/extension/extension-publications/2017/2017_April_bicarbonates.pdf (accessed on 4 April 2024).
- Pustika, A.B.; Subandiyah, S.; Holford, P.; Beattie, G.A.C.; Iwanami, T.; Masaoka, Y. Interactions between Plant Nutrition and Symptom Expression in Mandarin Trees Infected with the Disease Huanglongbing. Australas. Plant Dis. Notes 2008, 3, 112–115. [Google Scholar] [CrossRef]
- Etxeberria, E.; Gonzalez, P.; Achor, D.; Albrigo, G. Anatomical Distribution of Abnormally High Levels of Starch in HLB-Affected Valencia Orange Trees. Physiol. Mol. Plant Pathol. 2009, 74, 76–83. [Google Scholar] [CrossRef]
- Tang, L.; Chhajed, S.; Vashisth, T. Preharvest Fruit Drop in Huanglongbing-Affected ‘Valencia’ Sweet Orange. J. Am. Soc. Hort. Sci. 2019, 144, 107–117. [Google Scholar] [CrossRef]
- Rogers, M.E.; Stansly, P.A.; Stelinski, L.L. 2012 Florida Citrus Pest Management Guide: Asian Citrus Psyllid and Citrus Leafminer Asian Citrus Psyllid Psyllid Management; Entomology and Nematology Department, Florida Cooperative Extension Service: Gainesville, FL, USA, 2012. [Google Scholar]
- Hall, D.G.; Albrecht, U.; Bowman, K.D. Transmission Rates of ‘ Ca. Liberibacter Asiaticus’ by Asian Citrus Psyllid Are Enhanced by the Presence and Developmental Stage of Citrus Flush. J. Econ. Entomol. 2016, 109, 558–563. [Google Scholar] [CrossRef]
- Canales, E.; Coll, Y.; Hernández, I.; Portieles, R.; Rodríguez García, M.; López, Y.; Aranguren, M.; Alonso, E.; Delgado, R.; Luis, M.; et al. ‘Candidatus Liberibacter Asiaticus’, Causal Agent of Citrus Huanglongbing, Is Reduced by Treatment with Brassinosteroids. PLoS ONE 2016, 11, e0146223. [Google Scholar] [CrossRef]
- Sirhindi, G.; Kumar, S.; Bhardwaj, R.; Kumar, M. Effects of 24-Epibrassinolide and 28-Homobrassinolide on the Growth and Antioxidant Enzyme Activities in the Seedlings of Brassica juncea L. Physiol. Mol. Biol. Plants 2009, 15, 335–341. [Google Scholar] [CrossRef]
- Choudhary, S.P.; Yu, J.-Q.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.-S.P. Benefits of Brassinosteroid Crosstalk. Trends Plant. Sci. 2012, 17, 594–605. [Google Scholar] [CrossRef]
- Yu, M.-H.; Zhao, Z.-Z.; He, J.-X. Brassinosteroid Signaling in Plant–Microbe Interactions. Int. J. Mol. Sci. 2018, 19, 4091. [Google Scholar] [CrossRef]
- Bürger, M.; Chory, J. Stressed Out About Hormones: How Plants Orchestrate Immunity. Cell Host Microbe 2019, 26, 163–172. [Google Scholar] [CrossRef]
- De Bruyne, L.; Höfte, M.; De Vleesschauwer, D. Connecting Growth and Defense: The Emerging Roles of Brassinosteroids and Gibberellins in Plant Innate Immunity. Mol. Plant 2014, 7, 943–959. [Google Scholar] [CrossRef]
- Khripach, V. Twenty Years of Brassinosteroids: Steroidal Plant Hormones Warrant Better Crops for the XXI Century. Ann. Bot. 2000, 86, 441–447. [Google Scholar] [CrossRef]
- Wang, Z.-Y. Brassinosteroids Modulate Plant Immunity at Multiple Levels. Proc. Natl. Acad. Sci. USA 2012, 109, 7–8. [Google Scholar] [CrossRef]
- Ali, S.S.; Kumar, G.B.S.; Khan, M.; Doohan, F.M. Brassinosteroid Enhances Resistance to Fusarium Diseases of Barley. Phytopathology 2013, 103, 1260–1267. [Google Scholar] [CrossRef]
- Kim, Y.-W.; Youn, J.-H.; Roh, J.; Kim, J.-M.; Kim, S.-K.; Kim, T.-W. Brassinosteroids Enhance Salicylic Acid-Mediated Immune Responses by Inhibiting BIN2 Phosphorylation of Clade I TGA Transcription Factors in Arabidopsis. Mol. Plant 2022, 15, 991–1007. [Google Scholar] [CrossRef]
- Pan, G.; Liu, Y.; Ji, L.; Zhang, X.; He, J.; Huang, J.; Qiu, Z.; Liu, D.; Sun, Z.; Xu, T.; et al. Brassinosteroids Mediate Susceptibility to Brown Planthopper by Integrating with the Salicylic Acid and Jasmonic Acid Pathways in Rice. J. Exp. Bot. 2018, 69, 4433–4442. [Google Scholar] [CrossRef]
- Alférez, F.; Vincent, C.; Vashisth, T. Update on Brassinosteroids for HLB Management. Citrus Industry Magazine, 19 June 2019; pp. 16–18. [Google Scholar]
- Yao, T.; Xie, R.; Zhou, C.; Wu, X.; Li, D. Roles of Brossinosteroids Signaling in Biotic and Abiotic Stresses. J. Agric. Food Chem. 2023, 71, 7947–7960. [Google Scholar] [CrossRef]
- Rashidi, H.; Amiri, J.; Shirzad, H. Effect of Postharvest Treatment with 24-Epibrassinolide and Fennel (Foeniculum vulgare) Essential Oil on Quality Attributes and Storage Life of Orange (Citrus sinensis Cv. ‘Valencia’). Erwerbs-Obstbau 2023, 65, 927–939. [Google Scholar] [CrossRef]
- Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [Google Scholar] [CrossRef]
- Ibanez, F.; Suh, J.H.; Wang, Y.; Stelinski, L.L. Long-Term, Sustained Feeding by Asian Citrus Psyllid Disrupts Salicylic Acid Homeostasis in Sweet Orange. BMC Plant Biol. 2019, 19, 493. [Google Scholar] [CrossRef]
- Wu, Q.; Moniruzzaman, M.; Yan, H.; Lv, Y.; Jiang, B.; Jiang, N.; Zhong, Y. The CsNPR1 Gene Expression Modulation in Citrus and Understanding the Defense Mechanism against Huanglongbing by Screening CsNPR1-Interacting Proteins. Sci. Hortic. 2021, 288, 110375. [Google Scholar] [CrossRef]
- Zhang, S.; Wang, X.; He, J.; Zhang, S.; Zhao, T.; Fu, S.; Zhou, C. A Sec-Dependent Effector, CLIBASIA_04425, Contributes to Virulence in ‘Candidatus Liberibater Asiaticus’. Front. Plant Sci. 2023, 14, 1224736. [Google Scholar] [CrossRef]
- Peng, A.; Zou, X.; He, Y.; Chen, S.; Liu, X.; Zhang, J.; Zhang, Q.; Xie, Z.; Long, J.; Zhao, X. Overexpressing a NPR1-like Gene from Citrus paradisi Enhanced Huanglongbing Resistance in C. sinensis. Plant Cell Rep. 2021, 40, 529–541. [Google Scholar] [CrossRef]
- Ma, W.; Pang, Z.; Huang, X.; Xu, J.; Pandey, S.S.; Li, J.; Achor, D.S.; Vasconcelos, F.N.C.; Hendrich, C.; Huang, Y.; et al. Citrus Huanglongbing Is a Pathogen-Triggered Immune Disease that Can Be Mitigated with Antioxidants and Gibberellin. Nat. Commun. 2022, 13, 529. [Google Scholar] [CrossRef]
- Robertson, C.J.; Zhang, X.; Gowda, S.; Orbović, V.; Dawson, W.O.; Mou, Z. Overexpression of the Arabidopsis NPR1 Protein in Citrus Confers Tolerance to Huanglongbing. J. Citrus Pathol. 2018, 5, 1–8. [Google Scholar] [CrossRef]
- Sarkar, P.; El-Mohtar, C.; Turner, D.; Welker, S.; Robertson, C.J.; Orbovic, V.; Mou, Z.; Levy, A. NONEXPRESSOR OF PATHOGENESIS-RELATED GENES Control Huanglongbing Tolerance by Regulating Immune Balance in Citrus Plants. bioRxiv 2024. [Google Scholar] [CrossRef]
- Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef]
- Erb, M.; Reymond, P. Molecular Interactions Between Plants and Insect Herbivores. Annu. Rev. Plant Biol. 2019, 70, 527–557. [Google Scholar] [CrossRef]
- van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of Inducible Defense-Related Proteins in Infected Plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Thaler, J.S.; Farag, M.A.; Paré, P.W.; Dicke, M. Jasmonate-Deficient Plants Have Reduced Direct and Indirect Defences against Herbivores. Ecol. Lett. 2002, 5, 764–774. [Google Scholar] [CrossRef]
- Dicke, M.; Gols, R.; Ludeking, D.; Posthumus, M.A. Jasmonic Acid and Herbivory Differentially Induce Carnivore-Attracting Plant Volatiles in Lima Bean Plants. J. Chem. Ecol. 1999, 25, 1907–1922. [Google Scholar] [CrossRef]
- Pérez-Hedo, M.; Arias-Sanguino, Á.M.; Urbaneja, A. Induced Tomato Plant Resistance against Tetranychus urticae Triggered by the Phytophagy of Nesidiocoris tenuis. Front. Plant Sci. 2018, 9, 1419. [Google Scholar] [CrossRef]
- Cruz-Miralles, J.; Cabedo-López, M.; Guzzo, M.; Pérez-Hedo, M.; Flors, V.; Jaques, J.A. Plant Defense Responses Triggered by Phytoseiid Predatory Mites (Mesostigmata: Phytoseiidae) Are Species-Specific, Depend on Plant Genotype and May Not Be Related to Direct Plant Feeding. BioControl 2021, 66, 381–394. [Google Scholar] [CrossRef]
- Cabedo-López, M.; Cruz-Miralles, J.; Vacas, S.; Navarro-Llopis, V.; Pérez-Hedo, M.; Flors, V.; Jaques, J.A. The Olfactive Responses of Tetranychus urticae Natural Enemies in Citrus Depend on Plant Genotype, Prey Presence, and Their Diet Specialization. J. Pest Sci. 2019, 92, 1165–1177. [Google Scholar] [CrossRef]
- Dahmane, M.; Urbaneja, A.; Ruíz-Rivero, O.; Alonso-Valiente, M.; Pérez-Hedo, M. The Zoophytophagous Predator Pilophorus clavatus (Hemiptera: Miridae) Induces Plant Defences in Citrus. J. Pest Sci. 2022, 95, 1519–1530. [Google Scholar] [CrossRef]
- Pappas, M.L.; Steppuhn, A.; Geuss, D.; Topalidou, N.; Zografou, A.; Sabelis, M.W.; Broufas, G.D. Beyond Predation: The Zoophytophagous Predator Macrolophus pygmaeus Induces Tomato Resistance against Spider Mites. PLoS ONE 2015, 10, e0127251. [Google Scholar] [CrossRef]
- Santamaria, M.E.; Cambra, I.; Martinez, M.; Pozancos, C.; González-Melendi, P.; Grbic, V.; Castañera, P.; Ortego, F.; Diaz, I. Gene Pyramiding of Peptidase Inhibitors Enhances Plant Resistance to the Spider Mite Tetranychus urticae. PLoS ONE 2012, 7, e43011. [Google Scholar] [CrossRef]
- Huang, C.-Y.; Araujo, K.; Sánchez, J.N.; Kund, G.; Trumble, J.; Roper, C.; Godfrey, K.E.; Jin, H. A Stable Antimicrobial Peptide with Dual Functions of Treating and Preventing Citrus Huanglongbing. Proc. Natl. Acad. Sci. USA 2021, 118, e2019628118. [Google Scholar] [CrossRef]
- Alferez, F.; Albrecht, U.; Gaire, S.; Batuman, O.; Qureshi, J.; Zekri, M. Individual Protective Covers (IPCs) for Young Tree Protection from the HLB Vector, the Asian Citrus Psyllid. EDIS 2021, 2021, HS1425. [Google Scholar] [CrossRef]
- Gaire, S.; Albrecht, U.; Batuman, O.; Qureshi, J.; Zekri, M.; Alferez, F. Individual Protective Covers (IPCs) to Prevent Asian Citrus Psyllid and Candidatus Liberibacter Asiaticus from Establishing in Newly Planted Citrus Trees. Crop Prot. 2022, 152, 105862. [Google Scholar] [CrossRef]
- Li, W.; Hartung, J.S.; Levy, L. Quantitative Real-Time PCR for Detection and Identification of Candidatus Liberibacter Species Associated with Citrus Huanglongbing. J. Microbiol. Methods 2006, 66, 104–115. [Google Scholar] [CrossRef]
- McCoy, C.W.; Albrigo, L.G. Feeding Injury to the Orange Caused by the Citrus Rust Mite, Phyllocoptruta oleivora (Prostigmata: Eriophyoidea). Ann. Entomol. Soc. Am. 1975, 68, 289–297. [Google Scholar] [CrossRef]
- Monzo, C.; Arevalo, H.A.; Jones, M.M.; Vanaclocha, P.; Croxton, S.D.; Qureshi, J.A.; Stansly, P.A. Sampling Methods for Detection and Monitoring of the Asian Citrus Psyllid (Hemiptera: Psyllidae). Environ. Entomol. 2015, 44, 780–788. [Google Scholar] [CrossRef]
- Grafton-Cardwell, E.E.; Stelinski, L.L.; Stansly, P.A. Biology and Management of Asian Citrus Psyllid, Vector of the Huanglongbing Pathogens. Annu. Rev. Entomol. 2013, 58, 413–432. [Google Scholar] [CrossRef]
Mortality | Control Plants | HBr-Treated Plants | Statistics |
---|---|---|---|
Egg | 49.9 ± 16.3 | 65.0 ± 10.2 | t1,7 = 0.817; p = 0.441 |
Nymphal | 35.9 ± 18.2 | 68.6 ± 11.2 | t1,7 = 1.600; p = 0.158 |
Egg–adult | 76.6 ± 5.33 | 85.7 ± 6.8 | t1,7 = 1.008; p = 0.347 |
Gene | Gene Name | Citrus ID | Primer Sequence (5’→3’) |
---|---|---|---|
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | LOC102624117 | FW: GGAAGGTCAAGATCGGAATCAA |
RV: CGTCCCTCTGCAAGATGACTCT | |||
PAL | Phenylalanine ammonia-lyase-like | LOC102620464 | FW: CACATTCTTGGTAGCGCTTTG |
RV: AGCTACTTGGCTGACAGTATTC | |||
ICS | Isochorismate synthase 2, chloroplastic | LOC102630235 | FW: GGAGGAGGAGAGAGTGAATTTG |
RV: GGGTTGCTTCCTTCTACTATCC | |||
NPR1 | BTB/POZ domain and ankyrin repeat-containing protein | LOC102617188 | FW: GTACCTTGAAAACAGAGTTGGACTGG |
RV: TGCTCCTCTTGCATTTTGAAAGGTG | |||
MYC2 | Transcription factor MYC2 | LOC102626457 | FW: TGCATCTACAGCCGACCC |
RV: TAGGTCCAGCCCTCACGA | |||
LOX2 | Linoleate 13S-lipoxygenase 2-1, chloroplastic-like | LOC102629656 | FW: GAACCATATTGCCACTTTCG |
RV: CGTCATCAATGACTTGACCA | |||
AOS | Allene oxide synthase | AY243478 | FW: AGATCTTATTCCCGAACATGGT |
RV: CGGACTTCATCAACGGCAT | |||
JAR1 | Jasmonate resistant 1 | LOC102611440 | FW: AAGGCGATGCAGTCACAATG |
RV: TGGTGGAAATCAGGACCAAAG | |||
SAMP | Response A/B barrel domain-containing protein HS1 | LOC102628374 | FW: AACAGGGGCAAGAATGTGAGCAT |
RV: ACACGTACTGTTGTCGGTTTGTAGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Hedo, M.; Urbaneja, A.; Alférez, F. Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus (Citrus sinensis) Trees. Plants 2024, 13, 1229. https://doi.org/10.3390/plants13091229
Pérez-Hedo M, Urbaneja A, Alférez F. Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus (Citrus sinensis) Trees. Plants. 2024; 13(9):1229. https://doi.org/10.3390/plants13091229
Chicago/Turabian StylePérez-Hedo, Meritxell, Alberto Urbaneja, and Fernando Alférez. 2024. "Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus (Citrus sinensis) Trees" Plants 13, no. 9: 1229. https://doi.org/10.3390/plants13091229
APA StylePérez-Hedo, M., Urbaneja, A., & Alférez, F. (2024). Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus (Citrus sinensis) Trees. Plants, 13(9), 1229. https://doi.org/10.3390/plants13091229