Serum-Free Medium Supplemented with Haematococcus pluvialis Extracts for the Growth of Human MRC-5 Fibroblasts
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of H. pluvialis Extracts (HE)
2.3. Determination of the Composition of Monosaccharides in HE
2.4. Determination of Fatty Acid Components of HE
2.5. Determination of the Composition of Free-Amino Acid in HE
2.6. Cell Culture
2.7. Cell Viability and Proliferation
2.8. Cell Cycle Analysis
2.9. Quantitative Real-Time Polymerase Chain Reaction
2.10. Statistical Analysis
3. Results
3.1. Nutritional Composition of HE
3.2. Effects of Serum-Free Media Supplemented with HE on Cell Proliferation
3.3. Effects of Serum-Free Media Supplemented with GFs on Cell Proliferation
3.4. Effects of Serum-Free Media Supplemented with GFs and HE on Cell Growth and Cell Cycle Progression
3.5. Effects of Serum-Free Media Supplemented with GFs and HE on Regulators of Cell Cycle Progression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, S.; Yang, W.; Li, Y.; Sun, C. Fetal bovine serum, an important factor affecting the reproducibility of cell experiments. Sci. Rep. 2023, 13, 1942. [Google Scholar] [CrossRef] [PubMed]
- Chelladurai, K.S.; Christyraj, J.D.S.; Rajagopalan, K.; Yesudhason, B.V.; Venkatachalam, S.; Mohan, M.; Vasantha, N.C.; Christyraj, J.R.S.S. Alternative to FBS in animal cell culture-An overview and future perspective. Heliyon 2021, 7, e07686. [Google Scholar] [CrossRef] [PubMed]
- Pilgrim, C.R.; McCahill, K.A.; Rops, J.G.; Dufour, J.M.; Russell, K.A.; Koch, T.G. A review of fetal bovine serum in the culture of mesenchymal stromal cells and potential alternatives for veterinary medicine. Front. Vet. Sci. 2022, 9, 859025. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z. Regulation of cell cycle progression by growth factor-induced cell signaling. Cells 2021, 10, 3327. [Google Scholar] [CrossRef]
- Heber-Katz, E.; Zhang, Y.; Bedelbaeva, K.; Song, F.; Chen, X.; Stocum, D.L. Cell cycle regulation and regeneration. New Perspect. Regen. 2013, 367, 253–276. [Google Scholar]
- Lee, S.Y.; Yun, S.H.; Jeong, J.W.; Kim, J.H.; Kim, H.W.; Choi, J.S.; Kim, G.-D.; Joo, S.T.; Choi, I.; Hur, S.J. Review of the current research on fetal bovine serum and the development of cultured meat. Food Sci. Anim. Resour. 2022, 42, 775. [Google Scholar] [CrossRef]
- Dong, N.; Xue, C.; Yang, Y.; Chang, Y.; Wang, Y.; Guo, H.; Liu, Y.; Wang, Y. Auxenochlorella pyrenoidosa extract supplementation replacing fetal bovine serum for Carassius auratus muscle cell culture under low-serum conditions. Food Res. Int. 2023, 164, 112438. [Google Scholar] [CrossRef]
- Amirvaresi, A.; Ovissipour, R. Evaluation of Plant-and Microbial-Derived Protein Hydrolysates as Substitutes for Fetal Bovine Serum in Cultivated Seafood Cell Culture Media. BioRxiv 2024. [Google Scholar] [CrossRef]
- Chen, C.; Tang, T.; Shi, Q.; Zhou, Z.; Fan, J. The potential and challenge of microalgae as promising future food sources. Trends Food Sci. Technol. 2022, 126, 99–112. [Google Scholar] [CrossRef]
- Jeong, Y.; Choi, W.-Y.; Park, A.; Lee, Y.-J.; Lee, Y.; Park, G.-H.; Lee, S.-J.; Lee, W.-K.; Ryu, Y.-K.; Kang, D.-H. Marine cyanobacterium Spirulina maxima as an alternate to the animal cell culture medium supplement. Sci. Rep. 2021, 11, 4906. [Google Scholar] [CrossRef]
- Defendi-Cho, G.; Gould, T.M. In vitro culture of bovine fibroblasts using select serum-free media supplemented with Chlorella vulgaris extract. BMC Biotechnol. 2023, 23, 4. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, J.; Akiyama, Y.; Haraguchi, Y.; Yamanaka, K.; Asahi, T.; Nakao, Y.; Shimizu, T. Proliferation of mammalian cells with Chlorococcum littorale algal compounds without serum support. Biotechnol. Prog. 2024, 40, e3402. [Google Scholar] [CrossRef] [PubMed]
- Mularczyk, M.; Michalak, I.; Marycz, K. Astaxanthin and other nutrients from Haematococcus pluvialis—Multifunctional applications. Mar. Drugs 2020, 18, 459. [Google Scholar] [CrossRef]
- Oslan, S.N.H.; Tan, J.S.; Oslan, S.N.; Matanjun, P.; Mokhtar, R.A.M.; Shapawi, R.; Huda, N. Haematococcus pluvialis as a potential source of astaxanthin with diverse applications in industrial sectors: Current research and future directions. Molecules 2021, 26, 6470. [Google Scholar] [CrossRef]
- Jannel, S.; Caro, Y.; Bermudes, M.; Petit, T. Novel insights into the biotechnological production of Haematococcus pluvialis-derived astaxanthin: Advances and key challenges to allow its industrial use as novel food ingredient. J. Mar. Sci. Eng. 2020, 8, 789. [Google Scholar] [CrossRef]
- Ryu, Y.-K.; Lee, W.-K.; Choi, W.-Y.; Kim, T.; Lee, Y.-J.; Park, A.; Kim, T.; Oh, C.; Heo, S.-J.; Kim, J.H. A novel drying film culture method applying a natural phenomenon: Increased carotenoid production by Haematococcus sp. Bioresour. Technol. 2023, 390, 129827. [Google Scholar] [CrossRef]
- Willoughby, R.; Pomponi, S.A. Quantitative assessment of marine sponge cells in vitro: Development of improved growth medium. In Vitro Cell. Dev. Biol. Anim. 2000, 36, 194–200. [Google Scholar] [CrossRef]
- Yun, S.H.; Lee, S.Y.; Lee, J.; Joo, S.T.; Choi, I.; Choi, J.S.; Kim, G.D.; Lee, J.; Choi, S.-H.; Hur, S.J. Analysis of commercial fetal bovine serum (FBS) and its substitutes in the development of cultured meat. Food Res. Int. 2023, 174, 113617. [Google Scholar]
- Salazar, A.; Keusgen, M.; Von Hagen, J. Amino acids in the cultivation of mammalian cells. Amino Acids 2016, 48, 1161–1171. [Google Scholar] [CrossRef]
- Dulbecco, R.; Freeman, G. Plaque production by the polyoma virus. Virology 1959, 8, 396–397. [Google Scholar] [CrossRef]
- Jones, S.M.; Kazlauskas, A. Growth factor-dependent signaling and cell cycle progression. Chem. Rev. 2001, 101, 2413–2424. [Google Scholar] [CrossRef] [PubMed]
- Gross, S.M.; Rotwein, P. Unraveling growth factor signaling and cell cycle progression in individual fibroblasts. J. Biol. Chem. 2016, 291, 14628–14638. [Google Scholar] [CrossRef] [PubMed]
- Prickett, T.D.; Samuels, Y. Molecular pathways: Dysregulated glutamatergic signaling pathways in cancer. Clin. Cancer Res. 2012, 18, 4240–4246. [Google Scholar] [CrossRef] [PubMed]
- Matés, J.M.; Pérez-Gómez, C.; de Castro, I.N.; Asenjo, M.; Márquez, J. Glutamine and its relationship with intracellular redox status, oxidative stress and cell proliferation/death. Int. J. Biochem. Cell Biol. 2002, 34, 439–458. [Google Scholar] [CrossRef]
- Willard, S.S.; Koochekpour, S. Glutamate, glutamate receptors, and downstream signaling pathways. Int. J. Biol. Sci. 2013, 9, 948. [Google Scholar] [CrossRef]
Gene Name | Forward (5→3) | Reverse (5→3) |
---|---|---|
Cyclin A | GGTACTGAAGTCCGGGAACC | TGAACGCAGGCTGTTTACTG |
Cyclin D | GGCGGAGGAGAACAAACAGA | CTCCTCAGGTTCAGGCCTTG |
CDK1 | CTGGGGTCAGCTCGTTACTC | GGAGTGCCCAAAGCTCTGAA |
CDK2 | TCAAGCTGCTGGATGTCATTCA | CAGTGAGAGCAGAGGCATCCAT |
CDK4 | AGTGTGAGAGTCCCCAATGG | CCTTGATCTCCCGGTCAGTT |
CDK6 | TGGAGACCTTCGAGCACC | CACTCCAGGCTCTGGAACTT |
GAPDH | CAATGACCCCTTCATTGACC | GACAAGCTTCCCGTTCTCAG |
Monosaccharide Composition (%) | H. pluvialis Extracts (HE) |
---|---|
Galactose | 19.52 |
Glucose | 14.08 |
Fucose | 3.23 |
Arabinose | 3.47 |
Rhamnose | 0.40 |
Fatty Acid Composition (mg/g) | H. pluvialis Extracts (HE) |
---|---|
Palmitic acid | 4.136 |
Oleic acid | 0.949 |
Behenic acid (docosanoic acid) | 0.764 |
Linoleic acid | 0.685 |
Alpha-linolenic acid | 0.525 |
Myristic acid | 0.327 |
Stearic acid | 0.246 |
Arachidonic acid | 0.170 |
Lignoceric acid | 0.165 |
Palmitoleic acid | 0.163 |
Lauric acid (dodecanoic acid) | 0.119 |
Arachidic acid (icosanoic acid) | 0.094 |
Gamma-linolenic acid | 0.073 |
Eicosapentaenoic acid | 0.070 |
Amino Acid Composition (mg/kg) | H. pluvialis Extracts (HE) |
---|---|
Glutamic acid | 13,579 |
Aspatic acid | 10,669 |
Leucine | 7984 |
Isoleucine | 5306 |
Alanine | 7482 |
Valine | 6540 |
Glycine | 6296 |
Taurine | 6128 |
Arginine | 5827 |
Serine | 5797 |
Threonine | 5722 |
Phenylalanine | 5695 |
Lysine | 4742 |
Proline | 4362 |
Ornithine | 2853 |
Tyrosine | 2569 |
Histidine | 1242 |
Citrulline | 372 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koh, E.-J.; Heo, S.-Y.; Park, A.; Lee, Y.-J.; Choi, W.-Y.; Heo, S.-J. Serum-Free Medium Supplemented with Haematococcus pluvialis Extracts for the Growth of Human MRC-5 Fibroblasts. Foods 2024, 13, 3012. https://doi.org/10.3390/foods13183012
Koh E-J, Heo S-Y, Park A, Lee Y-J, Choi W-Y, Heo S-J. Serum-Free Medium Supplemented with Haematococcus pluvialis Extracts for the Growth of Human MRC-5 Fibroblasts. Foods. 2024; 13(18):3012. https://doi.org/10.3390/foods13183012
Chicago/Turabian StyleKoh, Eun-Jeong, Seong-Yeong Heo, Areumi Park, Yeon-Ji Lee, Woon-Yong Choi, and Soo-Jin Heo. 2024. "Serum-Free Medium Supplemented with Haematococcus pluvialis Extracts for the Growth of Human MRC-5 Fibroblasts" Foods 13, no. 18: 3012. https://doi.org/10.3390/foods13183012
APA StyleKoh, E.-J., Heo, S.-Y., Park, A., Lee, Y.-J., Choi, W.-Y., & Heo, S.-J. (2024). Serum-Free Medium Supplemented with Haematococcus pluvialis Extracts for the Growth of Human MRC-5 Fibroblasts. Foods, 13(18), 3012. https://doi.org/10.3390/foods13183012