Study on the Effect of Conditioners on the Degradation of Tetracycline Antibiotics in Deer Manure Composting

Abstract

The unscientific disposal of agricultural solid waste introduces more antibiotics and other pollutants into the environment. Composting, as an environmentally friendly solid waste disposal method, can be used as a green way to degrade antibiotics, and conditioners can regulate the physicochemical indicators of the composting process. This article investigates the removal mechanism of tetracycline antibiotics (TCs) during the composting process by adding different regulators (biochar, zeolite, and biochar + zeolite). The results showed that the conditioning agent could significantly improve the removal efficiency and removal rate of TCs in compost. Among them, the addition of the zeolite group had the highest degradation rate of TCs, which were 91.39% (Tetracycline), 97.18% (Chlortetracycline), and 95.68% (Oxytetracycline). The combination of biochar and zeolite conditioning agents effectively minimized the migration of TCs into the soil. According to the findings of the artificial neural network model, it was determined that TCs exhibited the highest sensitivity to biochar + zeolite modulators at 31.28%. Conditioners influenced the removal of TCs in compost by impacting their physicochemical properties and microbial community structure. We isolated and domesticated a suitable microbial preparation that promotes the degradation of TCs, including Acinetobacter pittii, Stenotrophomonas maltophilia, Lactobacillus reuteri, Pseudomonas putida, and Trichosporon dohaense.

1. Introduction

The deer industry in China is constantly developing and growing. With a population of over 55 million sika deer currently being raised, China is one of the world’s major countries for raising and consuming deer products [1]. Favorable policies and a prosperous market have facilitated the large-scale intensive breeding of Chinese sika deer. With the increase in the number of deer raised, more and more anthelmintics (mainly antibiotics) and antibacterial agents are being used to treat animal diseases. Tetracycline antibiotics (TCs) are one of the most commonly used antibiotics in animal husbandry. Due to the high water solubility of most antibiotics, up to 90% of the administered dose can be excreted in urine, and as much as 75% can be eliminated through animal feces. The inadequate biodegradation of these excretions results in an accumulation of antibiotic residues in the soil, potentially harming the environment [2,3,4]. The results of a nationwide assessment of fecal antibiotics in animals in China revealed that animals exhibited the highest concentrations of TCs. Among the 42 antibiotics evaluated, oxytetracycline (OTC), tetracycline (TC), and chlortetracycline (CTC) ranked as the top three [5]. Yang et al. [6] found high concentrations of residual TCs such as TC, OTC, and CTC in both Chinese organic fertilizer raw materials and commercial organic fertilizers. In addition, long-term low-dose TC can have adverse effects on the organisms exposed to it in the environment, including endocrine disorders, chronic toxicity, and antibiotic resistance [7]. These residues are released into agricultural soil after the application of livestock manure and can be subsequently transported to surface- and groundwater [8,9]. This can affect the structure and function of natural microbial communities, and may contribute to the spread of antibiotic-resistant bacteria (ARB) and antibiotic-resistant genes (ARGs) [10,11].

Many studies have shown that high-temperature aerobic composting was an effective way to remove TCs and make compost safer for use in farmland [12,13]. A quantitative analysis was conducted on articles on the direction of antibiotic degradation in composting, which were included in the core collection of Web of Science from 2013 to 2023. The results found that poultry manure composting is often associated with the removal of antibiotics and resistance genes. However, antibiotics are not fully degraded through traditional composting methods, and they can easily cause resistance genes to rebound exceeding their initial levels, which is not conducive to reducing their spread [14]. Previous studies by Selvam et al. (2012) [15] and Ho et al. (2013) [16] have demonstrated that the degradation of TC in feces primarily occurs within the first two weeks of composting. In Arikan’s study [17], the concentration of OTC rapidly decreased during fecal composting, showing a 95% reduction within the first six days. Hu et al. (2011) [18] reported that over 93% of TC was degraded during a 45-day composting process. Dolliver et al. (2008) [19] found that the removal rate of streptomycin exceeded 99% in less than 10 days. However, scientific information regarding the degradation of TCs is quite limited, as most researchers tend to focus on the degradation of sulfonamide drugs during the fecal composting process. In order to improve composting performance and enhance the removal effect of antibiotics, exogenous conditioning agents are typically added to raw compost materials. For example, Li et al. (2023) [20] found that the addition of persulfate as a modifier in a composting system reduced the number of potential antibiotic hosts.

Adding expansion agents during composting can promote the degradation of antibiotics and inhibit the spread of resistance genes in fertilizers. Expansion agents could increase compost temperature, prolong the high-temperature stage time, and facilitate the degradation of antibiotics [21]. Biochar, fly ash, lime, and zeolite are widely used to reduce nitrogen loss and improve the maturity and quality of compost [22,23]. Studies have shown that biochar can remove TCs from water based on its excellent adsorption performance [24,25]. Biochar in composting was also beneficial for improving composting performance and improving the removal efficiency of pollutants by affecting changes in properties and microbial communities during the composting process [26]. Shan et al. (2023) [27] added hydrated charcoal to the chicken manure composting system, changing the characteristics of the host microbial community while promoting carbohydrate metabolism. The addition of biochar had different effects on the microbial community in composting, which could affect the temperature distribution, organic degradation and mineralization, greenhouse gas emissions, and nutritional composition of the final product [28]. Adding corn stover biochar (pyrolyzed at 500 °C for 2 h) to pig manure compost enhanced the removal rates of sulfonamide, quinolone, and macrolide antibiotics from 55.9–77.1%, 40.2–52.9%, and 77.1%, respectively, to 68.3–84.8%, 62.6–87.2%, and 94.4% [29]. Karamova et al. (2022) [30] added biochar to chicken manure compost and found that the addition of biochar reduced the abundance of microorganisms that can serve as the carriers of resistance genes, thereby reducing resistance gene pollution. It is widely believed in academia that the high temperature generated by composting can promote antibiotic degradation by altering the microbial community structure [21,31,32]. Adding zeolite to compost had good nitrogen retention and fixation effects [33,34]. Wang et al. (2021) [35] found that using zeolite as an additive in composting was beneficial for prolonging high-temperature composting time and promoting harmless composting. However, there is limited research on the role of zeolite and the combined effect of biochar and zeolite as additives to eliminate antibiotics in compost. Conducting relevant research is of great significance.

This study uses biochar, zeolite, and their mixture as conditioning agents to investigate their effects on the degradation of TCs during composting, and to identify degradation strains. The research aims to (1) investigate the effects of different conditioning agents on the degradation of TCs during the composting process; (2) determine the impact of changes in microbial community structure on the degradation of TCs during the composting process; (3) determine the impact of adding regulators on the spread of TCs in compost; (4) screen TCs-degrading bacteria.

2. Materials and Methods

2.1. Composting Materials and Properties

The composted straw and deer manure both come from Jilin Province. Natural zeolite AR (grade) was purchased from an industrial zone. Biochar was prepared by the pyrolysis of corn stover (450 ± 25 °C), and the surface morphology of straw biochar is shown in Figure S1 [36]. The adsorption of iodine by biochar is a crucial indicator for characterizing its adsorption capacity. The amounts of iodine and methylene blue adsorbed by the produced straw biochar were measured at 641.5 mg/g and 2.89 mL (0.1 g)⁻¹, respectively. These values represent 71.28% and 41% of the adsorption capacity of second-grade wood-activated carbon for water purification [37]. This demonstrates that biochar possesses strong adsorption properties [36]. The properties of each raw material in the compost are shown in Table S1.

2.2. Experimental Design

2.2.1. The Effect of Conditioning Agents on the Degradation of TCs During Composting Process

Four experimental groups were established, each with three replicates, which included compost without adding regulators (CK), compost with biochar as regulator (B), compost with zeolite as regulator (Z), and compost with a mixture of biochar and zeolite as regulator (BZ). Set the initial carbon to nitrogen ratio to 30, moisture content to 60%, and total weight to 4 kg. The amount of conditioner added is 12% of the total weight. The proportion of four composting materials is shown in

Table 1. The preparation proportion of the materials in the four groups.

	Deer Manure (kg)	Straw (kg)	Biochar (kg)	Zeolite (kg)	Water (kg)
CK	3.05	0.69	0	0	5.19
B	2.98	0.54	0.48	0	5.26
Z	2.69	0.83	0	0.48	5.29
BZ	2.83	0.69	0.24	0.24	5.78

. After weighing the raw materials according to the set material ratio, adjust the moisture content, then mix evenly, and keep the mixture still in a black plastic bag for at least 12 h, and then transfer the mixed raw materials into the composting reactor. Choose a ventilation rate of 0.6 mL/min, ventilate for 15 min per hour, and stop for 45 min.

The first day of transferring compost into the reactor is designated as D1, and the nth day is referred to as Dn. After the experiment commenced, samples were collected on D1, D2, D3, D5, and D8. Subsequent samples were taken every 7 days until the conclusion of the composting process, specifically on D15, D22, D29, and D36. During sampling, the pile should be flipped and mixed thoroughly. The samples should be taken from three distinct depths within the same reactor: the top layer (0–10 cm), the middle layer (15–25 cm), and the bottom layer (30–40 cm). These samples should then be mixed evenly and divided into three portions for further analysis.

To enhance the experimental effect, TCs were added to the deer manure. We expanded tenfold according to the highest concentration of TC in deer manure, which was 4.12 mg/kg. The concentration of TC, CTC, and OTC in 500 g of deer manure was adjusted to approximately 40 mg/kg. The weighed antibiotic samples were dissolved in water and evenly sprayed onto the composted material. The mixture was then turned and stirred repeatedly to ensure that the antibiotics were uniformly distributed throughout the compost.

2.2.2. Effects of Conditioners on Plant Toxicity and Maturity of Deer Manure Compost with Residual TCs

We set up potted experiments with three parallel groups for each experiment. The soil was taken from an unfertilized campus in Jilin Province, and no residual TCs were detected. The potted experiment was conducted in a PVC flowerpot with a diameter of 20 cm and a height of 25 cm. Distilled water was used for irrigation. When sampling soil, we mixed the soil in the pot evenly and used it for the subsequent TCs testing.

2.2.3. Screening and Validation of TCs-Degrading Bacteria

The isolation and domestication of TCs-degrading bacteria are shown in Figure S2. The concentration of TCs in the medium was gradually increased according to gradients of 200, 400, 800, 1000, and 1200 mg/L. PCR amplification was performed on the full length of 16S rDNA, and the PacBio sequencing library was prepared using the amplification product as a template. The full-length sequence of 16S rDNA was sequenced using the PacBio system. PCR amplification was performed on the full length of fungal ITS, and the PacBio sequencing library was prepared using the amplified product as a template. The full-length sequence of fungal ITS was sequenced using the PacBio system.

2.3. Determination Method for TCs

CH₃OH (HP, Siyou, Tianjin, China), C₂H₃N (HP, Biaoshiqi, Tianjin, China), Na₂HPO₄-12H₂O (AR Guangfu, Tianjin, China), C₆H₈O₇-H₂O (AR Damao, Tianjin, China), Na₂EDTA-2H₂O (AR Guangfu, Tianjin, China), and C₂H₂O₄-2H₂O (AR Damao, Tianjin, China) were used for the determination of TCs.

High-performance liquid chromatography (HPLC) was employed to determine the concentrations of TC, CTC, and OTC [38]. Begin by adding 20 mL of Na₂EDTA-Mg-livine methanol extract to the sample. Extract the mixture at room temperature (approximately 25 °C) for 20 min using a mechanical shaker. Subsequently, centrifuge the mixture at 3500 rpm for 10 min at 15 °C and collect the supernatant. Next, add 20 mL and then 10 mL of Na₂EDTA-Mg-livine methanol extract to the residue sequentially, repeating the extraction process twice. Combine the supernatants to achieve a total volume of 50 mL. From this 50 mL supernatant, take 5 mL and place it in a nitrogen dryer. Evaporate the solvent with nitrogen at room temperature (approximately 25 °C) until the volume is reduced to about half of the original. Dilute the concentrated extract with an appropriate amount of water to reach a final volume of approximately 5 mL, and pass it through an activated solid-phase extraction column at a flow rate of 1 mL/min. Rinse the solid-phase extraction column sequentially with 5 mL of water followed by 5 mL of methanol–water mixture, discarding all effluent. Vacuum dry the column for 5 min, then elute the target substance using 5 mL of oxalic acid methanol solution. Adjust the pH of the eluent to approximately 5–6 using a saturated NaOH solution. Concentrate the solution using a nitrogen blow dryer until it is nearly dry, then dissolve the residue in 1 mL of water. Filter the solution through a 0.22 µm filter membrane and transfer it into a liquid chromatography vial for analysis. Utilize a liquid chromatograph equipped with a UV detector for detection. The chromatographic conditions are shown in Table S2. The gradient elution conditions are shown in Table S3.

2.4. Microbial Community Detection

After fully flipping the pile, we took a sample. The total genomic DNA samples were extracted using the OMEGA Soil DNA Kit (M5635-02) (Omega Bio-Tek, Norcross, GA, USA). The quantity and quality of the extracted DNAs were measured using a NanoDrop NC2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel electrophoresis, respectively. We set 3 replicates for each sample.

The amplification of the V3-V4 hypervariable region of the bacterial 16S rRNA gene was performed using primers F (ACTCCTAGGGGGGGGGAGGGAGC) and R (GGACTAHVGGGTWTCTAAT) and fungal ITS_V1 region using primers F (GGAAGTAAAGTCGTAACAGG) and R (GCTGCGTTCTTCATCGATGC).

The sequencing and bioinformatics were conducted by Shanghai Parsenor Biotechnology Co., Ltd. (Shanghai, China) on the QIIME2 platform. (Microbiome bioinformatics were performed with QIIME2 2019.4 [39], and raw sequence data were demultiplexed using the demux plugin followed by primer cutting with the cutadapt plugin [40]. The sequences were then quality filtered, denoised, merged, and chimera removed using the DADA2 plugin [41].

2.5. Artificial Neural Network Analysis

Artificial neural network (ANN) analysis was conducted using the Neuro Solutions 7.0 neural network software to establish a multilayer perception model with 1 and 2 hidden layers, a sigmoid Axon function for the transformation function, a learning rule Momentum, a step size of 1, an impulse of 0.7, a maximum iteration of 6000, and a threshold of 0.0000001. Train five times and select the weight value of the minimum mean square error (MSE). Use formula (2) to calculate the relative significance of the input variables on the removal rate of tetracycline antibiotics.

$$MSE=\left[{\sum }_{i=1}^N{\left(R_{i,pre}-R_{i,exp}\right)}^2\right]/\mathrm{N}$$

(1)

Among them, N is the number of data points, and R_i,pre and R_i,exp refer to the removal rate of tetracycline antibiotics in model predictions and experiments.

$$I_j={\displaystyle \frac{{\sum }_{m=1}^{m=\mathit{Nh}}\left(\left(|W_{\mathit{jm}}^{\mathit{ih}}/\sum _{k=l}^{K=\mathit{Ni}}|W_{\mathit{km}}^{\mathit{ih}}\right)\times |W_{\mathit{mn}}^{\mathit{ho}}|\right)}{{\sum }_{k=l}^{k=\mathit{Ni}}\left\{{\sum }_{m=l}^{m=\mathit{Nh}}\left(\left(|W_{\mathit{jm}}^{\mathit{ih}}/\sum _{k=l}^{K=\mathit{Ni}}|W_{\mathit{km}}^{\mathit{ih}}|\right)\times |W_{\mathit{mn}}^{\mathit{ho}}|\right)\right\}}}$$

(2)

Among them, I_j represents the relative importance of the jth input variable on the output variable; W_s is the linking weight; N_i and N_h are the trees of input and hidden neurons; superscripts i, h, o represent the input, hidden, and output layers; and subscripts k, m, n represent the input, hidden, and output neurons.

2.6. Degradation Kinetics of TCs

Research has shown that the degradation of most organic pollutants follows a first-order kinetic model. The variation in tetracycline antibiotic concentration over time during the composting process can be used as a parameter to obtain

$$C_t=C_0{e}^{-\mathit{kt}}$$

(3)

Among them, C₀ is the initial concentration; t is the time, in this study it is the number of days of composting; and C_t is the concentration of antibiotics at time t.

2.7. Statistical Analysis

Use Microsoft Excel 2016 for data statistics, IBM SPSS Statistics 24.0 for data statistics, t-tests for independent and paired samples, and Prism 8 to draw result analysis graphs.

3. Results and Discussion

3.1. Degradation Effect of Conditioning Agents on TCs During Composting Process

The changes in TC, CTC, and OTC in the four compost groups are shown in Figure 1. From Figure 1a–c, it can be seen that the initial values of the three antibiotics in the four compost groups are all around 40 mg/kg. The three antibiotics all decreased in composting, mainly during the early high-temperature period (D2–D8), when they rapidly decreased, followed by a gentle but sustained downward trend.

The concentration of tetracycline antibiotics measured by D1–D8 in each group was sorted out according to Formula (3), and the model was established with $-\ln {\displaystyle \frac{{\mathrm{C}}_{\mathrm{t}}}{{\mathrm{C}}_0}}$ as Ordinate and time t as Abscissa. The final model parameters are shown in Table S4. R² indicates that the degradation of the three antibiotics in the four compost groups conforms to the first-order reaction kinetics model. From the degradation of k, the degradation rate of the compost group was significantly higher than that of the compost group (CK) without the addition of regulators. TC and CTC had the highest degradation rate in the biochar–zeolite mixed conditioning compost (BZ), while OTC had the highest degradation rate in the zeolite conditioning compost (Z). Biochar may promote the removal of TC by adsorption and electrochemical fixation on its surface [42]. Research has shown that OTC is easily adsorbed on the surface of zeolites, and the adsorption process of OTC is spontaneous, mainly occurring through physical and chemical adsorption [43]. The adsorption of CTC on biochar is controlled by various adsorption processes, including diffusion into pores, chemical reactions with surface functional groups, and physical adsorption on the surface of tested biochar [44]. In the same zeolite framework, aluminum ions occupy the centers of four oxygen tetrahedra. Since the Al³⁺ isomer replaces Si⁴⁺, the entire zeolite lattice is negatively charged, and positively charged substances, including antibiotics, can be adsorbed by electrostatic attraction [33]. The different promoting effects of biochar on the removal of three tetracycline antibiotics may be related to their different organic structures. Three antibiotics are adsorbed on specific adsorption sites by biochar and zeolite, while also competing for adsorption sites [45]. The faster decrease in TC, CTC, and OTC in the BZ group may be due to the higher proportion of porous regulators, which provide more adsorption sites and attenuate the competition and mutual influence among the three antibiotics.

3.2. The Effect of Physicochemical Properties on TCs During Composting Process

As shown in Figure 2a, the temperature changes in the four composting groups all showed three typical stages: moderate temperature period (<45 °C), high-temperature period (=45 °C), and cooling period (<45 °C), which were synchronous with the changes in the microbial respiration stages of composting. The highest temperature of the reactor was B (57.5 °C) < Z (65.4 °C) < BZ (67.1 °C). Biochar promotes temperature rise and the prolongation of time during the high-temperature stage [46]. The effect of adding biochar alone on temperature was not significant in this study, while zeolite increased the highest temperature of group Z. This increase may be attributed to the porosity of zeolite, which provides aerobic conditions for microbial activity and organic matter degradation processes [47]. The mixed conditioner of zeolite and biochar had a more pronounced effect on increasing temperature. As a result of the constant ventilation rate and flipping frequency, there is only one temperature peak for each of the four groups of reactor temperatures overall. The change in temperature has a significant impact on the degradation of TC, and the higher the temperature, the faster the degradation rate [48]. During the high-temperature period, thermophilic microorganisms decompose a large amount of organic matter, causing a rapid decrease in TCs in the four compost groups. Adding zeolite and a mixture of zeolite and biochar as conditioning agents are beneficial for temperature increase and the degradation rate of TCs is faster. The concentration of TCs rapidly decreases after D3, while CTC and OTC remain stable after D15. Additionally, the degradation rate of TC decreases after D8. This pattern corresponds closely to the temperature fluctuations observed during the heating, high-temperature, and cooling phases of composting. At high temperatures, microbial growth significantly enhances the biodegradation of tetracycline antibiotics [48].

The moisture content can affect the absorption rate of oxygen and significantly affect microbial activity, and hydrolysis is also one of the important processes in the degradation of TCs. As shown in Figure 2b, the moisture content of the four groups of compost during the high-temperature period (D2–D15) showed significant fluctuations. The porous structure of zeolites and biochar can retain water molecules in micropores and cracks, thereby affecting the moisture content of the compost. Microbial activity during the mid-temperature and high-temperature periods generates water, leading to fluctuations in the moisture content, which stabilizes at approximately 55%. TCs degrade rapidly [49]; however, a decrease in the moisture content subsequently reduces microbial activity. As a result, after D8, the decline in tetracycline antibiotics slows down.

The optimal pH for microbial survival is between 5.5 and 8.5, as shown in Figure 2c. The pH of the four compost groups varied between 6.25 and 8.45, all within the optimal pH range for microbial survival. Dehydration significantly contributes to the removal of TCs. This phenomenon is associated with an increase in reaction activity and alterations in pH [49,50]. Consequently, after D3, the pH of the four compost groups rose above 7.5, indicating weak alkalinity, which is advantageous for the removal of TCs [51]. At the beginning of the composting process, the pH is lower compared to the temperature phase. Tetracycline, oxytetracycline, and aureomycin carry more positive charges, making them easily adsorbed by negatively charged biochar.

The conductivity is mainly affected by the concentration of organic acid salts and inorganic salts, which could to some extent reflect the plant toxicity of fertilizers [52]. As shown in Figure 2d, there is a small difference in the initial conductivity among each group of compost. All the treated electrical conductivity (EC) showed a brief decrease at the beginning of the composting process and then increased. The EC of the CK group was higher than that of the other three groups during the composting process, indicating that biochar and zeolite, as conditioning agents, slowed down the changes in EC during the composting process. The final conductivity of the four compost groups was less than 9000 µS/m, indicating that the four compost groups had no growth inhibitory effect on plants [53].

The desorption process and adsorption process of biochar coexist. pH and EC also have certain effects on the desorption of biochar. Both acidity and alkalinity can promote the desorption of antibiotics in biochar [54], and the higher the EC, the greater the desorption rate. At the start of composting, the pH is around 6.5, which is weakly acidic, and D3 is 7.2, close to neutral. Afterwards, it slowly rises, and the alkalinity increases. Additionally, EC initially decreases but then continues to rise in D3 to D8 before stabilizing. Therefore, the decrease rate of TC, OTC, and CTC concentrations after D3 is accelerated, while the decrease in TC concentrations after D8 is slowed down, possibly due to the enhanced desorption process of biochar on them in D3–D8.

3.3. The Effect of Microbial Community Structure on the Degradation of TCs in Compost

As shown in Figure 3, During the high-temperature period, the proportion of psychrobacter in B and BZ decreased, while the proportion in CK and Z increased. The changes in Glutamicibecter and Turiciibecter are on the contrary. At the end of composting, the proportion of Luteimonas and Chryseolinea increased. However, the proportion of Pseudomonas, Romboutsia, Acinetobacter, and Clostridium_sensu_stricto_1 decreased significantly. It can be inferred from the changes in the Shannon index during the four composting processes. Among the four compost groups, the addition of conditioning agents significantly reduced the microbial richness during the high-temperature period and improved the uniformity of microorganisms. Composting increases the abundance of microorganisms in the pile. At different stages of composting, the bacterial community structure undergoes significant changes.

Analyze the variation relationship of bacteria in different stages of composting with different conditioning agents based on Figure S3. Pseudomonas is most closely related to lignin degradation and humification in compost [55]. The composting used in this study is based on deer manure and straw, which contain lignin that can be utilized by Pseudomonas, resulting in a higher abundance and more pronounced appearance in the BZ group. Romboutsia was detected in pig manure compost and is sensitive to tetracycline stress, making it a biological indicator of tetracycline stress. In this study, the relative abundance of Romboutsia bacteria decreased in CK, Z, and BZ, but increased during the high-temperature period of B. The addition of conditioning agents such as biochar and zeolite may affect the relative abundance changes in Pseudomonas and Romboutsia during the composting process. Pseudomonas is usually isolated from different environments, including animal organs [56,57]. In this study, the abundance of Pseudomonas was high during both the composting heating and high-temperature periods, suggesting that it may be related to the degradation of TCs. Coldphilic bacteria, glutamic acid bacteria, and pseudomonas may all be involved in the biodegradation of TCs during the composting process. During the composting maturity period, the abundance of Glutamicibacter was found to be absent in all the samples. Therefore, it is speculated that glutamic acid bacteria are implicated in the degradation of TCs during the high-temperature period.

Fungi also play a crucial role, as they can degrade recalcitrant compounds, stabilize organic matter, and decompose organic residues under dry, acidic, and low nitrogen conditions [58]. During the composting process, as shown in Figure 4, at the genus level, the composting process significantly reduced the relative abundance of Botryotrichum, Aspergillus, Mucor, Scopulariopsis, Microascus, and Penicillium, making Mycothermus a dominant bacterial species. Among them, the abundance of Mucor, Scopulariopsis, and Penicillium increased during the high-temperature period, and Microascus in Group B also showed an upward trend during the high-temperature period. Mycothermus can grow above 50 °C. Wang [59] found that Mycothermus is the dominant bacterial group in the aerobic fermentation cooling and maturation stages of cow manure. It can provide energy for the later stage of composting by producing various hydrolytic enzymes to decompose the remaining macromolecular substances after the high-temperature stage [60]. It can be inferred from the changes in the Shannon index during the four composting processes that the richness of fungi in the initial and high-temperature stages of the four composting groups is similar. The addition of conditioning agents B and Z did not significantly affect the richness of fungi in the pile. Although the richness of the BZ group was lower than the other three groups, there was a significant increase in fungal richness during the high-temperature period. Ultimately, composting reduced the richness of fungi in the heap.

Analyze the variation relationship of bacteria in different stages of composting with different conditioning agents based on Figure S4. The abundance of Microascus and Penicillium increased during the period of high temperature. Scopolariopsis is a soil parasitic fungus with a membrane and relative resistance to broad-spectrum antifungal drugs [61]. The mature development of Aspergillus mycelium can support the degradation of organic matter by producing extracellular enzymes [62,63]. The relative abundance of Aspergillus increases during the high-temperature period, possibly due to their involvement in the degradation of TCs in composting. Meanwhile, the large specific surface area of zeolite promotes the attachment of microorganisms and enhances the biodegradation of tetracycline antibiotics [64,65]. Additionally, the incorporation of biochar may alter microbial communities and accelerate the degradation of tetracycline antibiotics by microorganisms under high-temperature conditions [66].

3.4. ANN Analysis

ANN is a process of pattern recognition and error minimization that mimics the structure of the human brain for learning, memory, and induction. The use of artificial neural network models for analysis can address the limitations of traditional logic-based artificial intelligence in processing intuitive and unstructured information [67].

This study established an artificial neural network model based on the experimental results. Test the MSE of hidden layer 1 and 2 models. When the hidden layer is 1, the MSE is smaller. Therefore, set the number of hidden layers to 1. The model obtained after 5 rounds of training is shown in Figure 5. The evaluation indicators of the model, including mean square error (MSE); normalized root mean square error (NRMSE), r; and other error parameters, are shown in Table S5 and dynamically change with the number of training sessions. We selected the model with the smallest MSE value, specifically Model 3; recorded the weight values of each variable; and calculated the sensitivity of TCs to various conditioners in the compost based on the weight. The result is CK (14.86%) < Z (25.60%) < B (28.26%) < BZ (31.28%). The comparison between the predicted values of the ANN model and the experimental results of the removal rate in composting is shown in Figure 6. The analysis found that the overall trend of the experiment and prediction is consistent.

The results of the analysis using artificial neural networks showed that the sensitivity of TCs to conditioners in the compost was as follows: CK (14.86%) < Z (25.60%) < B (28.26%) < BZ (31.29%). The analysis results show that adding biochar as a conditioning agent to compost has a stronger removal effect on TCs than zeolite; furthermore, the mixed conditioning agent of zeolite and biochar has the highest impact on the removal of TCs in compost.

3.5. The Effects of Conditioning Agents on the Phytotoxicity of TCs Residues in Deer Manure Compost

The cultivation experiment of Chinese cabbage was conducted using mature compost as an additive, and the results are shown in Figure 7. In the DM group, the concentration of TCs in the soil is higher than that in the leaves. The soil concentration range was 3.54–4.58 mg/kg, and the leaf concentration range was 1.42–1.87 mg/kg. The concentrations of TCs in the soil and Chinese cabbage treated with composting in groups B, Z, and BZ with the addition of conditioning agents were lower than those in the CK group. Among them, no residual TCs were detected in the leaves treated with groups B, Z, and BZ. The maximum reduction in TC residue in the soil was 75.61% (TC concentration in BZ group soil). Composting with a mixed conditioner of biochar and zeolite had the best effect on reducing the transfer of TCs into the soil and plants.

3.6. Screening of TC-Degrading Bacterial Strains

After high-throughput sequencing, the final degradation agent contained four types of bacteria and one type of fungus. They belonged to the bacteria Acinetobacter pittii, Stenotrophomonas maltophilia, Lactobacillus reuteri, and Pseudomonas putida, and the fungus Trichosporon dohayense. Their classification and characteristic features are shown in Tables S6 and S7 [68,69,70]. Lactobacillus reuteri is essentially resistant to several antibiotics and serves as a beneficial adjunct supplement during some antibiotic treatments [71]. Pseudomonas putida can form stronger biofilms, thereby enhancing the population’s resistance to antibiotics [72]. Trichosporon dohaense is a fungus, but there is currently no research on it. Strains obtained from the human body exhibit moderate sensitivity to antibiotics such as fluconazole, itraconazole, voriconazole, and posaconazole [73]. The presence of Trichosporon dohaense in the bacterial agents of this study may be due to the stimulation of tetracycline antibiotics in the culture medium, leading to the formation and inheritance of drug resistance [74].

The domesticated bacterial agent was applied to the deer manure and straw, and the results are shown in Figure 8. It can be seen that the degradation rates of TC, CTC, and OTC in the deer manure straw system significantly increased after the addition of microbial agents. The experiments were conducted in conical flasks at room temperature, demonstrating that the microbial agent also exhibits good activity at room temperature and had a significant promoting effect on the degradation of tetracycline antibiotics within composting systems. The bacterial agent was added to the zeolite compost system with the highest degradation rate for validation, and the results are shown in Figure S5. After adding microbial agents, the compost still exhibited three distinct stages: heating period, high-temperature period, and cooling period. The heating period was extended by one day, with a maximum temperature of 68.2 °C. Compared with the previous Z group compost, the maximum temperature increased by 2.4 °C. All three antibiotics began to degrade while being heated, possibly due to the competition between the original microorganisms and exogenous strains during the high-temperature period, which consumed available carbon sources and energy. At D29, the concentrations of CTC and OTC were both 0, and on D36, the concentrations of the three antibiotics were all 0. The addition of microbial agents significantly increased the degradation rate of TC, CTC, and OTC in the zeolite composting process of deer manure straw.

4. Conclusions

The unscientific disposal of agricultural solid waste and other pollutants introduces more antibiotics and other pollutants into the environment. This study uses deer manure straw composting processes with different conditioners to study the effect of adding compost conditioners on the degradation of TCs. The main conclusions are as follows:

(1)

Conditioners can affect the removal of tetracycline antibiotics during composting by affecting the physicochemical properties and microbial community structure. TC, CTC, and OTC showed the highest degradation rates in group Z, which were 94.29%, 97.18%, and 95.68%, respectively. Among the three TCs, TC has a lower degradation rate in general than that of CTC and OTC.

(2)

The biochar–zeolite mixed conditioning agent compost has the highest degradation rate of TC and CTC. The sensitivity of TCs to regulators was calculated using an artificial neural network model, and the results showed that TCs had the highest sensitivity to a mixture of biochar and zeolite regulators.

(3)

Adding conditioners further promotes the reduction in the migration of TCs caused by the single application of deer manure into the soil and Chinese cabbage leaves after composting. The addition of conditioning agents has a promoting effect on this effect, and the best effect is achieved by using a biochar–zeolite mixed conditioning agent.

(4)

A mixed microbial agent that promotes the removal of TC, CTC, and OTC in compost was isolated and domesticated, including Acinetobacter pittii, Stenotrophomonas maltophilia, Lactobacillus reuteri, Pseudomonas putida, and Trichosporon dohaense. The practical application of microbial agents promotes the degradation rate of TCs during the heating period, and ultimately TC, CTC, and OTC are completely removed in the compost with added degradation microbial agents.