Next Article in Journal
A Long-Term Stable Sensor Based on Fe@PCN-224 for Rapid and Quantitative Detection of H2O2 in Fishery Products
Next Article in Special Issue
Determination of Carbohydrate Composition in Mealworm (Tenebrio molitor L.) Larvae and Characterization of Mealworm Chitin and Chitosan
Previous Article in Journal
5-Hydroxymethylfurfural Formation in Bread as a Function of Heat Treatment Intensity: Correlations with Browning Indices
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chemical Composition and Nutritional Value of Different Species of Vespa Hornets

by
Sampat Ghosh
1,
Saeed Mahamadzade Namin
1,2,
Victor Benno Meyer-Rochow
1,3 and
Chuleui Jung
1,4,*
1
Agriculture Science and Technology Research Institution, Andong National University, Andong 36729, Korea
2
Department of Plant Protection, College of Agriculture, Varamin-Pishva Branch, Islamic Azad University, Varamin 3381774895, Iran
3
Department of Ecology and Genetics, Oulu University, 90140 Oulu, Finland
4
Department of Plant Medicals, Andong National University, Andong 36729, Korea
*
Author to whom correspondence should be addressed.
Foods 2021, 10(2), 418; https://doi.org/10.3390/foods10020418
Submission received: 27 January 2021 / Revised: 10 February 2021 / Accepted: 11 February 2021 / Published: 14 February 2021

Abstract

:
We genetically identified three different species of hornets and analyzed the nutrient compositions of their edible brood. Samples were collected from a commercial production unit in Shizong province of China and from forests near Andong City in Korea. The species were identified as Vespa velutina, V. mandarinia, and V. basalis from China and V. velutina from Korea. Farmed V. velutina and V. mandarinia were found to have similar protein contents, i.e., total amino acids, whereas V. basalis contained less protein. The V. velutina brood collected from the forest contained the highest amount of amino acids. Altogether 17 proteinogenic amino acids were detected and quantified with similar patterns of distribution in all three species: leucine followed by tyrosine and lysine being predominant among the essential and glutamic acid among the non-essential amino acids. A different pattern was found for fatty acids: The polyunsaturated fatty acid proportion was highest in V. mandarinia and V. basalis, but saturated fatty acids dominated in the case of V. velutina from two different sources. The high amounts of unsaturated fatty acids in the lipids of the hornets could be expected to exhibit nutritional benefits, including reducing cardiovascular disorders and inflammations. High minerals contents, especially micro minerals such as iron, zinc, and a high K/Na ratio in hornets could help mitigate mineral deficiencies among those of the population with inadequate nutrition.

1. Introduction

Numerous communities in the world traditionally include the broods of wasps and hornets (Hymenoptera) in their diets (Figure 1). Since ancient times it has been customary for Chinese people, especially those from Yunnan, to consume wasps, as is documented in a book from the Tang dynasty (618–907 C.E.) [1]. In Korea, Vespa hornet nests and larvae are harvested for medicinal and occasional edible use, especially V. mandarinia [2]. In Laos insects including wasps and hornets are consumed by 95% of the population, with the exception of two provinces for which a value of 85–90% has been reported [3]. The hornets consumed are of a different species, but V. affinis and V. tropica are particularly popular in Laos [4], whereas V. cincta (synonym to V. tropica, based on a report by [5]) is favored in Northern Thailand [6]. Wasp pupae as well as the adults belonging to the genus Vespula, locally known as hebo, are popular in the mountainous region of Honshu, Japan [7,8]. People commonly harvest the wasp nest from the forest, but in some cases the wasps are semi-domesticated [4,8] (Figure 1B).
The preparation of the wasp and hornet brood for consumption varies. The most common method of preparation includes deep-frying or frying with chicken eggs as in Yunnan, but the Dai people of southern Yunnan prefer to steam larvae and pupae together and mix them with vinegar and other seasonings [1]. Korean people also prefer frying and roasting [2], whereas Japanese people cook or preserve the wasps using soy sauce and mirin (sweet cooking rice wine) [8]. Although in Korea hornets are not considered a common food, they did, however, feature in the armamentarium of Korean traditional medicine. Polistes and Vespa larvae and adults are used as therapeutics for different ailments [9,10].
Vespa spp. have received attention not only as edible insects, but also as a pest affecting honeybee populations. In this context V. velutina, an invasive species, is regarded as the most obnoxious in Korea [11,12] and in Europe as well [13]. Although the Asian honeybee, Apis cerana, has evolved a “heat balling defense” and warning behavior when hornets are patrolling near their nests, the European honeybee, A. mellifera, does not possess this behavior and is therefore more susceptible to an attack by V. velutina [14,15,16,17]. A study of risk prediction in connection with the distribution of V. velutina [18,19] shows that the yearly dispersal of the species is 9.4 km northward in Korea and that this could have a serious impact on beekeeping as well as biodiversity and the ecosystem in general.
Nine native and one invasive hornet species occur in South Korea: V. analis, V. binghami, V. mandarinia, V. simillima simillima, V. simillima xantothorax, V. crabro crobroformis, V. crabro flavofasciata, V. ducalis, V. dybowskii, and V. velutina nigrothorax [20,21]. The lifecycle of the Vespa species includes different phases. Following overwintering, the emergence foundress, i.e., mated queen, searches for a suitable nest site and then constructs the primary nest for egg laying. About a month later, the eggs will have developed into female, non-reproductive adult workers and predation begins. During that time the workers build a secondary nest that is bigger in size than the primary nest. After that, large numbers of future queens are produced, which mate with drones that stem from unfertilized eggs. As the winter approaches, drones and workers die, while queens seek out overwintering places and the cycle continues the following spring [13].
Harvesting these wasps and hornets (Vespa spp.) can be a mode of biocontrol, but it can also lead to the use of these species as human food or animal feed. The present study was undertaken to assess the nutrient composition of three different species of Vespa. It was hoped that an investigation such as this would give us an opportunity to understand why there are differences in amino acid as well as fatty acid compositions between semi-domesticated hornets and specimens collected from the wild, e.g., the forest environment.

2. Materials and Methods

2.1. Sample Collection and Preparation

Three bottles of Vespa broods, representing three species, were obtained in frozen and dried form from a hornet-producing farm in Shizong County in China. The hornets were semi-domesticated primarily to be sold as food. All of the Vespa samples were packed into a freezing box and brought to the laboratory (Andong National University, Andong, South Korea). Samples were stored at −20 °C until further processing. A few individuals (n = 10) from each bottle were taken for our DNA barcoding experiment in order to identify the species. Specimens used in the chemical analyses were not separated according to developmental stage; they included late instar larvae and pupae together, almost 50:50 (as this is the way they are sold and used by the consumer), but excluded adults.
A V. velutina nest was harvested in early morning from the forest behind the university (Andong City, Korea) in the month of July and brought to the laboratory. The broods were collected, similar to the Chinese commercial late instar larvae and pupae in a 50:50 proportion, separately from the nest and kept in a refrigerator (−20 °C) until further processing (n = 100), which involved freeze drying and grinding up into a homogenous powder form.

2.2. Identification of the Species

The collected specimens i.e., broods of Vespa, were labelled VEUN20, VENU21, and VENU22 and identified based on DNA barcoding. The total DNA of each sample was extracted from the head and thorax using a DNeasy Blood & Tissue kit (QIAGEN, Inc., Dusseldorf, Germany) following the manufacturer’s protocol. Two primers, LCO-1490 (5′-GGT CAA CAA ATC ATA AAG ATA TTG G-3′) and HCO-2198 (5′-TAA ACT TCA GGG TGA CCA AAA AAT CA-3′) targeting mitochondrial the Cytochrome Oxidase I (COI) gene [22] were used. The polymerase chain reaction (PCR) was conducted using AccuPower PCR PreMix (Bioneer, Daejeon, Korea) in order to amplify the COI gene corresponding to “DNA Barcode” region [23]. Sequencing was performed commercially by Macrogen (Seoul, South Korea). All three sequences were generated in both directions and assembled using Bioedit v7.0.5.2 [24] to annotate the species level identification using the BLAST (Basic Local Alignment Search Tool) database of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov, accessed on 31 August 2019). Based on the similarity (in %) the specimens were identified.

2.3. Nutritional Composition Analyses

2.3.1. Amino Acid Analysis

The amino acid composition was estimated using a Sykam Amino Acid analyzer S433 (Sykam GmbH, Eresing, Germany) following a standard method of AOAC (Association of Official Analytical Chemists) [25]. The Vespa samples in powder form were hydrolyzed in 6 N HCl for 24 h at 110 °C under a nitrogen atmosphere followed by concentrating in a rotary evaporator. The concentrated samples were reconstituted with sample dilution buffer provided by the manufacturer (0.12N citrate buffer, pH 2.20). The hydrolyzed samples were analyzed for amino acid composition. The amino acid score was calculated considering the total estimated amino acid as protein, based on the WHO/FAO/UNU (World Health Organization/Food and Agriculture Organization/United Nations University) [26] report of a joint WHO/FAO/UNU Expert Consultation on protein and amino acid requirements in human nutrition following the formula [27]:
Amino   acid   score = ( mg   of   amino   acid   in   1 g   of   test   protein )   ×   100 mg   of   amino   acid   in   reference   pattern

2.3.2. Fatty Acid Composition Analysis

Fatty acid compositions of studied Vespa were determined and quantified using gas chromatography–flame ionization detection (GC-14B, Shimadzu, Tokyo, Japan) equipped with an SP-2560 column, following the recommended method of the Korean Food Standard Codex [28]. Briefly, the samples were derivatized into fatty acid methyl esters (FAMEs), which were then identified and quantified by comparing the retention time and peak areas of standards from Sigma (Yongin, Korea) and analyzed under the same conditions.

2.3.3. Mineral Analysis

Minerals of nutritional importance were analyzed following standard procedures of the Korean Food Standard Codex [28]. Dried Vespa powder samples were digested with nitric and hydrochloric acid (1:3) at 200 °C for 30 min in a high pressure microwave digestive system. The mineral contents, upon filtration with 0.45 micron filter paper, were analyzed using an inductively coupled plasma-optical emission spectrophotometer (ICP-OES 720 series; Agilent; Santa Clara, CA, USA). Recommended dietary allowance (RDA), population reference intake (PRI), and adequate intake (AI) values for the respective minerals were obtained from organizations such as the Linus Pauling Institute of Oregon State University and the European Food Safety Authority (EFSA).

2.3.4. Statistical Analysis

Composite sampling methods were followed including 100 samples for each group. In order to increase reliability the chemical analysis was carried out in at least duplicate and represented as mean ± standard deviation. To test the differences for individual nutrients of different Vespa, we carried out one-way ANOVA (analysis of variance) followed by a post hoc test (Tukey’s Honestly Significant Difference (HSD)) using SPSS 16.0 (SPSS Inc., Chicago, IL, USA). If the p-value was found to be ≤0.05 (CI = 95%), the null hypothesis was rejected.

3. Results

3.1. Identification of the Species

With the help of the DNA barcoding method, based on the similarity between the sequences obtained in this study and sequences existing in the NCBI database, we identified the three species, VEUN20 as V. mandarinia, VENU21 as V. basalis, and VENU22 as V. velutina. The obtained sequences for the COI gene, corresponding to the “DNA Barcode” region, are available in GenBank under accession number MN477949- MN477951 (Appendix A).

3.2. Nutritional Composition of Vespa

3.2.1. Amino Acids

Amino acid compositions of the Vespa species studied are represented in Table 1. There were 17 amino acids in all Vespa samples. There was a significant difference in the total amino acid content of broods of different species of Vespa (df = 3,4, F = 19.135, p = 0.008). Almost all the amino acids were found to be higher in the V. velutina brood collected from the wild in Korea. However, the differences were not significant in all cases (Table 1). Considering the totality of the amino acids as protein, the results show that V. velutina and V. mandarinia collected from the commercial production unit in Shizong province (China) had similar protein contents whereas V. basalis contained less protein. However, V. velutina broods collected from the forest near Andong (Korea) contained the highest amount of amino acids. Leucine was the predominating essential amino acid followed by lysine and valine. Tryptophan was not assessed and the amounts of cysteine and methionine were not measured in their entirety presumably because of the acid hydrolysis process [29]. Among the non-essential amino acids, glutamic acid was the most abundant one. The amino acid scoring pattern suggested that among all the estimated indispensable amino acids, methionine was found to be limiting; others satisfied (having a score of >100) the ideal protein pattern recommended by the WHO/FAO/UNU [26].

3.2.2. Fatty Acids

Table 2 represents the fatty acid compositions of the Vespa broods studied. Significant differences were found in the total fatty acid content of broods of different Vespa species (df = 3,4, F = 12.255, p = 0.017). Palmitic acid was the predominating saturated fatty acid; it was followed by stearic acid. Oleic acid was the most abundant monounsaturated fatty acid. However, there was apparently no consistency in the polyunsaturated group. Except for V. velutina from China, linoleic acid was always found in abundance among the polyunsaturated fatty acids, although the quantities varied widely (0.55 to 9.49 mg/100 g). Overall, the V. mandarinia and V. basalis broods were found to have the highest proportions of polyunsaturated fatty acids. However, no such difference was found between the saturated and monounsaturated fatty acid contents in these two species. By contrast, the V. velutina brood contained a higher amount of saturated fatty acids followed by monounsaturated and polyunsaturated fatty acids.

3.2.3. Mineral Content

Table 3 represents the comparative account of mineral contents of the species studied as well as the RDA values of respective elements. Significant differences in the mineral content, except manganese, of broods of different Vespa species were found (calcium: df = 3,4, F = 19.994, p = 0.007; magnesium: df = 3,4, F = 478.504, p = 0.000; sodium: df = 3,4, F = 161.653, p = 0.000; potassium: df = 3,4, F = 56.353, p = 0.001; phosphorus: df = 3,4, F = 42.778, p = 0.002; iron: df = 3,4, F= 38.232, p = 0.002; zinc: df = 3,4, F = 19.654, p = 0.007; manganese: df = 3,4, F = 4.086, p = 0.104; copper: df =3,4, F = 603.414, p = 0.000). The V. velutina brood collected from the wild in Korea was found to have a higher mineral content except for zinc and copper, however, the differences were not always significant. For magnesium, potassium, phosphorus, iron, and manganese, no significant differences were found between V. velutina broods from China and Korea. Potassium was the most abundant element. It was followed by phosphorus. Among the microminerals, iron and zinc were found to be dominating. The farmed V. velutina brood contained much less sodium than that detected in the wild-collected V. velutina brood. The potassium-to-sodium ratio (K/Na) in the wild V. velutina brood was as high as 11.7, but even higher ratios were noted in the farmed broods of V. velutina, V. mandarinia, and V. basalis, namely, 72.3, 13.7, and 45.5, respectively. It is noteworthy that the wild-collected V. velutina brood contained higher amounts of most of the minerals than the farmed hornets.

4. Discussion

4.1. Amino Acid Composition

The amino acid distributions seen in our study are in general agreement with a previously published report, although the contents of some of the amino acids in the current study were a little less than what was reported earlier [1]. The total amino acid content as protein content of Vespa broods is comparable with other reports on edible insects, including wasps (V. velutina nigrithorax: 48.64 [30], V. mandarinia: 59.7 [2], V. basalis: 43.91, V. mandarinia: 52.20, V. velutina auraria: 49.03, V. tropica ducalis: 42.44 [1]). In the earlier study, as with ours, overall glutamic acid was the most abundant amino acid. Glutamic acid is the precursor of GABA (gamma aminobutyric acid), which is a neurotransmitter of inhibitory neurons [31] and thus might be responsible for docile behavior. However, the saliva of Vespa spp. larvae is not rich in glutamic acid [32], which could be a reason for the wasps’ aggressiveness in defense and times of hunting prey. This aggressive behavior lessens in the nest where trophallaxis is performed, an essential behavioral trait for a social insect. The high proline content, amongst other effects, influences the flight of the insect, because it is metabolized to produce energy for the wing movements during flight [33]. It has been reported that hornet, with higher proline content in their saliva, generally build their nests higher up and also have a wider hunting range than hornets with less proline content in saliva and those live underground or nest in caves or tree holes and hunt over a smaller area [32].
Although V. mandarinia and V. velutina inhabit subterranean and open-air nests, respectively [34,35], they did not differ with respect to proline content, at least in the brood stage. Nonetheless, differences in body composition can be expected to exist between larvae, pupae, and adults as well as drones, workers, and queens with regard to developmental as well as physiological states, as has been demonstrated for the honeybee (A. mellifera) and the bumblebee (Bombus terrestris) [36,37,38,39]. Histidine, decarboxylated to histamine, is a major component of the venom and found in similar amounts in V. velutina and V. mandarinia, but less in the case of V. basalis. Among the indispensable amino acids, leucine was found to predominate and to be present in higher amounts in V. velutina and V. mandarinia than in V. basalis. Leucine and isoleucine are metabolized in the musculature.
From a nutritional standpoint, lysine deserves consideration as it is a limiting amino acid in cereals such as rice, wheat, and maize. Catabolism of lysine, an entirely ketogenic amino acid, includes the saccharopine pathway, which results in the formation of glutamate and α-aminoadipate. In addition, lysine is also a precursor for the biosynthesis of carnitine, which plays an important role in β-oxidation [40]. The aromatic amino acid tyrosine functions as precursor of catecholamines such as dopamine, norepinephrine, and epinephrine and is involved in melanogenesis. Tyrosine is a conditionally essential amino acid with phenylalanine playing a crucial role in tyrosine synthesis. Therefore, because of the presence of almost all proteinogenic amino acids and estimated indispensable ones except for methionine, satisfying the recommended protein pattern (Table 1), Vespa broods would supplement the nutritional requirements in people.

4.2. Fatty Acid Composition

The higher polyunsaturated acid contents of V. mandarinia and V. basalis are likely due to their diet, which consists of crickets and grasshoppers, which are often rich in polyunsaturated fatty acids (cf., grasshopper, Chondacris rosea: [41], and crickets, Gryllus sp. and Teleogryllus sp.: [42]). Compared to earlier analyses, the proportions of monounsaturated fatty acids were higher in the case of other hymenopteran species such as, to mention but a few, B. ignitus [37], B. terrestris [38], Carebara vidua [43], Polyrhachis vicina [44,45], and Oecophylla smaragdina [46]. However, diet manipulations can result in changes in the fatty acid composition in farmed versus wild insects [47,48].
Oleic acid was the dominant monounsaturated and palmitic acid, with stearic and myristic acids being the abundant saturated fatty acids. Linoleic acid was the most abundant polyunsaturated fatty acid followed by linolenic acid in V. mandarinia and V. basalis. Primarily saturated fatty acids such as myristic, palmitic, and lauric acids increased the level of low density lipoprotein, the so-called bad cholesterol. However, stearic acid does not raise serum cholesterol [49]. Oleic acid inhibits the store-operated Ca+2 entry process (SOCE) that controls the Ca+2 influx pathway and is involved in several cellular and physiological processes, including cell proliferations that are often diagnostic for colorectal cancer [50]. Oleic acid also shows significant in vitro inhibition of prolyl-endopeptidase (PEP), an enzyme playing a crucial role in the formation of amyloid in the brain and implicated in disorders such as dementia and Alzheimer’s disease [50].
Unsaturated fatty acids are being given special attention as they are seen to be beneficial to human health. Earlier studies, e.g., by Grundy [51], demonstrated the capacity of monounsaturated fatty acids to lower lipoprotein density and thus total cholesterol. Polyunsaturated fatty acids play a crucial role in the biosynthesis of cellular hormones such as eicosanoids and other signaling compounds that modulate human health [50]. Polyunsaturated fatty acids are of two types, i.e., n−6 and n−3, based on the position of the first unsaturated site in the chain. A higher ratio of n−3 to n−6, i.e., more n−3 and less n−6 in the diet, is preferable in connection with human health as it helps to reduce weight through the removal of intra-abdominal fat, a drop in adipocyte cell size, and the normalization of the heartbeat. Diets with high n−3 polyunsaturated fatty acids enhance the body’s ability to reduce damaging inflammatory conditions, as they are usually converted into anti-inflammatory eicosanoids. Besides, epidemiological as well as clinical studies further suggest that n−3 polyunsaturated fatty acids, including n−3 from marine food resources, help lower cardiovascular mortality [52,53] through mechanisms that include the modulation of cellular metabolic functions and gene expression and exert beneficial effects on lipid profiles and blood pressure [54]. Thus, the presence of linolenic acid in V. mandarinia and V. basalis could have nutritional benefits for sufferers of cardiovascular complexities.

4.3. Mineral Content

Minerals are essential micronutrients that play critical roles in human health. Among the minerals of nutritional importance, potassium was found in abundance followed by phosphorus. The values were within the range of reports on Hymenoptera as well as edible insects belonging to other orders [42,55]. A substantial amount of evidence shows that potassium intake lowers blood pressure. An increased intake of potassium also plays a critical role in the management of hypercalciuria and is likely to decrease the risk of osteoporosis [56]. Low serum potassium is strongly related to glucose intolerance and increases the risk of lethal ventricular arrhythmias in patients suffering from ischemic heart disease. On the other hand, a high intake of dietary sodium is associated with a prevalence of hypertension [57].
From the human nutritional point of view, a high potassium-to-sodium ratio can be regarded as beneficial as it reduces cardiovascular risk and improves blood pressure [58]. All the hornet broods contained higher potassium and comparatively less sodium, and thus can be regarded as beneficial for human health. The calcium content of the Vespa brood was found to be within the range of other insects [55], but less than what had been reported for A. mellifera larvae and pupae [36]. Over 99% of total body calcium by virtue of its phosphate salt is present in the teeth and bones of mammals and the remainder is present in the blood, extracellular fluid, muscle, and other tissues. Calcium plays critical physiological roles, including mediating vascular contraction and vasodilation, muscle contraction, nerve transmission, and glandular secretion, to mention a few [59]. Chronic calcium deficiency often results in a reduction in bone mass and osteoporosis [60], the development of hypertension, and even colon cancer [61].
Among the minerals of nutritional importance, iron receives the most attention. Iron deficiency and anemia still exist and are major public health concerns worldwide, especially in many developing and low-income countries [62,63]. The most vulnerable sections of the population in developing countries regarding iron deficiency are women of childbearing age and children under five [64,65]. Although the iron content of the studied species was a little less than that was reported for A. mellifera workers [36], it could still supplement the iron requirement, especially for those in the population who cannot afford iron-rich food such as red meat, liver, fish, etc. The element zinc plays a role in several cellular processes, including catalytic, structural, and regulatory roles in many enzymes, gene transcription, signal transduction pathways, etc. [66]. Although severe zinc deficiency is considered rare [67], mild to moderate zinc deficiencies persist worldwide [68]. An inadequate dietary zinc intake is particularly common in Sub-Saharan Africa and South Asia [69]. Based on the RDA values provided by agencies, consumption of 100 g of Vespa brood could satisfy a significant proportion of daily dietary requirements for minerals, especially iron, zinc, and copper (Table 3). Even if it cannot meet the total mineral need, assuming good bioavailability, the consumption of Vespa brood could at least supplement the nutritional requirements of minerals and could help mitigate the problems of mineral deficiencies in those sections of the population most at risk for them.

5. Conclusions

Since it was first suggested in 1975 that insects could help ease the problem of global food shortages [70], the last two decades in particular have seen a remarkable increase in attention to edible insects as a nutrient-rich and healthy food resource. Numerous countries have formulated or are in the process of formulating legislation to regulate mass production and trade of edible insects. The global market value of edible insects is expected to exceed USD 522 million by 2023 [71]. Since 2012, the South Korean edible-insect market focusing on human consumption alone (not including insects as animal feed) has experienced major advances, with governmental support and successful research endeavors [42,72]. The country’s tradition of using certain insects such as processed silkworm pupae, commonly known as beondaegi, as food [73] has further helped. Noting the competent nutrient composition of all three Vespa species examined by us and the feasibility of rearing these insects, we propose that these hornet broods can be a sustainable, high-quality nutritional source. However, the rearing process is yet to be established before any large-scale controlled production can commence.

Author Contributions

Conceptualization, C.J. and S.G.; methodology, S.G. and S.M.N.; software, S.G.; validation, S.G. and S.M.N.; formal analysis, S.G., S.M.N., and C.J.; investigation, S.G., C.J., and S.M.N.; data curation, C.J.; writing—original draft preparation, S.G.; writing—review and editing, C.J., V.B.M.-R., S.G., and S.M.N.; visualization, C.J.; supervision, C.J.; project administration, C.J.; funding acquisition, C.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the BSRP through the National Research Foundation of Korea (NRF), Ministry of Education (NRF-2018R1A6A1A03024862).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We appreciate Zhao Quanghui, owner of the Vespa farm in Shizong County and Professor Ken Tan, Chinese Academy of Science, Yunnan province, China, for the valuable assistance on this work. This study was partly supported by the BSRP through the National Research Foundation of Korea (NRF), Ministry of Education (NRF-2018R1A6A1A03024862).

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. DNA sequences for the COI gene corresponding to the “DNA Barcode” region of VEUN20 as Vespa mandarinia, VENU21 as Vespa basalis, and VENU22 as Vespa velutina.
Table A1. DNA sequences for the COI gene corresponding to the “DNA Barcode” region of VEUN20 as Vespa mandarinia, VENU21 as Vespa basalis, and VENU22 as Vespa velutina.
IDAccession No.Sequence
VEUN20MN477949TATATTATATTTTATTTTTGCCTTATGATCAGGAACTATCGGAGCATCCATAAGATTAATTATTCGAATAGAGCTTAGATCTCCTGGCAATCTAATTAATAATGACCAAATTTACAATTCTATTATTACTGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCCTTTATAATTGGAGGGTTTGGAAATTGATTAATTCCATTAATACTAGGTATTCCAGATATGGCATTTCCTCGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCATTATTCCTTCTAATTATAAGAAACTTTATTGGAGGGGGTGTTGGTACAGGATGAACCCTTTATCCCCCCCTATCATCCATTATTGGCCATAATTCTCCTTCAGTAGATCTAAGAATTTTCTCTCTCCATATTGCAGGAATTTCTTCAATTATAGGAGCAATTAATTTTATTGTAACAATTCTAAATATACATGTCAAAACCCATTCATTAAATTTTTTACCATTATTCTCTTGGTCTGTCCTAATTACAGCATTCTTATTACTTTTATCTTTACCTGTTTTAGCTGGCGCAATCACCATACTTTTAACAGATCGAAATTTTAATACATCCTTTTTCGATCCAACTGGAGGCGGAGACCCCATCTTATACCAACATTTATTC
VEUN21MN477950AATACTTTATTTTATTTTTGCTTTATGATCAGGATCTTTAGGAGCCTCTATAAGTTTAATTATTCGTATAGAACTTAGATCCCCAGGAAGATTAATTAACAACGATCAAATCTATAATTCTATTATTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTCTGACTATTACCTCCCTCTTTATTTCTATTAATTATAAGAAATTTTATTGGAGGAGGAGTAGGAACTGGATGAACTCTTTACCCACCTCTATCATCAATTACTGGTCATAATTCTCCAGCTGTTGATCTTAGAATCTTTTCATTACATATTGCAGGAATTTCATCAATTATAGGAGCCATTAATTTCATTGTTACAATTTTAAACATACACATTAAAACTCACTCACTAAGATTCTTACCTTTATTTTCATGATCAGTTTTAATTACAGCATTTTTACTATTATTATCCTTACCTGTTCTAGCAGGAGCAATTACAATACTTCTTACCGATCGAAACTTTAATACATCATTTTTTGATCCCACAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT
VEUN22MN477951AATATTATACTTTATTTTTGCATTATGATCTGGAACATTGGGAGCATCAATAAGATTAATTATTCGTATAGAATTAAGATCTCCCGGAAATTTAATTAATAATGATCAAATTTATAATTCAATTATCACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATCGGAGGATTCGGTAACTGAATAATTCCTCTAATACTCGGAATTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGACTACTCCCTCCATCATTATTTATATTAATTATAAGAAACTTTATTGGTGGAGGTGTAGGAACAGGATGAACTTTATATCCTCCTTTATCATCAATTACTGGTCATAACTCACCATCAGTTGATTTAAGAATTTTCTCTTTACATATTGCAGGAATTTCATCAATTATAGGTGCAATTAATTTTATTGTAACAATTCTGAATATACATGTAAAAACACACTCATTAAATTTTTTACCATTATTCTCATGATCAGTCTTAATTACTGCTTTTTTACTTTTATTATCACTCCCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTTAATACATCATTCTTCGATCCAACCGGAGGAGGAGACCCAATTCTATATCAACACTTATTT

References

  1. Ying, F.; Xiaoming, C.; Long, S.; Zhiyong, C. Common edible wasps in Yunnan Province, China and their nutritional value. In Forest Insects as Food: Human Bites Back; Durst, P.B., Johnson, D.V., Leslie, R.N., Shono, K., Eds.; Food and Agriculture Organi-zation of the United Nations; Regional Office for Asia and the Pacific: Bangkok, Thailand, 2010; pp. 93–98. [Google Scholar]
  2. Kim, H.S.; Jung, C. Nutritional characteristics of edible insects as potential food materials. Korean J. Apic. 2013, 28, 1–8. [Google Scholar]
  3. Barennes, H.; Phimmasane, M.; Rajaonarivo, C. Insect Consumption to Address Undernutrition, a National Survey on the Prevalence of Insect Consumption among Adults and Vendors in Laos. PLoS ONE 2015, 10, e0136458. [Google Scholar] [CrossRef]
  4. Hanboonsong, Y.; Durst, P.B. Edible Insects in Lao PDR: Building on Tradition to Enhance Food Security; Food and Agriculture Organization of the United Nations—Regional Office for Asia and the Pacific: Bangkok, Thailand, 2014. [Google Scholar]
  5. Carpenter, J.M.; Kojima, J. Checklist of the species in the subfamily Vespinae (Insects: Hymenoptera: Vespinae). Nat. Hist. Bull. Ibaraki Univ. 1997, 1, 51–92. [Google Scholar]
  6. Leksawasdi, P. Compendium of research on selected edible insects in northern Thailand. In Forest Insects as Food: Human Bites Back; Durst, P.B., Johnson, D.V., Leslie, R.N., Shono, K., Eds.; Food and Agriculture Organization of the United Nations—Regional Office for Asia and the Pacific: Bangkok, Thailand, 2010; pp. 183–188. [Google Scholar]
  7. Nonaka, K. Feasting on insects. Èntomol. Res. 2009, 39, 304–312. [Google Scholar] [CrossRef]
  8. Payne, C.L.R.; Evans, J.D. Nested Houses: Domestication dynamics of human-wasp relations in contemporary rural Japan. J. Ethnobiol. Ethnomedicine 2017, 13, 13. [Google Scholar] [CrossRef] [Green Version]
  9. Pemberton, R.W. Insects and other arthropods used as drugs in Korean traditional medicine. J. Ethnopharmacol. 1999, 65, 207–216. [Google Scholar] [CrossRef]
  10. Meyer-Rochow, V.B. Therapeutic arthropods and other largely terrestrial folk-medicinally important invertebrates: A comparative survey and review. J. Ethnobiol. Ethnomedicine 2017, 13, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Jung, C.; Kim, D.W.; Lee, H.S.; Baek, H. Some Biological Characteristics of a New Honeybee Pest, Vespa velutina nigrithorax Buysson, 1905 (Hymenoptera: Vespidae). Korean J. Apic. 2009, 24, 61–65. [Google Scholar]
  12. Jung, C. Initial state risk assessment of an invasive hornet, Vespa velutina nigrithorax Buysson (Hymenoptera: Vespidae) in Korea. Korean J. Apic. 2012, 27, 95–104. [Google Scholar]
  13. Monceau, K.; Bonnard, O.; Thiéry, D. Vespa velutina: A new invasive predator of honeybees in Europe. J. Pest Sci. 2014, 87, 1–16. [Google Scholar] [CrossRef]
  14. Shah, F.A.; Shah, T.A. Vespa Velutina, a Serious Pest of Honey Bees in Kashmir. Bee World 1991, 72, 161–164. [Google Scholar] [CrossRef]
  15. Abrol, D.P. Ecology, behaviour and management of social wasp, Vespa velutina Smith (Hymenoptera: Vespidae), attacking honeybee colonies. Korean J. Apic. 1994, 9, 5–10. [Google Scholar]
  16. Tan, K.; Radloff, S.E.; Li, J.J.; Hepburn, H.R.; Yang, M.X.; Zhang, L.J.; Neumann, P. Bee-hawking by the wasp, Vespa velutina, on the honeybees Apis cerana and A. mellifera. Naturwissenschaften 2007, 94, 469–472. [Google Scholar] [CrossRef] [PubMed]
  17. Ono, M.; Okada, I.; Sasaki, M. Heat production by balling in the Japanese honeybee, Apis cerana japonica as a defensive behavior against the hornet Vespa simillima xanthoptera (Hymenoptera: Vespidae). Cell. Mol. Life Sci. 1987, 43, 1031–1034. [Google Scholar] [CrossRef]
  18. Jung, C. Spatial expansion of an invasive hornet, Vespa velutina nigrithorax Buysson (Hymenoptera: Vespidae) in Korea. Korean J. Apic. 2012, 27, 87–93. [Google Scholar]
  19. Park, J.-J.; Jung, C. Risk Prediction of the Distribution of Invasive Hornet, Vespa velutina nigrothorax in Korea using CLIMEX Model. J. Apic. 2016, 31, 293–303. [Google Scholar] [CrossRef]
  20. Jung, C.; Kang, M.S.; Kim, D.W.; Lee, H.S. Vespid Wasps (Hymenoptera) Occurring Around Apiaries in Andong, Korea-I. Taxonomy and life history. Korean J. Apic. 2007, 22, 53–62. [Google Scholar]
  21. Choi, M.B.; Kim, J.K.; Lee, J.W. Checklist and Distribution of Korean Vespidae Revisited. Korean J. Appl. Èntomol. 2013, 52, 85–91. [Google Scholar] [CrossRef] [Green Version]
  22. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  23. Hebert, P.D.; Ratnasingham, S.; de Waard, J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. B Biol. Sci. 2003, 270, S96–S99. [Google Scholar] [CrossRef] [Green Version]
  24. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999, 41, 95–98. [Google Scholar]
  25. AOAC. Official Methods of Analysis of the AOAC, 15th ed.; Association of official analytical chemists: Washington, DC, USA, 1990. [Google Scholar]
  26. FAO/WHO/UNU. Protein and Amino Acid Requirements in Human Nutrition, Report of a FAO/WHO/UNU Expert Consultation; WHO Technical Report Series no. 935; World Health Organisation: Geneva, Switzerland, 2007. [Google Scholar]
  27. Millward, D.J. Amino acid scoring patterns for protein quality assessment. Br. J. Nutr. 2012, 108, S31–S43. [Google Scholar] [CrossRef] [Green Version]
  28. Ministry of Food and Drug Safety. Korean Food Standard Codex; Ministry of Food and Drug Safety: Cheongju, Korea, 2010. [Google Scholar]
  29. Pickering, M.V.; Newton, P. Amino acid hydrolysis: Old problems, new solutions. Lc Gc 1990, 8, 778–781. [Google Scholar]
  30. Jeong, H.; Kim, J.M.; Kim, B.; Nam, J.-O.; Hahn, D.; Choi, M.B. Nutritional Value of the Larvae of the Alien Invasive Wasp Vespa velutina nigrithorax and Amino Acid Composition of the Larval Saliva. Foods 2020, 9, 885. [Google Scholar] [CrossRef] [PubMed]
  31. Curtis, C.R.; Watkins, J.C. The pharmacology of amino acids related to gamma-aminobutyric acid. Pharmacol. Rev. 1965, 17, 347–391. [Google Scholar]
  32. Abe, T.; Tanaka, Y.; Miyazaki, H.; Kawasaki, Y.Y. Comparative study of the composition of hornet larval saliva, its effect on bahviour and role of trophallaxis. Comp. Biochem. Physiol. Part C Comp. Pharmacol. 1991, 99C, 79–84. [Google Scholar]
  33. Beenakkers, A.M.T.; Horst, D.J.V.; Marrewijk, J.A.V. Biochemical process directed to flight muscle metabolism. In Comprehensive Insect Physiology, Biochemistry and Pharmacology; Kerkut, G.A., Gilbert, L.I., Eds.; Pergamon Press: Oxford, UK, 1985; Volume 10, pp. 451–486. [Google Scholar]
  34. Matsuura, M.; Sakagami, S.F. A bionomic sketch of the giant hornet, Vespa mandarinia, a serious pest for Japanese apiculture. J. Fac. Sci. Hokkaido Univ. Ser. VI Zoo. 1973, 19, 125–162. [Google Scholar]
  35. Sánchez, X.F.; Charles, R.J. Notes on the nest-architecture and colony composition in winter of the Yellow-legged Asian hornet, Vespa velutina Lepeletier 1836 (Hym.: Vespidae), in its introduced habitat in Galicia (NW Spain). Insects 2019, 10, 237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Ghosh, S.; Jung, C.; Meyer-Rochow, V.B. Nutritional value and chemical composition of larvae, pupae, and adults of worker honey bee, Apis mellifera ligustica as a sustainable food source. J. Asia Pac. Èntomol. 2016, 19, 487–495. [Google Scholar] [CrossRef]
  37. Ghosh, S.; Jung, C.; Choi, K.; Choi, H.Y.; Kim, H.W.; Kim, S. Body fat and amino acid composition of a native bumblebee, Bombus ignitus relative to B. terrestris of foreign origin in Korea. J. Apic. 2017, 32, 111–117. [Google Scholar] [CrossRef]
  38. Ghosh, S.; Choi, K.; Kim, S.; Jung, C. Body Compositional Changes of Fatty Acid and Amino Acid from the Queen of Bumblebee, Bombus terrestris during Overwintering. J. Apic. 2017, 32, 11–18. [Google Scholar] [CrossRef] [Green Version]
  39. Ghosh, S.; Sohn, H.-Y.; Pyo, S.-J.; Jensen, A.B.; Meyer-Rochow, V.B.; Jung, C. Nutritional Composition of Apis mellifera Drones from Korea and Denmark as a Potential Sustainable Alternative Food Source: Comparison Between Developmental Stages. Foods 2020, 9, 389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Tomé, D.; Bos, C. Lysine Requirement through the Human Life Cycle. J. Nutr. 2007, 137, 1642S–1645S. [Google Scholar] [CrossRef] [Green Version]
  41. Chakravorty, J.; Ghosh, S.; Jung, C.; Meyer-Rochow, V. Nutritional composition of Chondacris rosea and Brachytrupes orientalis: Two common insects used as food by tribes of Arunachal Pradesh, India. J. Asia Pac. Èntomol. 2014, 17, 407–415. [Google Scholar] [CrossRef]
  42. Ghosh, S.; Lee, S.-M.; Jung, C.; Meyer-Rochow, V. Nutritional composition of five commercial edible insects in South Korea. J. Asia Pac. Èntomol. 2017, 20, 686–694. [Google Scholar] [CrossRef]
  43. Ayieko, M.A.; Kinyuru, J.N.; Ndonģa, M.F.; Kenji, G.M. Nutritional value and consumption of black ants (Carebara vidua Smith) from the Lake Victoria region in Kenya. Adv. J. Food Sci. Technol. 2012, 4, 39–45. [Google Scholar]
  44. Sihamala, O.; Bhulaidok, S.; Shen, L.R.; Li, D. Lipids and fatty acid composition of dried edible red and black ants. Agric. Sci. China 2010, 9, 1072–1077. [Google Scholar]
  45. Bhulaidok, S.; Sihamala, O.; Shen, L.; Li, D. Nutritional and fatty acid profiles of sun dried edible black ants (Polyrhachis vicina Roger). Majeo Int. J. Sci. Technol. 2010, 4, 101–112. [Google Scholar]
  46. Chakravorty, J.; Ghosh, S.; Megu, K.; Jung, C.; Meyer-Rochow, V. Nutritional and anti-nutritional composition of Oecophylla smaragdina (Hymenoptera: Formicidae) and Odontotermes sp. (Isoptera: Termitidae): Two preferred edible insects of Arunachal Pradesh, India. J. Asia Pac. Èntomol. 2016, 19, 711–720. [Google Scholar] [CrossRef]
  47. Lehtovaara, V.; Valtonen, A.; Sorjonen, J.; Hiltunen, M.; Rutaro, K.; Malinga, G.; Nyeko, P.; Roininen, H. The fatty acid contents of the edible grasshopper Ruspolia differens can be manipulated using artificial diets. J. Insects Food Feed. 2017, 3, 253–262. [Google Scholar] [CrossRef]
  48. Rutaro, K.; Malinga, G.M.; Lehtovaara, V.J.; Opoke, R.; Nyeko, P.; Roininen, H.; Valtonen, A. Fatty acid content and composition in edible Ruspolia differens feeding on mixtures of natural food plants. BMC Res. Notes 2018, 11, 687. [Google Scholar] [CrossRef]
  49. Mensink, R.P. Effects of the individual saturated fatty acids on serum lipids and lipoprotein concentrations. Am. J. Clin. Nutr. 1993, 57, 711S–714S. [Google Scholar] [CrossRef] [Green Version]
  50. Aluko, R.E. Functional Foods and Nutraceuticals; Springer: New York, NY, USA, 2012. [Google Scholar]
  51. Grundy, S.M. Comparison of Monounsaturated Fatty Acids and Carbohydrates for Lowering Plasma Cholesterol. N. Engl. J. Med. 1986, 314, 745–748. [Google Scholar] [CrossRef] [PubMed]
  52. Abeywardena, M.Y.; Patten, G.S. Role of ω3 long-chain polyunsaturated fatty acids in reducing cardio-metabolic risk factors. Endocr. Metab. Immune Disord. Drug Targets 2011, 11, 232–246. [Google Scholar] [CrossRef] [PubMed]
  53. Bagge, C.N.; Strandhave, C.; Skov, C.M.; Svensson, M.; Schmidt, E.B.; Christensen, J.H. Marine n-3 polyunsaturated fatty acids affect the blood pressure control in patients with newly diagnosed hypertension—A 1-year follow-up study. Nutr. Res. 2017, 38, 71–78. [Google Scholar] [CrossRef] [PubMed]
  54. Cabo, J.; Alonso, R.; Mata, P. Omega-3 fatty acids and blood pressure. Br. J. Nutr. 2012, 107, S195–S200. [Google Scholar] [CrossRef] [Green Version]
  55. Rumpold, B.A.; Schlüter, O.K. Nutritional composition and safety aspects of edible insects. Mol. Nutr. Food Res. 2013, 57, 802–823. [Google Scholar] [CrossRef]
  56. He, F.J.; MacGregor, G.A. Beneficial effects of potassium on human health. Physiol. Plant. 2008, 133, 725–735. [Google Scholar] [CrossRef]
  57. Doyle, M.E.; Glass, K.A. Sodium Reduction and Its Effect on Food Safety, Food Quality, and Human Health. Compr. Rev. Food Sci. Food Saf. 2010, 9, 44–56. [Google Scholar] [CrossRef]
  58. Iwahori, T.; Miura, K.; Ueshima, H. Time to Consider Use of the Sodium-to-Potassium Ratio for Practical Sodium Reduction and Potassium Increase. Nutrients 2017, 9, 700. [Google Scholar] [CrossRef]
  59. Institute of Medicine (US) Standing Committee on the Scientific Evaluation of Dietary Reference Intakes. Dietary Reference Intakes for Calcium, Phosphorus, Magnesium, Vitamin D, and Fluoride; National Academies Press: Washington, DC, USA, 1997. [Google Scholar]
  60. Gennari, C.; Lezama, I.; Lockwood, K.; Bergmann, T. Calcium and vitamin D nutrition and bone disease of the elderly. Public Health Nutr. 2001, 4, 547–559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Power, M.L.; Heaney, R.P.; Kalkwarf, H.J.; Pitkin, R.M.; Repke, J.T.; Tsang, R.C.; Schulkin, J. The role of calcium in health and disease. Am. J. Obstet. Gynecol. 1999, 181, 1560–1569. [Google Scholar] [CrossRef]
  62. Ramakrishnan, U.; Imhoff-Kunsch, B. Anemia and Iron Deficiency in Developing Countries. In Handbook of Nutrition and Pregnancy; Springer International Publishing: New York, NY, USA, 2008; pp. 337–354. [Google Scholar]
  63. Lutter, C.K. Iron Deficiency in Young Children in Low-Income Countries and New Approaches for Its Prevention. J. Nutr. 2008, 138, 2523–2528. [Google Scholar] [CrossRef]
  64. The Problem: About Iron Deficiency. Available online: http://www.unicef.org/nutrition/23964_iron.html (accessed on 27 August 2019).
  65. Gupta, A.; Gadipudi, A. Iron deficiency anaemia in pregnancy: Developed versus developing countries. EMJ Hematol. 2018, 6, 101–109. [Google Scholar]
  66. Aggett, P.J.; Comerford, J.G. Zinc and human health. Nutr. Rev. 1995, 53, S16–S22. [Google Scholar] [PubMed]
  67. Caulfield, L.E.; Black, R.E. Zinc deficiency, In Comparative Quantification of Health Risks: Global and Regional Burden of Disease Attributable to Selected Major Risk Factors; Ezzati, M., Lopez, A.D., Rodgers, A., Murray, C.J.L., Eds.; World Health Organization: Geneva, Switzerland, 2004; Volume 1, pp. 257–279. [Google Scholar]
  68. Maxfield, L.; Crane, J.S. Zinc Deficiency. Available online: https://www.ncbi.nlm.nih.gov/books/NBK493231/ (accessed on 28 August 2019).
  69. Wessells, K.R.; Brown, K.H. Estimating the Global Prevalence of Zinc Deficiency: Results Based on Zinc Availability in National Food Supplies and the Prevalence of Stunting. PLoS ONE 2012, 7, e50568. [Google Scholar] [CrossRef] [Green Version]
  70. Meyer-Rochow, V.B. Can insects help to ease the problem of world food shortage? Search 1975, 6, 261–262. [Google Scholar]
  71. Han, R.; Shin, J.T.; Kim, J.; Choi, Y.S.; Kim, Y.W. An overview of the South Korean edible insect food industry: Challenges and future pricing/promotion strategies. Èntomol. Res. 2017, 47, 141–151. [Google Scholar] [CrossRef]
  72. Kim, T.-K.; Yong, H.I.; Kim, Y.-B.; Kim, H.-W.; Choi, Y.-S. Edible Insects as a Protein Source: A Review of Public Perception, Processing Technology, and Research Trends. Food Sci. Anim. Resour. 2019, 39, 521–540. [Google Scholar] [CrossRef] [Green Version]
  73. Meyer-Rochow, V.B.; Ghosh, S.; Jung, C. Farming of insects for food and feed in South Korea: Tradition and innovation. Berl. Münchener Tierärztliche Wochenschr. 2019, 131, 236–244. [Google Scholar] [CrossRef]
Figure 1. (A) bottled hornet larvae sold in China; (B) hebo (Vespula sp.) contest in which judges evaluate wasp nests by weight in search for the largest nest of domestically raised wasps. [Photo credit: Soleil Ho; source: https://www.splendidtable.org/story/the-japanese-tradition-of-raising-and-eating-wasps, accessed on 31 August 2019]; (C) larvae of Vespa velutina collected from the forest near Andong (Korea); (D) pupae of Vespa velutina collected from the forest near Andong (Korea); (E) range expansion of the invasive hornet Vespa velutina in Korea [Source: 19]; (F) canned hachinoko (wasp brood) in Japan; (G) practice of eating wasps in Yunnan province [Source: http://teaurchin.blogspot.com/2011/10/weird-things-ive-eaten-in-yunnan.html, accessed on 31 August 2019].
Figure 1. (A) bottled hornet larvae sold in China; (B) hebo (Vespula sp.) contest in which judges evaluate wasp nests by weight in search for the largest nest of domestically raised wasps. [Photo credit: Soleil Ho; source: https://www.splendidtable.org/story/the-japanese-tradition-of-raising-and-eating-wasps, accessed on 31 August 2019]; (C) larvae of Vespa velutina collected from the forest near Andong (Korea); (D) pupae of Vespa velutina collected from the forest near Andong (Korea); (E) range expansion of the invasive hornet Vespa velutina in Korea [Source: 19]; (F) canned hachinoko (wasp brood) in Japan; (G) practice of eating wasps in Yunnan province [Source: http://teaurchin.blogspot.com/2011/10/weird-things-ive-eaten-in-yunnan.html, accessed on 31 August 2019].
Foods 10 00418 g001
Table 1. Amino acid composition (g/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods, requirement of indispensable amino acid and amino acid scoring pattern as per the WHO/FAO/UNU [26] and amino acid scoring pattern (%).
Table 1. Amino acid composition (g/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods, requirement of indispensable amino acid and amino acid scoring pattern as per the WHO/FAO/UNU [26] and amino acid scoring pattern (%).
ChinaKoreaIndispensable Amino Acid Requirements 1Amino Acid Scoring Pattern 1
Vespa velutinaVespa mandariniaVespa basalisVespa velutinamg/kg Per Daymg/g ProteinAmino Acid Score
Vespa velutinaVespa mandariniaVespa basalisVespa velutina
Leucine *3.3 ± 0.18 b3.2 ± 0.33 b2.4 ± 0.16 c4.3 ± 0.32 a3959145.8149.3145.0143.7
Valine *2.3 ± 0.15 b2.3 ± 0.24 b1.6 ± 0.11 c3.2 ± 0.25 a2639152.2158.3149.9161.5
Isoleucine *2.1 ± 0.17 ab2.1 ± 0.19 b1.5 ± 0.07 c2.7 ± 0.28 a2030188.2185.8177.1174.9
Methionine *0.6 ± 0.04 a0.3 ± 0.33 a0.3 ± 0.07 aND101692.357.873.5ND
Cysteine0.3 ± 0.28 a0.7 ± 0.68 a0.1 ± 0.01 a2.0 ± 1.13 a46123.1312.777.2643.6
Lysine *2.3 ± 0.03 ab2.3 ± 0.22 ab1.9 ± 0.23 b2.7 ± 0.07 a3045134.2137.2148.9116.6
Threonine *1.6 ± 0.05 b1.6 ± 0.12 b1.2 ± 0.13 b2.3 ± 0.14 a1523188.1183.2182.9193.7
Histidine *1.2 ± 0.09 b1.2 ± 0.21 b0.9 ± 0.06 b1.7 ± 0.14 a1015212.8208.5211.5217.8
Phenylalanine *1.6 ± 0.01 ab1.6 ± 0.39 ab1.2 ± 0.16 b2.1 ± 0.07 a2538286.7311.2296.5283.0
Tyrosine **2.5 ± 0.10 ab2.7 ± 0.38 ab2.0 ± 0.13 b3.3 ± 0.46 a
Arginine ***1.7 ± 0.05 ab0.8 ± 0.86 b1.2 ± 0.13 ab2.2 ± 0.18 a
Aspartic acid2.4 ± 0.06 b2.4 ± 0.45 b1.8 ± 0.28 b3.7 ± 0.04 a
Glutamic acid7.6 ± 0.19 a7.8 ± 1.6 a6.2 ± 1.04 a9.0 ± 0.96 a
Serine1.7 ± 0.12 b1.6 ± 0.09 bc1.2 ± 0.13 c2.4 ± 0.28 a
Proline2.3 ± 0.23 a2.1 ± 0.17 a1.6 ± 0.05 b2.4 ± 0.11 a
Glycine2.4 ± 0.60 ab2.3 ± 0.34 ab1.6 ± 0.13 b3.4 ± 1.03 a
Alanine2.1 ± 0.69 a2.0 ± 0.51 a1.4 ± 0.16 a3.4 ± 1.27 a
Total37.9 ± 1.65 b36.8 ± 2.37 b28.1 ± 2.22 c50.5 ± 4.74 a
* Essential amino acid. ** Conditional essential amino acid. *** Essential amino acid for children. 1 All the values were obtained for the adult population from the WHO/FAO/UNU 2007 report of a joint WHO/FAO/UNU Expert Consultation on protein and amino acid requirements in human nutrition. ND = Not detected. Superscripts indicate significant difference (p ≤ 0.05).
Table 2. Fatty acid composition (g/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods. Superscripts indicate a significant difference (p ≤ 0.05) for selected predominating fatty acids.
Table 2. Fatty acid composition (g/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods. Superscripts indicate a significant difference (p ≤ 0.05) for selected predominating fatty acids.
ChinaKorea
Vespa velutinaVespa mandariniaVespa basalisVespa velutina
Saturated Fatty Acids
Capric acidNDNDND<0.01
Lauric acid0.2 ± 0.040.2 ± 0.040.1 ± 0.020.3 ± 0.02
Tridecanoic acidNDNDND0.01 ± 0.00
Myristic acid0.7 ± 0.14 a0.5 ± 0.17 ab0.3 ± 0.06 b0.8 ± 0.11 a
Palmitic acid3.7 ± 0.49 a4.3 ± 0.24 a3.5 ± 0.01 a3.5 ± 0.28 a
Heptadecanoic acid0.02 ± 0.000.02 ± 0.000.04 ± 0.000.02 ± 0.00
Stearic acid0.9 ± 0.061.0 ± 0.171.2 ± 0.010.7 ± 0.00
Arachidic acid0.1 ± 0.010.2 ± 0.030.2 ± 0.020.1 ± 0.00
Behenic acidND0.1 ± 0.020.1 ± 0.010.1 ± 0.00
Lignoceric acidND0.01 ± 0.010.03 ± 0.000.1 ± 0.01
Subtotal5.6 ± 0.71 a6.2 ± 0.21 a5.4 ± 0.05 a5.4 ± 0.42 a
Monounsaturated Fatty Acids
Myristoleic acid0.02 ± 0.01NDND0.03 ± 0.01
Palmitoleic acid0.4 ± 0.100.2 ± 0.050.1 ± 0.000.4 ± 0.06
cis-10-Heptadecenoic acid0.01 ± 0.02NDND0.01 ± 0.00
Oleic acid4.1 ± 0.44 b5.6 ± 0.55 a5.3 ± 0.29 a4.1 ± 0.28 b
cis-11-Eocosenic acidND0.1 ± 0.060.14 ± 0.0270.5 ± 0.01
Subtotal4.6 ± 0.56 a5.9 ± 0.56 a5.6 ± 0.31 a5.1 ± 0.37 a
Polyunsaturated Fatty Acids
Linoleic acid0.6 ± 0.11 b6.8 ± 3.09 a9.5 ± 1.96 a0.6 ± 0.02 b
Linolenic acid0.8 ± 0.111.2 ± 0.301.8 ± 0.01ND
Arachidonic acid0.04 ± 0.03NDND0.02 ± 0.00
cis-5,8,11,14,17-Eicosapentaenoic acid0.03 ± 0.02NDNDND
Subtotal1.4 ± 0.05 b8.1 ± 3.39 a11.2 ± 1.98 a0.6 ± 0.04 b
Total11.5 ± 1.31 b20.1 ± 3.75 a22.2 ± 2.25 a11.1 ± 0.82 b
ND = Not detected. Superscripts indicate significant difference (p ≤ 0.05).
Table 3. Mineral contents (mg/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods and recommended dietary allowance (RDA) or population reference intakes (PRI) and satisfying the requirement in %
Table 3. Mineral contents (mg/100 g dry matter, mean ± SD, duplicate analysis with composite sampling process) of different Vespa species broods and recommended dietary allowance (RDA) or population reference intakes (PRI) and satisfying the requirement in %
ChinaKoreaRDA 1PRI/AI 2Satisfying the Requirement as per PRI/AI2 by 100 g of Consumption of Respective Vespa Brood (in %) 3
Vespa velutinaVespa mandariniaVespa basalisVespa velutina
Vespa velutinaVespa mandariniaVespa basalisVespa velutinaMFMFMFMFMFMF
Ca38.8 ± 0.04 b27.4 ± 0.20 c31.8 ± 0.34 bc46.3 ± 5.22 a10009504.12.93.34.9
Mg63.9 ± 0.01 a33.0 ± 0.44 c38.2 ± 0.24 b66.3 ± 2.16 a400310350 300 18.321.39.411.010.912.718.922.1
Na10.4 ± 0.02 c30.8 ± 0.40 b8.9 ± 0.09 c61.5 ± 5.44 a1500 *3800 *----0.70.32.10.80.60.24.11.6
K751.6 ± 0.87 a422.7 ± 6.58 b404.4 ± 0.01 b718.6 ± 69.87 a3400 *2600 *3500 21.512.111.620.5
P561.2 ± 1.18 a322.5 ± 2.93 b318.4 ± 4.90 b641.9 ± 71.37 a700550 102.058.657.9116.7
Fe10.0 ± 0.12 a7.2 ± 0.41 b5.0 ± 0.18 c9.1 ± 0.89 a818111690.962.565.545.045.531.382.756.9
Zn7.2 ± 0.02 a4.7 ± 0.01 c5.1 ± 0.04 c6.1 ± 0.71 b1189.47.576.696.050.062.754.368.064.981.3
Mn0.6 ± 0.02 ab0.1 ± 0.01 b1.2 ± 0.68 ab2.8 ± 1.49 a2.3 *1.8 *3 20.03.340.093.3
Cu2.2 ± 0.04 a0.9 ± 0.01 d1.1 ± 0.04 c1.3 ± 0.04 b9001.6 1.3 137.5169.256.369.268.884.681.3100.0
1 Recommended dietary allowance (RDA) values were obtained from the Micronutrient Information Center, Linus Pauling Institute, Oregon State University [www.lpi.oregonstate.edu/mic/minerals, accessed 9 February 2021]. All the values are for adult (>19–50) populations and provided in mg/day except for copper, which is in µg/day. M = male; F = female. * indicates the adequate intake (AI) values. 2 Population reference intakes (PRIs) and adequate intakes (AIs) for minerals were obtained from the European Food Safety Authority (EFSA) [www.efsa.europa.eu/sites/deafult/files/assets/DRV_Summary_tables_jan_17.pdf, accessed 9 February 2021]. All values are for adult (>25 years) populations and provided in mg/day. indicates the adequate intake (AI) values. 3 Sodium (Na) was calculated based on the value provided by the Linus Pauling Institute, Oregon State University; all others were based on values provided by the European Food Safety Authority (EFSA). Superscripts indicate significant difference (p ≤ 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ghosh, S.; Namin, S.M.; Meyer-Rochow, V.B.; Jung, C. Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods 2021, 10, 418. https://doi.org/10.3390/foods10020418

AMA Style

Ghosh S, Namin SM, Meyer-Rochow VB, Jung C. Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods. 2021; 10(2):418. https://doi.org/10.3390/foods10020418

Chicago/Turabian Style

Ghosh, Sampat, Saeed Mahamadzade Namin, Victor Benno Meyer-Rochow, and Chuleui Jung. 2021. "Chemical Composition and Nutritional Value of Different Species of Vespa Hornets" Foods 10, no. 2: 418. https://doi.org/10.3390/foods10020418

APA Style

Ghosh, S., Namin, S. M., Meyer-Rochow, V. B., & Jung, C. (2021). Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods, 10(2), 418. https://doi.org/10.3390/foods10020418

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop