Next Article in Journal
Identification of Common Angiogenesis Marker Genes in Chronic Lung Diseases and Their Relationship with Immune Infiltration Based on Bioinformatics Approaches
Previous Article in Journal
The Interplay of Nutrition, the Gut Microbiota and Immunity and Its Contribution to Human Disease
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 13
Issue 2
10.3390/biomedicines13020328
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

HIF-1α Promotes Luteinization via NDRG1 Induction in the Human Ovary

by
Akemi Nishigaki
1,
Mitsuaki Ishida
2,*,
Hiroaki Tsubokura
1,
Yoji Hisamatsu
1,
Yoshinobu Hirose
2 and
Hidetaka Okada
1
1
Department of Obstetrics and Gynecology, Kansai Medical University, Hirakata 573-1191, Osaka, Japan
2
Department of Pathology, Osaka Medical and Pharmaceutical University, Takatsuki 569-8686, Osaka, Japan
*
Author to whom correspondence should be addressed.
Biomedicines 2025, 13(2), 328; https://doi.org/10.3390/biomedicines13020328
Submission received: 9 December 2024 / Revised: 22 January 2025 / Accepted: 28 January 2025 / Published: 31 January 2025
(This article belongs to the Section Cell Biology and Pathology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Background/Objectives: Hypoxia-inducible factor-1α (HIF-1α) is a transcription factor that plays a crucial role in various physiological and pathological processes of the ovary. However, the timing of HIF-1α expression and its specific biological function in the follicular development of the human ovary remain unclear. Therefore, in this study, we aimed to examine whether HIF-1α and its downstream gene, N-myc downstream-regulated gene 1 (NDRG1), exhibit stage-specific expression during the follicular development process in the human ovary. Methods: We used ovarian tissues from eight women with regular menstrual cycles who were not undergoing hormonal treatment. We investigated HIF-1α and NDRG1 expression and localization using immunohistochemistry. Further, we transfected human ovarian granulosa (KGN) cells with HIF-1α small interfering RNA (siRNA) to investigate the influence of HIF-1α on NDRG1 expression and progesterone synthesis. Results: The immunohistochemical analysis of human ovarian tissues revealed that HIF-1α was localized in the cytoplasm of granulosa cells (GCs) at both the primary and secondary follicular stages. Conversely, in tertiary and later developmental stages, HIF-1α was observed exclusively in the nucleus of GCs. Furthermore, while NDRG1 was not detected in primary follicles, it was present in all GCs beyond the tertiary stage. Notably, transfection of KGN cells with HIF-1α siRNA significantly decreased NDRG1 expression, at both the mRNA and protein levels, and in progesterone synthesis. Conclusion: Our results indicate that HIF-1α and NDRG1 are integral to follicular development and the early luteinization of pre-ovulatory follicles.

1. Introduction

During the process of follicular growth, the follicle undergoes various structural changes, including alterations in the vascular system, cell differentiation, and proliferation, along with the development of a fluid-filled antrum [1]. Collectively, these transformations establish a hypoxic environment within the follicle, where the oocyte develops under low-oxygen conditions [2,3]. Hypoxia-inducible factor-1α (HIF-1α) is the main mediator of cellular response to hypoxia, which acts as an oxygen-regulated transcriptional activator [4]. HIF-1α is an essential regulator in the development of various physiological systems and plays a crucial role in maintaining tissue homeostasis, because it influences cell survival and adaptation, immune responses, cytokine secretion, anaerobic metabolism, and angiogenesis [5,6,7,8,9]. The HIF-1α protein stabilizes under hypoxic conditions and is translocated from the cytoplasm to the nucleus [10], where it forms a dimer with HIF-1β [11]. This heterodimer then binds to hypoxia response elements in the promoters of target genes, activating the transcription of HIF-regulated genes involved in numerous physiological processes [4,11,12].
HIF-1α has been identified in the granulosa cells (GCs) of various species such as humans, monkeys, pigs, rats, mice, and cows [13,14,15,16,17,18]. Recent research has highlighted HIF-1α as a significant regulator of gene expression within ovarian compartments, contributing to physiological follicle development. For example, Zhang et al. reported that HIF-1α expression is decreased in atretic follicles compared to mature healthy antral follicles of pigs [19]. HIF-1α is also essential for ovulation as inhibiting its function leads to anovulation in mice [18]. Additionally, HIF-1α is a key regulator of vascular endothelial growth factor A expression, which is important for angiogenesis and luteal formation [3,20]. Collectively, substantial evidence is available, which suggests that HIF-1α regulates various genes in GCs and is involved in the development and differentiation of ovarian follicles in mammals. However, the expression and functions of HIF-1α during human ovarian development remain incompletely understood.
N-myc downstream-regulated gene 1 (NDRG1) plays important roles in various biological processes such as angiogenesis, cell proliferation, differentiation, apoptosis, as well as tumor progression and metastasis in response to various stress signals such as hypoxia, oxidative stress, and hormones [21,22,23,24,25,26,27]. Additionally, its expression is notably increased by several transcription factors linked to hypoxia, particularly HIF-1α, under low-oxygen conditions, in various types of tissues [28,29,30]. NDRG1 is mainly located in the cytoplasm and is widely distributed across different tissues [21,31]. In the human ovary, NDRG1 expression has been detected in oocytes, GCs, theca-interstitial cells, and the corpus luteum [28]. Notably, our previous study has shown that reducing NDRG1 levels leads to the decreased mRNA expression of steroidogenic acute regulator protein (StAR) and CYP11A1 (p450scc), as well as a reduction in P4 production, which suggests that NDRG1 is involved in progesterone synthesis in human GCs [28].
Given the diverse functions of HIF-1α, we hypothesized that it is involved in the development of the ovarian follicles in humans and that its localization varies throughout the different phases of the follicular cycle. Therefore, in this study, we aimed to clarify the localization of the HIF-1α protein at various stages of human ovarian follicle development. Additionally, we examined how HIF-1α affects the expression of its downstream gene NDRG1 and the production of P4 in GCs. Exploring the functions of HIF-1α in the human ovary could enhance our understanding of follicle development and luteinization.

2. Materials and Methods

2.1. Patient Selection

The ovarian tissues utilized in this research were collected from eight women (ages 32–39) with regular menstrual cycles, who were not undergoing hormonal treatment for uterine cancer, at Kansai Medical University Hospital between January and December 2021. Formalin-fixed and paraffin-embedded whole ovarian tissues were used for immunohistochemical analysis. All human samples were obtained with written informed consent from each participant, in accordance with the Declaration of Helsinki. This study received approval from the Ethics Review Board of Kansai Medical University, Osaka, Japan (project approval number 2008105).

2.2. Immunohistochemistry for HIF-1α and NDRG1

We evaluated the developmental stages of follicles (i.e., primary, secondary, and tertiary follicles, and corpus luteum) in the ovarian tissues because they contain follicles at various developmental stages. HIF-1α and NDRG1 protein expression was examined at each follicular developmental stage. Immunohistochemical analysis was performed using an auto-stainer (Discovery ULTRA System; Roche Diagnostics, Basel, Switzerland; Leica BOND-III; Leica Biosystems GmbH, Nussloch, Germany) according to the manufacturer’s instructions. A primary rabbit polyclonal antibody was used to detect HIF-1α (1:200; cat. no. ab51608; Abcam, Cambridge, UK) and NDRG1 (1:75; Cell Signaling Technology, Danvers, MA, USA). Antigen retrieval was performed by autoclaving tissue sections at 100 °C for 16 min in a Tris-based buffer (pH 8.5; Cell Conditioning Solution CC1; Ventana Medical Systems, Oro Valley, AZ, USA). Thereafter, automated protocol steps for immunostaining were followed, using 3,3′-diaminobenzidine (DAB) as a colorimetric agent.

2.3. Cell Culture

The KGN cell line (RCB1154) was acquired from the RIKEN Cell Bank of Japan (Tsukuba, Japan) and was cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F-12 supplemented with 10% fetal calf serum (FCS; HyClone, Logan, UT, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) in an atmosphere of 5% CO2 at 37 °C. Luteinized GCs were prepared by incubating KGN cells with 10 µM forskolin (Selleckchem, Huston, TX, USA), which strongly increases cAMP and stimulates steroid synthesis by mimicking the action of gonadotropins. All experiments were performed at least in triplicate with cell preparations each time.

2.4. HIF-1α Silencing with Small Interfering RNA (siRNA)

The silencing of HIF-1α expression was achieved using siRNA preparations directed against distinct regions of the gene sequence (Human Stealth Select RNAi; Life Technologies, Carlsbad, CA, USA). Stealth siRNA targeting HIF-1α (Catalog numbers: HSS104775 and HSS104774) as well as a non-silencing RNA negative control (Catalog number: 12935300 Human Stealth Select RNAi™) were used. The cells were allowed to grow until they reached approximately 30% confluency in DMEM/F12 medium supplemented with 10% FCS, as determined by optimizing the experimental conditions. Subsequently, they were transfected with each siRNA (10 nmol/L) using Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s guidelines for 72 h. KGN cells were transfected with or without 10 μM forskolin in DMEM/F12 supplemented with 10% dextran-coated stripped FCS for progesterone measurements.

2.5. RNA Extraction and Quantitative Reverse-Transcription PCR (RT-PCR)

Total RNA was extracted from cultured KGN cells using an RNeasy Minikit (Qiagen GmbH, Hilden, Germany). cDNA was synthesized from 1 µg of RNA using ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Quantitative RT-PCR was conducted using Rotor-Gene Q HRM (Qiagen GmbH, Hilden, Germany) along with a quantitative PCR mix kit (THUNDERBIRD SYBR qPCR Mix; Toyobo, Osaka, Japan), following a previously established protocol [32]. The Ct method was used to calculate the relative mRNA expression. Ct values were standardized to Elongation factor-1α (EF-1α) as an internal control. The primer sequences used in quantitative RT-PCR are provided in Table 1.

2.6. Western Blot Analysis

Cultured cells were homogenized using lysis buffer containing RIPA buffer (Cell Signaling Technology, Danvers, MA, USA) and phenylmethanesulfonyl fluoride (Cell Signaling Technology, Danvers, MA, USA) to assess protein levels. The samples were then centrifuged at 14,000× g to collect the cell pellets. Protein concentrations were quantified using a Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). Equal amounts of lysates (20 μg/lane) were separated via electrophoresis on an Any kD™ Mini-PROTEAN® TGX™ Precast Protein Gel and were electro-transferred onto nitrocellulose membranes using a Trans-Blot Turbo device (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were blocked with 10% skim milk powder dissolved in Tris-buffered saline for 1 h to minimize nonspecific binding. The blots were then incubated overnight at 4 °C with the primary antibodies, including rabbit polyclonal NDRG1 antibody (1:1000; cat. no. #5196: Cell Signaling Technology, Danvers, MA, USA), rabbit monoclonal StAR antibody (1:1000; cat. no. #8449: Cell Signaling Technology, Danvers, MA, USA), rabbit monoclonal CYP11A1 (p450scc) antibody (1:1000; cat. no. #14217: Cell Signaling Technology, Danvers, MA, USA), or mouse monoclonal β-actin antibody (1:5000; cat. no. A5316: Sigma-Aldrich, St. Louis, MO, USA). Subsequently, the blots were probed with anti-rabbit immunoglobulin IgG (1:5000; GE Healthcare Life Sciences, Chicago, IL, USA) or anti-mouse IgG (1:10,000; GE Healthcare Life Sciences, Chicago, IL, USA) peroxidase-conjugated secondary antibodies. Enhanced chemiluminescence plus Western blotting detection agents (GE Healthcare Life Sciences, Chicago, Il, USA) were used to visualize immune complexes.

2.7. Measurement of Hormone Secretion

The concentration of P4 in cell culture medium was measured using commercially available ELISA Kits specific for progesterone (Cayman Chemical Co., Ann Arbor, MI, USA) according to the manufacturer’s instructions. Data are presented as the quantity of steroids secreted (pg/mL).

2.8. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Multiple comparisons were analyzed using one-way analysis of variance (ANOVA), followed by Dunnett’s or Tukey’s test for multiple comparisons. GraphPad Prism 8 was used to conduct statistical analyses (GraphPad Software, Inc., La Jolla, CA, USA). Statistical significance was set at p < 0.05.

3. Results

3.1. Localization of HIF-1α Protein Expression in the Human Follicles

We performed immunohistochemical analyses to determine the localization of HIF-1α protein expression within the human ovary (Figure 1). Table 2 shows the positive rates of HIF-1α protein at various ovarian follicular development stages. Immunohistochemical analysis of human ovarian tissue sections revealed positive HIF-1α staining in the GCs of ovarian follicles at various developmental stages. HIF-1α protein was detected in the cytoplasm of more than 70% of GCs in primary (Figure 1A) and secondary follicles (Figure 1B), whereas it was barely detectable in the nucleus of GCs. Conversely, in tertiary follicles, HIF-1α was predominantly localized in the nucleus of GCs, with no significant cytoplasmic staining observed, and its expression was reduced in the corpus luteum (Figure 1C,D).

3.2. Localization of NDRG1 Protein Expression in the Human Follicles

We performed immunohistochemical analyses to investigate the localization of NDRG1 protein expression in the human ovary (Figure 2). Table 3 shows the positive rates of the NDRG1 protein at various follicular developmental stages. NDRG1 expression was not observed in the nucleus at all stages of follicular development and was restricted to the cytoplasm of GCs. NDRG1 protein was also detected in the cytoplasm of theca-interstitial cells. NDRG1 protein expression was not detected in the cytoplasm of GCs in primary follicles (Figure 2A). In contrast, NDRG1 expression was observed in some secondary follicles (Figure 2B) and was present in all GCs at stages beyond tertiary follicles (Figure 2C,D). Thus, NDRG1 protein expression increased with follicular development.

3.3. Regulation of NDRG1 Expression by HIF-1α

We subsequently investigated the impact of HIF-1α on NDRG1 expression by transfecting KGN cells with HIF-1α siRNA to explore the interaction between these two proteins. We confirmed the efficiency of HIF-1α knockdown using quantitative RT-PCR, which revealed a significant reduction in HIF-1α mRNA levels 24 h after siRNA transfection (Figure 3A). After 72 h of HIF-1α siRNA transfection, KGN cells exhibited a significant decrease in the expression of NDRG1 both at the mRNA and protein levels (Figure 3B,C).

3.4. Effect of HIF-1α Silencing on Hormone Production

We further investigated the effect of siRNA-mediated knockdown of HIF-1α expression on hormone production to directly analyze the critical role of HIF-1α in hormone production. The addition of FSK significantly increased the expression of StAR, CYP11A1 (p450scc), and progesterone. After 72 h of HIF-1α siRNA transfection, KGN cells exhibited a notable decrease in StAR and CYP11A1 (p450scc) mRNA and protein levels (Figure 4A–C). Moreover, a notable reduction was observed in the release of P4 into the culture medium of these cells (Figure 4D).

4. Discussion

In this study, we demonstrated that HIF-1α is primarily expressed in the GCs of the human ovary, with its expression levels and patterns varying significantly across different developmental stages in humans. NDRG1 was expressed at a slightly later stage than HIF-1α and was detected in all GCs at stages beyond tertiary follicles. Furthermore, HIF-1α plays a role in the regulation of luteinization-related genes and P4 secretion, highlighting the importance of HIF-1α signaling in ovarian folliculogenesis and luteinization.
During the growth and maturation of ovarian follicles, the microenvironment within the follicles is characterized by hypoxic condition [1,3]. Specifically, oxygen levels in the follicular fluid of the human ovary decrease as folliculogenesis advances [2]. Notably, the ovarian follicle is adapted to function effectively under low-oxygen conditions. Cellular adaptations to low oxygen levels are primarily mediated by HIF-1α [4]. HIF-1α regulates the expression of various target genes and is vital for numerous biological processes, including ovarian functions [7,8,9,20,28,33,34]. Although the roles of HIF-1α in folliculogenesis have recently been investigated in various species [13,14,15,16,17,18,19], its expression in the human ovary has not been well characterized. Therefore, we investigated the expression and localization of HIF-1α protein in human ovaries at different phases of follicular development. We observed changes in HIF-1α immunolocalization across the ovarian cycle, suggesting its involvement in the follicular development. Specifically, we found that HIF-1α protein was localized in the cytoplasm of primary and secondary follicles. HIF-1α was weakly localized in the nucleus of primary and secondary follicles, whereas strong nuclear localization was observed in tertiary follicles. Consistent with our results, another study using mammalian cell lines has indicated that HIF-1α expression is mainly cytoplasmic under normoxic conditions, whereas it localizes to the nucleus under hypoxic conditions [10]. Consequently, the low-oxygen environment during follicular development is suggested to cause HIF-1α to translocate into the nucleus. Moreover, in our study, we observed that HIF-1α expression in the corpus luteum was decreased. Notably, HIF-1α expression decreases over time after ovulation in various species [14,15,16,35], and the changes in HIF-1α expression during follicular development suggest its critical role in follicular growth and maturation. In addition, we observed a lack of HIF-1α staining in some tertiary follicles, which corroborates the finding by Zhang et al., who demonstrated that HIF-1α expression was downregulated in atretic follicles compared to mature healthy antral follicles [19]. Overall, the absence of HIF-1α expression may indicate follicular terminal differentiation.
We previously showed that NDRG1 was expressed in human GCs and the corpus luteum [28]. However, to our knowledge, the expression patterns of NDRG1 and the relationship between NDRG1 and HIF-1α proteins expressions throughout ovarian stages have not been extensively studied in any species, including humans. Accordingly, in the present study, we utilized immunohistochemistry to analyze relative NDRG1 protein expression and noted differences between NDRG1 and HIF-1α expression at various stages of follicular development. Specifically, NDRG1 was not expressed in primary follicles but was expressed in some secondary follicles and highly expressed in tertiary follicles and the corpus luteum. NDRG1 was also expressed at a later stage than HIF-1α, which corresponds to the stage at which HIF translocates to the nucleus. Furthermore, we elucidated its role in follicular development in the ovary by knocking down HIF-1α expression. This knockdown resulted in the downregulation of NDRG1 expression at both the mRNA and protein levels. Our previous study demonstrated that echinomycin inhibits hypoxia-induced NDRG1 expression by specifically blocking the DNA-binding capability of HIF-1α through direct interaction with the hypoxia response element of its target gene [28]. This explains our observations of decreased NDRG1 expression in both normoxic and hypoxic environments following HIF-1α knockdown. Collectively, these observations suggest that HIF-1α is a key initiator of NDRG1 expression and that its signaling pathway plays a significant role in regulating NDRG1 expression in GCs.
In this study, the transfection of KGN cells with HIF-1α siRNA resulted in a significant decrease in the mRNA and protein levels of StAR and CYP11A1 (p450scc). StAR is responsible for transporting cholesterol from the outer to the inner mitochondrial membrane, while CYP11A1 (p450scc) catalyzes the reaction that converts cholesterol to pregnenolone, which represents an early and limiting step in steroid hormone synthesis [36]. Moreover, StAR is crucial for the synthesis of P4 and the development and maintenance of the corpus luteum in humans and other primates [37]. The expression of StAR in GCs indicates the early functional maturation of ovarian antral follicles [38]. Thus, our results are consistent with previous studies [17,20,34,39] that identified HIF-1α as a contributor to StAR expression. Overall, these results suggest that HIF-1α facilitates steroidogenesis and luteinization, which is the terminal differentiation process of GCs in the ovary. After ovulation, GCs undergo luteinization to form the corpus luteum and secrete P4, which is essential for establishing pregnancy [40,41]. In fact, our results highlight the role of HIF-1α in promoting luteinization, since silencing HIF-1α resulted in decreased P4 secretion. Therefore, these results provide strong evidence that HIF-1α plays a crucial role in promoting P4 production during luteinization in the human ovary. Nonetheless, additional in vivo studies are necessary for clarifying the specific functions of HIF-1α in folliculogenesis and luteinization. In our previous study, we explored the effect of NDRG1 in hormone production and demonstrated that NDRG1 is involved in P4 production but does not affect estrogen production. In addition, we found that NDRG1 knockdown results in a reduction in StAR and CYP11A1 (p450scc) mRNA expression [28]. In the present study, we showed that HIF-1α knockdown results in a decrease in both NDRG1 expression and P4 production. These findings indicate that HIF-1α plays a role in inducing NDRG1 expression and that NDRG1, in turn, regulates the expression of StAR and p450scc, facilitating P4 production. Consequently, our results imply that HIF is crucial for the regulation of NDRG1 expression in the ovary, with both HIF-1α and NDRG1 contributing to the luteinization process (Figure 5).
In summary, this study is the first to reveal significant changes in HIF-1α expression throughout the various developmental stages of the human ovary. This suggests that HIF-1α signaling is a key mechanism in regulating folliculogenesis in humans, although further exploration is required to fully understand the underlying mechanisms. However, the HIF-1α knockdown experiments conducted in this study were performed only under normoxic conditions. Therefore, future studies should investigate the effects of hypoxia on the HIF signaling pathway in the ovary. Such investigations may have implications for future infertility treatments and could yield new insights into ovarian physiology, including the processes of ovarian folliculogenesis.

Author Contributions

Conceptualization, A.N. and H.O.; investigation, A.N., H.O. and M.I.; formal analysis, A.N., M.I., H.T., Y.H. (Yoji Hisamatsu) and H.O.; data curation, A.N., M.I. and H.O.; writing—original draft preparation, A.N., M.I. and H.O; writing—review and editing, A.N., M.I., H.T., Y.H. (Yoji Hisamatsu), Y.H. (Yoshinobu Hirose) and H.O.; funding acquisition, H.O. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant from the Smoking Research Foundation (to H.O.).

Institutional Review Board Statement

This study was approved by the Ethics Review Board of Kansai Medical University, Osaka, Japan (project approval number 2008105).

Informed Consent Statement

Informed consent was obtained from all subjects involved in this study, in accordance with the Declaration of Helsinki.

Data Availability Statement

The original contributions presented in this study are included in this article. Further inquiries can be directed to the corresponding author(s).

Acknowledgments

We thank all the sample donors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Anashi, L.P.E. The Ovary; Academic Press: Cambridge, MA, USA, 2019. [Google Scholar]
  2. Fischer, B.; Künzel, W.; Kleinstein, J.; Gips, H. Oxygen tension in follicular fluid falls with follicle maturation. Eur. J. Obstet. Gynecol. Reprod. Biol. 1992, 43, 39–43. [Google Scholar] [CrossRef]
  3. Lim, M.; Thompson, J.G.; Dunning, K.R. HYPOXIA AND REPRODUCTIVE HEALTH: Hypoxia and ovarian function: Follicle development, ovulation, oocyte maturation. Reproduction 2021, 161, F33–F40. [Google Scholar] [CrossRef]
  4. Wang, G.L.; Jiang, B.H.; Rue, E.A.; Semenza, G.L. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA 1995, 92, 5510–5514. [Google Scholar] [CrossRef] [PubMed]
  5. Semenza, G.L. Regulation of tissue perfusion in mammals by hypoxia-inducible factor 1. Exp. Physiol. 2007, 92, 988–991. [Google Scholar] [CrossRef] [PubMed]
  6. Majmundar, A.J.; Wong, W.J.; Simon, M.C. Hypoxia-inducible factors and the response to hypoxic stress. Mol. Cell. 2010, 40, 294–309. [Google Scholar] [CrossRef] [PubMed]
  7. Lee, J.S.; Kim, Y.; Bhin, J.; Shin, H.J.; Nam, H.J.; Lee, S.H.; Yoon, J.B.; Binda, O.; Gozani, O.; Hwang, D.; et al. Hypoxia-induced methylation of a pontin chromatin remodeling factor. Proc. Natl. Acad. Sci. USA 2011, 108, 13510–13515. [Google Scholar] [CrossRef]
  8. Kim, M.R.; Choi, H.S.; Yang, J.W.; Park, B.C.; Kim, J.A.; Kang, K.W. Enhancement of vascular endothelial growth factor-mediated angiogenesis in tamoxifen-resistant breast cancer cells: Role of Pin1 overexpression. Mol. Cancer Ther. 2009, 8, 2163–2171. [Google Scholar] [CrossRef] [PubMed]
  9. Havelund, B.M.; Sørensen, F.B.; Pløen, J.; Lindebjerg, J.; Spindler, K.L.; Jakobsen, A. Immunohistological expression of HIF-1α, GLUT-1, Bcl-2 and Ki-67 in consecutive biopsies during chemoradiotherapy in patients with rectal cancer. APMIS 2013, 121, 127–138. [Google Scholar] [CrossRef] [PubMed]
  10. Zheng, X.; Ruas, J.L.; Cao, R.; Salomons, F.A.; Cao, Y.; Poellinger, L.; Pereira, T. Cell-type-specific regulation of degradation of hypoxia-inducible factor 1 alpha: Role of subcellular compartmentalization. Mol. Cell. Biol. 2006, 26, 4628–4641. [Google Scholar] [CrossRef] [PubMed]
  11. Semenza, G.L. Hypoxia-inducible factor 1: Master regulator of O2 homeostasis. Curr. Opin. Genet. Dev. 1998, 8, 588–594. [Google Scholar] [CrossRef] [PubMed]
  12. Salceda, S.; Caro, J. Hypoxia-inducible factor 1alpha (HIF-1alpha) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J. Biol. Chem. 1997, 272, 22642–22647. [Google Scholar] [CrossRef]
  13. Henríquez, S.; Kohen, P.; Muñoz, A.; Godoy, A.; Orge, F.; Strauss, J.F.; Devoto, L. In-vitro study of gonadotrophin signaling pathways in human granulosa cells in relation to progesterone receptor expression. Reprod. Biomed. Online 2017, 35, 363–371. [Google Scholar] [CrossRef]
  14. Zhang, Z.H.; Chen, L.Y.; Wang, F.; Wu, Y.Q.; Su, J.Q.; Huang, X.H.; Wang, Z.C.; Cheng, Y. Expression of hypoxia-inducible factor-1α during ovarian follicular growth and development in Sprague-Dawley rats. Genet. Mol. Res. 2015, 14, 5896–5909. [Google Scholar] [CrossRef] [PubMed]
  15. Duncan, W.C.; van den Driesche, S.; Fraser, H.M. Inhibition of vascular endothelial growth factor in the primate ovary up-regulates hypoxia-inducible factor-1alpha in the follicle and corpus luteum. Endocrinology 2008, 149, 3313–3320. [Google Scholar] [CrossRef] [PubMed]
  16. Boonyaprakob, U.; Gadsby, J.E.; Hedgpeth, V.; Routh, P.A.; Almond, G.W. Expression and localization of hypoxia inducible factor-1alpha mRNA in the porcine ovary. Can. J. Vet. Res. 2005, 69, 215–222. [Google Scholar] [PubMed]
  17. Fadhillah; Yoshioka, S.; Nishimura, R.; Yamamoto, Y.; Kimura, K.; Okuda, K. Hypoxia-inducible factor 1 mediates hypoxia-enhanced synthesis of progesterone during luteinization of granulosa cells. J. Reprod. Dev. 2017, 63, 75–85. [Google Scholar] [CrossRef] [PubMed]
  18. Kim, J.; Bagchi, I.C.; Bagchi, M.K. Signaling by hypoxia-inducible factors is critical for ovulation in mice. Endocrinology 2009, 150, 3392–3400. [Google Scholar] [CrossRef]
  19. Zhang, J.; Liu, Y.; Yao, W.; Li, Q.; Liu, H.; Pan, Z. Initiation of follicular atresia: Gene networks during early atresia in pig ovaries. Reproduction 2018, 156, 23–33. [Google Scholar] [CrossRef]
  20. Baddela, V.S.; Sharma, A.; Michaelis, M.; Vanselow, J. HIF1 driven transcriptional activity regulates steroidogenesis and proliferation of bovine granulosa cells. Sci. Rep. 2020, 10, 3906. [Google Scholar] [CrossRef]
  21. Kurdistani, S.K.; Arizti, P.; Reimer, C.L.; Sugrue, M.M.; Aaronson, S.A.; Lee, S.W. Inhibition of tumor cell growth by RTP/rit42 and its responsiveness to p53 and DNA damage. Cancer. Res. 1998, 58, 4439–4444. [Google Scholar]
  22. Bae, D.H.; Jansson, P.J.; Huang, M.L.; Kovacevic, Z.; Kalinowski, D.; Lee, C.S.; Sahni, S.; Richardson, D.R. The role of NDRG1 in the pathology and potential treatment of human cancers. J. Clin. Pathol. 2013, 66, 911–917. [Google Scholar] [CrossRef] [PubMed]
  23. Fang, B.A.; Kovačević, Ž.; Park, K.C.; Kalinowski, D.S.; Jansson, P.J.; Lane, D.J.; Sahni, S.; Richardson, D.R. Molecular functions of the iron-regulated metastasis suppressor, NDRG1, and its potential as a molecular target for cancer therapy. Biochim. Biophys. Acta. 2014, 1845, 1–19. [Google Scholar] [CrossRef] [PubMed]
  24. Angst, E.; Dawson, D.W.; Stroka, D.; Gloor, B.; Park, J.; Candinas, D.; Reber, H.A.; Hines, O.J.; Eibl, G. N-myc downstream regulated gene-1 expression correlates with reduced pancreatic cancer growth and increased apoptosis in vitro and in vivo. Surgery 2011, 149, 614–624. [Google Scholar] [CrossRef]
  25. Lu, W.J.; Chua, M.S.; So, S.K. Suppressing N-Myc downstream regulated gene 1 reactivates senescence signaling and inhibits tumor growth in hepatocellular carcinoma. Carcinogenesis 2014, 35, 915–922. [Google Scholar] [CrossRef]
  26. van Belzen, N.; Dinjens, W.N.; Diesveld, M.P.; Groen, N.A.; van der Made, A.C.; Nozawa, Y.; Vlietstra, R.; Trapman, J.; Bosman, F.T. A novel gene which is up-regulated during colon epithelial cell differentiation and down-regulated in colorectal neoplasms. Lab. Investig. 1997, 77, 85–92. [Google Scholar]
  27. Taketomi, Y.; Sugiki, T.; Saito, T.; Ishii, S.; Hisada, M.; Suzuki-Nishimura, T.; Uchida, M.K.; Moon, T.C.; Chang, H.W.; Natori, Y.; et al. Identification of NDRG1 as an early inducible gene during in vitro maturation of cultured mast cells. Biochem. Biophys. Res. Commun. 2003, 306, 339–346. [Google Scholar] [CrossRef]
  28. Nishigaki, A.; Tsubokura, H.; Ishida, M.; Hashimoto, Y.; Yoshida, A.; Hisamatsu, Y.; Tsuzuki-Nakao, T.; Murata, H.; Okada, H. NDRG1 is expressed in human granulosa cells: An implicative role of NDRG1 in the ovary. Reprod. Med. Bio.l 2022, 21, e12437. [Google Scholar] [CrossRef]
  29. Salnikow, K.; Kluz, T.; Costa, M.; Piquemal, D.; Demidenko, Z.N.; Xie, K.; Blagosklonny, M.V. The regulation of hypoxic genes by calcium involves c-Jun/AP-1, which cooperates with hypoxia-inducible factor 1 in response to hypoxia. Mol. Cell. Biol. 2002, 22, 1734–1741. [Google Scholar] [CrossRef]
  30. Said, H.M.; Stein, S.; Hagemann, C.; Polat, B.; Staab, A.; Anacker, J.; Schoemig, B.; Theobald, M.; Flentje, M.; Vordermark, D. Oxygen-dependent regulation of NDRG1 in human glioblastoma cells in vitro and in vivo. Oncol. Rep. 2009, 21, 237–246. [Google Scholar] [CrossRef]
  31. Kokame, K.; Kato, H.; Miyata, T. Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J. Biol. Chem. 1996, 271, 29659–29665. [Google Scholar] [CrossRef] [PubMed]
  32. Nishigaki, A.; Kido, T.; Kida, N.; Kakita-Kobayashi, M.; Tsubokura, H.; Hisamatsu, Y.; Okada, H. Resveratrol protects mitochondrial quantity by activating SIRT1/PGC-1α expression during ovarian hypoxia. Reprod. Med. Biol. 2020, 19, 189–197. [Google Scholar] [CrossRef] [PubMed]
  33. Hashimoto, Y.; Tsuzuki-Nakao, T.; Kida, N.; Matsuo, Y.; Maruyama, T.; Okada, H.; Hirota, K. Inflammatory Cytokine-Induced HIF-1 Activation Promotes Epithelial-Mesenchymal Transition in Endometrial Epithelial Cells. Biomedicines 2023, 11, 210. [Google Scholar] [CrossRef]
  34. Kowalewski, M.P.; Gram, A.; Boos, A. The role of hypoxia and HIF1α in the regulation of STAR-mediated steroidogenesis in granulosa cells. Mol. Cell. Endocrinol. 2015, 401, 35–44. [Google Scholar] [CrossRef] [PubMed]
  35. Nishimura, R.; Okuda, K. Hypoxia is important for establishing vascularization during corpus luteum formation in cattle. J. Reprod. Dev. 2010, 56, 110–116. [Google Scholar] [CrossRef] [PubMed]
  36. Craig, Z.R.; Wang, W.; Flaws, J.A. Endocrine-disrupting chemicals in ovarian function: Effects on steroidogenesis, metabolism and nuclear receptor signaling. Reproduction 2011, 142, 633–646. [Google Scholar] [CrossRef] [PubMed]
  37. Devoto, L.; Kohen, P.; Vega, M.; Castro, O.; González, R.R.; Retamales, I.; Carvallo, P.; Christenson, L.K.; Strauss, J.F. Control of human luteal steroidogenesis. Mol. Cell. Endocrinol. 2002, 186, 137–141. [Google Scholar] [CrossRef]
  38. Thompson, W.E.; Powell, J.; Thomas, K.H.; Whittaker, J.A. Immunolocalization and expression of the steroidogenic acute regulatory protein during the transitional stages of rat follicular differentiation. J. Histochem. Cytochem. 1999, 47, 769–776. [Google Scholar] [CrossRef] [PubMed]
  39. Lanfranchi, B.; Rubia, R.F.; Gassmann, M.; Schuler, G.; Kowalewski, M.P. Transcriptional regulation of HIF1α-mediated STAR expression in murine KK1 granulosa cell line involves cJUN, CREB and CBP-dependent pathways. Gen. Comp. Endocrinol. 2022, 315, 113923. [Google Scholar] [CrossRef] [PubMed]
  40. Devoto, L.; Kohen, P.; Muñoz, A.; Strauss, J.F. Human corpus luteum physiology and the luteal-phase dysfunction associated with ovarian stimulation. Reprod. Biomed. Online 2009, 18 (Suppl. 2), 19–24. [Google Scholar] [CrossRef] [PubMed]
  41. Cavender, J.L.; Murdoch, W.J. Morphological studies of the microcirculatory system of periovulatory ovine follicles. Biol. Reprod. 1988, 39, 989–997. [Google Scholar] [CrossRef] [PubMed]
Biomedicines 13 00328 g001
Figure 1. Immunolocalization of HIF-1α expression in the human follicle. The immunolocalization of HIF-1α in human follicles is depicted, with representative data from eight specimens. (A) Primary follicle. (B) Secondary follicle. (C) Tertiary follicle. (D) Corpus luteum. The cytoplasm of granulosa cells in primary and secondary follicles exhibited positive staining with anti-HIF-1α antibody (indicated by red arrows). In the tertiary and later stages of development, HIF-1α expression was confined to the nucleus (indicated by black arrows in the high power field of the tertiary follicle ((C) inset)).HIF-1α, hypoxia-inducible factor-1α.
Figure 1. Immunolocalization of HIF-1α expression in the human follicle. The immunolocalization of HIF-1α in human follicles is depicted, with representative data from eight specimens. (A) Primary follicle. (B) Secondary follicle. (C) Tertiary follicle. (D) Corpus luteum. The cytoplasm of granulosa cells in primary and secondary follicles exhibited positive staining with anti-HIF-1α antibody (indicated by red arrows). In the tertiary and later stages of development, HIF-1α expression was confined to the nucleus (indicated by black arrows in the high power field of the tertiary follicle ((C) inset)).HIF-1α, hypoxia-inducible factor-1α.
Biomedicines 13 00328 g001
Biomedicines 13 00328 g002
Figure 2. Immunolocalization of NDRG1 expression in the human follicle. The immunolocalization of NDRG1 in human follicles is depicted, with representative data from eight specimens. (A) Primary follicle. (B) Secondary follicle. (C) Tertiary follicle. (D) Corpus luteum. The cytoplasm of the GCs was positively stained with anti-NDRG1 antibody in the tertiary follicle and corpus luteum (arrows) (the high power field of the tertiary follicle ((C) inset). NDRG1, N-myc downstream-regulated gene 1.
Figure 2. Immunolocalization of NDRG1 expression in the human follicle. The immunolocalization of NDRG1 in human follicles is depicted, with representative data from eight specimens. (A) Primary follicle. (B) Secondary follicle. (C) Tertiary follicle. (D) Corpus luteum. The cytoplasm of the GCs was positively stained with anti-NDRG1 antibody in the tertiary follicle and corpus luteum (arrows) (the high power field of the tertiary follicle ((C) inset). NDRG1, N-myc downstream-regulated gene 1.
Biomedicines 13 00328 g002
Biomedicines 13 00328 g003
Figure 3. Effect of HIF-1α silencing on NDRG1. (A) Effect of HIF-1α silencing on HIF-1α mRNA. KGN cells were transfected with either siRNA targeting HIF-1α or a control siRNA for 24 h, and the efficiency of HIF-1α knockdown was assessed using quantitative reverse-transcription polymerase chain reaction (RT-PCR) (n = 6). Effect of HIF-1α silencing on NDRG1 mRNA (B) and protein (C). KGN cells were transfected with HIF-1α siRNA or control siRNA for 72 h. The effect of HIF-1α knockdown on NDRG1 mRNA expression was evaluated using quantitative RT-PCR (n = 6). The protein levels of NDRG1 were analyzed through Western blotting, with β-actin serving as a loading control (n = 3). At least three experiments were conducted for each. The results of densitometric analysis were normalized to the expression of β-actin to ensure accuracy in quantification. The data were presented as mean ± SEM. ** p < 0.01 versus the si-NC group. HSS104774 and HSS104775 are siRNA IDs. NDRG1, N-myc downstream-regulated gene 1; HIF-1α, hypoxia-inducible factor-1α; RT-PCR, reverse-transcription polymerase chain reaction.
Figure 3. Effect of HIF-1α silencing on NDRG1. (A) Effect of HIF-1α silencing on HIF-1α mRNA. KGN cells were transfected with either siRNA targeting HIF-1α or a control siRNA for 24 h, and the efficiency of HIF-1α knockdown was assessed using quantitative reverse-transcription polymerase chain reaction (RT-PCR) (n = 6). Effect of HIF-1α silencing on NDRG1 mRNA (B) and protein (C). KGN cells were transfected with HIF-1α siRNA or control siRNA for 72 h. The effect of HIF-1α knockdown on NDRG1 mRNA expression was evaluated using quantitative RT-PCR (n = 6). The protein levels of NDRG1 were analyzed through Western blotting, with β-actin serving as a loading control (n = 3). At least three experiments were conducted for each. The results of densitometric analysis were normalized to the expression of β-actin to ensure accuracy in quantification. The data were presented as mean ± SEM. ** p < 0.01 versus the si-NC group. HSS104774 and HSS104775 are siRNA IDs. NDRG1, N-myc downstream-regulated gene 1; HIF-1α, hypoxia-inducible factor-1α; RT-PCR, reverse-transcription polymerase chain reaction.
Biomedicines 13 00328 g003
Biomedicines 13 00328 g004
Figure 4. Effect of HIF-1α silencing on hormone production. Effect of HIF-1α silencing on StAR mRNA (A), p450scc mRNA (B), and StAR and CYP11A1 (p450scc) protein (C). KGN cells were transfected with either siRNA targeting HIF-1α or a control siRNA for 72 h. The effect of HIF-1α knockdown was evaluated using quantitative RT-PCR (n = 6). NDRG1 protein levels were quantified using Western blotting, with β-actin serving as a control (n = 3). At least three experiments were conducted for each. Densitometric analysis results were normalized to the expression of β-actin. (D) Effect of HIF-1α silencing on progesterone secretion. Progesterone concentration in the cell culture supernatant was analyzed using the enzyme immunoassay protocol after 72 h. Data are presented as the amount of steroids secreted, with results expressed as the means ± SEM. * p < 0.01 versus the si-NC group. ** p < 0.01 versus the si-NC + FSK group. HSS104774 and HSS104775 are siRNA IDs. FSK, forskolin; HIF-1α, hypoxia-inducible factor-1α; RT-PCR, reverse-transcription polymerase chain reaction; StAR, steroidogenic acute regulator protein.
Figure 4. Effect of HIF-1α silencing on hormone production. Effect of HIF-1α silencing on StAR mRNA (A), p450scc mRNA (B), and StAR and CYP11A1 (p450scc) protein (C). KGN cells were transfected with either siRNA targeting HIF-1α or a control siRNA for 72 h. The effect of HIF-1α knockdown was evaluated using quantitative RT-PCR (n = 6). NDRG1 protein levels were quantified using Western blotting, with β-actin serving as a control (n = 3). At least three experiments were conducted for each. Densitometric analysis results were normalized to the expression of β-actin. (D) Effect of HIF-1α silencing on progesterone secretion. Progesterone concentration in the cell culture supernatant was analyzed using the enzyme immunoassay protocol after 72 h. Data are presented as the amount of steroids secreted, with results expressed as the means ± SEM. * p < 0.01 versus the si-NC group. ** p < 0.01 versus the si-NC + FSK group. HSS104774 and HSS104775 are siRNA IDs. FSK, forskolin; HIF-1α, hypoxia-inducible factor-1α; RT-PCR, reverse-transcription polymerase chain reaction; StAR, steroidogenic acute regulator protein.
Biomedicines 13 00328 g004
Biomedicines 13 00328 g005
Figure 5. Schematic representation of the potential mechanisms involved in luteinization. The hypoxic environment during follicular development induces the stabilization of HIF-1α. HIF mediates NDRG1 and promotes luteinization.
Figure 5. Schematic representation of the potential mechanisms involved in luteinization. The hypoxic environment during follicular development induces the stabilization of HIF-1α. HIF mediates NDRG1 and promotes luteinization.
Biomedicines 13 00328 g005
Table 1. List of primer sequences for quantitative RT-PCR.
Table 1. List of primer sequences for quantitative RT-PCR.
GeneForward Primer (5′→3′)Reverse Primer (5′→3′)
HIF-1αTTCACCTGAGCCTAATAGTCCCAAGTCTAAATCTGTGTCCTG
NDRG1AGGCAGGTGACAGCAGGGACCGTGGCAGACGGCAAAGT
StARAAACTTACGTGGCTACTCAGCATCGACCTGGTTGATGATGCTCTTG
p450sccCAGGAGGGGTGGACACGACAGGTTGCGTGCCATCTCATAC
EF TCTGGTTGGAATGGTGACAACATGCAGAGCTTCACTCAAAGCTTCATGG
Table 2. Immunohistochemical staining for HIF-1α in ovarian follicles.
Table 2. Immunohistochemical staining for HIF-1α in ovarian follicles.
Number of Samples
TotalHIF-1α +HIF-1α -Positive Rate (%)
Cytoplasmic
primary follicles69541578.3
secondary follicles118372.7
tertiary follicle180180.0
corpus luteum130130.0
Nuclear
primary follicles691681.4
secondary follicles111109.1
tertiary follicle1813572.2
corpus luteum1321115.4
Table 3. Immunohistochemical staining for NDRG1 in ovarian follicles.
Table 3. Immunohistochemical staining for NDRG1 in ovarian follicles.
Number of Samples
TotalNDRG1 +NDRG1 -Positive Rate (%)
primary follicles680680.0
secondary follicles105550.0
tertiary follicle660100.0
corpus luteum12120100.0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nishigaki, A.; Ishida, M.; Tsubokura, H.; Hisamatsu, Y.; Hirose, Y.; Okada, H. HIF-1α Promotes Luteinization via NDRG1 Induction in the Human Ovary. Biomedicines 2025, 13, 328. https://doi.org/10.3390/biomedicines13020328

AMA Style

Nishigaki A, Ishida M, Tsubokura H, Hisamatsu Y, Hirose Y, Okada H. HIF-1α Promotes Luteinization via NDRG1 Induction in the Human Ovary. Biomedicines. 2025; 13(2):328. https://doi.org/10.3390/biomedicines13020328

Chicago/Turabian Style

Nishigaki, Akemi, Mitsuaki Ishida, Hiroaki Tsubokura, Yoji Hisamatsu, Yoshinobu Hirose, and Hidetaka Okada. 2025. "HIF-1α Promotes Luteinization via NDRG1 Induction in the Human Ovary" Biomedicines 13, no. 2: 328. https://doi.org/10.3390/biomedicines13020328

APA Style

Nishigaki, A., Ishida, M., Tsubokura, H., Hisamatsu, Y., Hirose, Y., & Okada, H. (2025). HIF-1α Promotes Luteinization via NDRG1 Induction in the Human Ovary. Biomedicines, 13(2), 328. https://doi.org/10.3390/biomedicines13020328

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop