Heterologous Expression and Functional Analysis of Exiguobacterium Algin Lyase Gene by Pichia pastoris

Abstract

Algin is the most abundant substance in alga. Alginate lyase degrades algin and produces algin monosaccharides, disaccharides, and oligosaccharides, which are widely used in bioenergy, food, medicine, and other fields. In this study, one Exiguobacterium strain isolated from rotten kelp exhibited a robust ability to degrade the alga. The sequencing of this strain revealed the presence of three different types of algin alginate lyase. Nevertheless, the expression of three genes in Escherichia coli revealed a lower alginate lyase activity compared to that of the original strain. After codon optimization, the gene with the highest activity of the three was successfully expressed in Pichia pastoris to produce recombinant EbAlg664. The activity of the recombinant enzyme in 5 L high-density fermentation reached 1306 U/mg protein, 3.9 times that of the original Exiguobacterium strain. The results of the enzymatic analysis revealed that the optimal temperature and the pH range of recombinant EbAlg664 were narrower compared to the original strain. Additionally, the presence of Cu²⁺ and Co²⁺ enhanced the enzymatic activity, whereas Mg²⁺ and Fe³⁺ exhibited inhibitory effects on the recombinant alginate lyase. The study offers a theoretical and practical foundation for the industrial-scale production of engineered Pichia pastoris with high alginate lyase activity.

1. Introduction

Algin is a crucial component of the cell wall in algae [1]. Due to its excellent thickening, gelation, and biosecurity properties, algin has found extensive applications in food, medicine, cosmetics, and other industries [2,3,4]. Algin primarily consists of β-D-mannuronic acid (M) and α-L-guluronic acid (G), which are isomers connected through β-1, 4-glucoside bonds. Depending on the monomer type, algin exists in three common forms: polyguluronic acid (poly G), polymannuronic acid (poly M), and a combination of both monomers alternately (poly MG) [5,6,7]. Through the beta-elimination mechanism (β-eliminate), alginate lyase acts on the 1–4 glycosidic bond between monomers to degrade algin into various lengths of monosaccharide, disaccharide, or oligosaccharide fragments [8]. Among these fragments, algin monosaccharides and disaccharides can be fermented to ethanol for use in bioenergy. Additionally, algin oligosaccharides produced by alginate lyase have been widely employed in medicine, the food industry, as well as agriculture due to their diverse biological activities, such as immune regulation, anti-tumor effects, antioxidant properties, and anti-inflammatory capabilities, and they hold significant potential value within the medical field. Furthermore, in terms of food preservation, the antibacterial characteristics exhibited by algin oligosaccharides can effectively extend the shelf life of food products. Additionally, in agriculture, it also plays a role in promoting crop root growth [9,10,11].

As a crucial enzyme for the production of algin oligosaccharides, alginate lyase features high reaction efficiency, mild reaction conditions, and strong controllability [12]. It is convenient for the directional preparation of algin monosaccharides, disaccharides, and oligosaccharides and holds far-reaching application prospects. At present, more than 50 kinds of alginate lyase have been isolated from algae, marine mollusks, and soil bacteria [13]. Most alginate lyase comes from bacteria and fungi, especially from bacteria, such as Pseudomonas, Microbulbifer, Flavobacterium, and so on [14,15,16]. In recent years, there have been many studies on cloning the genes of alginate lyase from different sources and heterologous expression in different host organisms. Yamasaki et al. (2004) discovered a gene in the Pseudomonas aeruginosa genome that encodes a protein homologous to Sphinsinomonas alginate lyase A1-II (PA1167). Overexpression of this gene in Escherichia coli resulted in the degradation of sodium alginate and subsequent release of unsaturated sugars [17]. Zhu et al. (2019) cloned and identified a novel dual-function enzyme FsAlgB from the deep-sea Flammevirga sp. The recombinant FsAlgB demonstrates both alginate lyase and endoenzyme characteristics, being capable of recognizing a tetrasaccharide as the smallest substrate and cleaving the glycosidic bond between related sites [18]. Yang et al. (2018) cloned the gene alym, which encodes a new alginate lyase from Microbulbifer sp. Q7, and expressed it in E. coli. The recombinant AlyM demonstrates maximum activity at pH 7.0 and 55 °C, and it shows a specific preference for PolyG [19].

In this study, a strain was isolated from rotten kelp and was found to possess strong alginate lyase activity. After identification, it was ascertained that the strain belongs to the Exiguobacterium, a deep-sea microbial species. Exiguobacterium is a highly versatile and important bacterial genus of Gram-positive bacteria that possess abundant stress-responsive genes, helping them to colonize and thrive in diverse ecological niches [20]. In addition, the ability of Exiguobacterium to compete and survive in various harsh environments has made them attractive for bioremediation and biodegradation [21]. It originates from a wide array of sources and can be isolated in various environments such as soil, sediment, frozen soil, glaciers, and others within seawater. Exiguobacterium can thrive in an environment ranging from −12 °C to 55 °C and demonstrates a strong tolerance to NaCl, with the maximum tolerance concentration reaching up to 15%. There exist numerous types of enzymes in Exiguobacterium, including amylase, cellulase, lipase, protease, pectinase, alginate lyase, and so forth. However, there are relatively few studies on the alginate lyase of Exiguobacterium [22,23,24].

By means of whole-genome sequencing, it was discovered that the Exiguobacterium strain encompasses three types of alginates lyase, namely Ebalg660, Ebalg664, and Ebalg665. If we want to precisely understand the functions and characteristics of these three kinds of alginate lyases, a suitable method is to clone and heterologously express the gene for further research. Subsequently, three genes of alginate lyase were cloned and heterologously expressed in E. coli separately. Through codon optimization, the gene with the highest alginate lyase activity was heterogeneously expressed in Pichia pastoris, and a recombinant enzyme with high alginate lyase activity was successfully obtained. By conducting enzymatic properties analysis on the recombinant enzyme, the optimal reaction temperature and pH conditions were determined, and the impacts of several metal ions on its activity were clarified. These discoveries will provide references for the industrial production and application of alginate lyase.

2. Materials and Methods

2.1. Culture Source and Medium

Exiguobacterium HH1 strain, isolated from rotten kelp in Weihai City, Shandong province, was stored in a 2216E medium (peptone 5 g/L, yeast extract 1 g/L, iron phosphate 0.01 g/L, sodium chloride 35 g/L) [25]. E. coli (Vazyme, Nanjing, China), preserved in LB medium (yeast extract 5 g/L, tryptone 10 g/L, sodium chloride 10 g/L). Pichia X33 (Invitrogen, Carlsbad, CA, USA), stored in YPD medium (yeast extract 10 g/L, peptone 20 g/L, glucose 20 g/L).

2.2. Culture and Optimization of Exiguobacterium

A 2216E medium and an LB medium with different NaCl concentrations were used to culture the Exiguobacterium strain. Firstly, the Exiguobacterium strain was inoculated into a 2216E liquid medium for activation. When OD600 was adjusted to 1.0, 3 mL of activated bacterial solution was added into 300 mL of 2216E and an LB liquid medium with different NaCl concentrations (0.5–2%), respectively, and cultured in a 500 mL flask by shake culture at 28 °C and 180 rpm. The OD600 value was monitored regularly, the growth curve was drawn, and the optimal culture conditions were determined.

2.3. Cloning of Alginate Lyase Gene

The genomic DNA was extracted from Exiguobacterium using a Bacterial Gen DNA kit (Vazyme, Nanjing, China). According to the data of genome sequencing of Exiguobacterium, specific primers were designed and synthesized (

Table 1. Sequences of the primers used in this study.

Primer Name	Primer Sequences (5′→3′)
Ebalg660 F	GGATCCATGAAACGAATCTTACTCGTCCTCG
Ebalg660 R	CTCGAGTTAGATGGGCACACTGATCTGTCT
Ebalg664 F	GGATCCATGAAACCTTTGTATACACGATTATCG
Ebalg664 R	CTCGAGTCATTTTGGTACGTTGATCGTATTT
Ebalg665 F	GGATCCATGAGGGAACGAATGGAACATT
Ebalg665 R	CTCGAGTCAATATGGAATTCGGATGACG
664(Pichia) F	GAATTCATGAAACCTTTGTATACACGATTATCC
664(Pichia) R	GTCGACTCATTTTGGTACGTTGATCGTATTG

Restriction sites are underlined; F denotes forward primers; R denotes reverse primers.

). These genes were amplified by polymerase chain reaction (PCR) from the genomic DNA. The PCR conditions were as follows: a hot start at 94 °C for 5 min, 35 repeated cycles of 94 °C for 30 s, 62 °C for 30 s, and 72 °C for 2–3 min, followed by one cycle of 72 °C for 10 min. The PCR products were purified from agarose gels. The purified DNA fragments were ligated to pEASY-Blunt (Transgen, Beijing, China), and the plasmids were transformed into E. coli DH5α cells. The resulting recombinant plasmids were isolated from a positive clone and sequenced.

2.4. Expression of Alginate Lyase Genes in E. coli

The genes were excised from the pEASY-Blunt recombinant plasmids using one pair of restriction enzymes, BamHI and XhoI, and ligated with the pET-30a (+) vector, which was digested with the same pair of restriction enzymes. The ligation of the DNA insert was conducted overnight at 16 °C using T4 DNA ligase. E. coli BL21(DE3) cells were transformed with the ligation mixture and plated on Luria–Bertani (LB) agar containing kanamycin (50 μg/mL) [26]. Positive colonies were screened by direct colony PCR using vector-specific primers (T7 promoter and T7 terminator primers). E. coli BL21(DE3) cells, transformed with the recombinant plasmid pET-30a, were grown in 100 mL of LB medium containing 50 μg/mL kanamycin on a rotary shaker at 200 rpm at 37 °C. When the absorbance at 600 nm reached 0.6, 0.1 mM IPTG was added to the culture medium, and the cultures were incubated further at 25 °C for 12 h [27].

2.5. Heterologous Expression of Alginate Lyase Genes in Pichia pastoris

The Ebalg664 gene was entrusted to Tsingke Biological Company (Beijing, China) for codon optimization, and the optimized gene was used as the template to redesign primers (Table 1) to amplify linear fragments with the restriction enzymes EcoR I and Sal I. The fragment of P. pastoris expression plasmid pPICZaA, which had also been digested by EcoR I and Sal I, was connected to construct the vector pPicZaA-Ebalg664, which was transformed into E. coli DH5α for further amplification. Then, the plasmid was extracted, digested with Sac I enzyme, linearized, and transferred into X33 cells of P. pastoris (methods are described in the operation manual of Invitrogen Company). The positive clones were selected by YPD culture medium containing 100 μg/mL Zeocin antibiotic.

The recombinant yeast was cultured in a 7 L airlift fermenter with a working volume of 5 L YPD medium at 30 °C, an initial pH of 6.5, and an aeration rate of 0.5 m³/h. Methanol was added to a final concentration of 1% every 24 h to induce the expression of alginate lyase. The alginate lyase activity in the fermentation solution was measured from 24 to 96 h.

2.6. Extraction of Alginate Lyase and Determination of Its Activity

A 10 mL quantity of recombinant E. coli with OD600 1.0 was centrifuged at 340-force (5000 rpm) for 5 min at 4 °C, the supernatant was separated from the cells, and 3.0 mL of 0.05 mol/L Tris-HCl (pH 7.0) buffer, 30 μL of lysozyme, and 30 μL of PMSF were added to the cell pellet. E. coli cell pellets were sonicated using a sonicator (total power at 80%, working time of 4 s, interval of 150 4 s, for 100 cycles). Subsequently, the recombinant E. coli cell lysate and the recombinant P. pastoris fermentation liquid were respectively ultrafiltered with 10K and 100K membranes to obtain the crude enzyme solution. Additionally, another 10 mL tube was filled with the reaction mixture (3.8 mL of Tris at 2.42 g/L, 11.7 g/L of sodium chloride, and 10 g/L of sodium alginate), and 200 μL of fermentation supernatant or cell lysate extract was added separately. The reaction was carried out at 40 °C for 20 min, and immediately, 40 μL of 10 mol/L NaOH was added to terminate the reaction. Distilled water was used as the control, and each sample was measured three times. The absorbance at 235 nm was determined, and one enzyme activity unit was defined as the increase in absorbance by 0.1 units per minute.

The molecular mass of the alginate lyase was estimated by SDS-PAGE using a vertical gel electrophoresis system. SDS-PAGE was performed according to the procedure described by Laemmli [28].

2.7. Effects of pH and Temperature on Alginate Lyase Activity

The alginate lyase activity was determined in different pH buffers (sodium acetate (pH 2.0–5.0), sodium phosphate (pH 5.0–8.0), and Tris—HCl (pH 8.0–10.0)). The effect of temperature on alginate lyase activity was determined at different temperatures ranging from 20 °C to 70 °C [27].

The activity of the treated samples above was assayed by the standard method, as given above. The relative activity was expressed as the ratio of alginate lyase activity under a certain condition to its maximum activity.

2.8. Effects of Metal Ions on Alginate Lyase Activity

The effects of metal ions (KCl, NaCl, BaCl₂, CaCl₂, CoCl₂, FeCl₃, FeSO_4, MgSO₄, MnSO₄, ZnSO₄, and CuSO₄) and EDTA on alginate lyase activity were evaluated using sodium phosphate buffer (pH 7.0). The enzyme was incubated for 30 min at 37 °C with 5 mM of metal ions prior to the addition of substrate. The activity without added metal ions was taken as 100% activity [27].

2.9. Statistical Analyses

All data from the three replicates are expressed as the mean ± SD and were analyzed by the LSD t-test at p < 0.05 using SPSS software (version 26.0; IBM, Armonk, NY, USA) to assess the statistical difference between mean values. Different letters are used for identification.

3. Results

3.1. Media for the Growth and Alginate Lyase Activity of Exiguobacterium

In the selection and cultivation of Exiguobacterium, the 2216E medium is typically employed. In this study, we chose different NaCl concentrations of the LB medium and analyzed the growth of Exiguobacterium as well as the activity of alginate lyase to determine the optimum conditions for their growth and enzyme production. The results (Figure 1a) showed that Exiguobacterium had the maximum viable cell concentration of 4.41 × 10⁸ CFU/mL in the 2216E medium during the stationary growth phase. Meanwhile, the maximum viable cell concentration in the LB medium with 0.5%, 1%, and 2% NaCl concentrations were 11.2 × 10⁸ CFU/mL, 10.1 × 10⁸ CFU/mL, and 10.2 × 10⁸ CFU/mL, respectively. It can be inferred that despite the varying NaCl concentrations in the LB medium, the maximum growth of the Exiguobacterium in the LB medium is over 50% higher than that of the 2216E medium. Additionally, by determining the enzymatic activity of alginate lyase in the supernatant and sediment of the Exiguobacterium fermentation, it was found that although the cells were treated with lysozyme and sonication, the enzymatic activity in the supernatant was significantly higher than that in the sediment (Figure 1b), indicating that Exiguobacterium releases its alginate lyase through extracellular secretion. Furthermore, the results of the enzymatic activity of alginate lyase in different culture media revealed that under the same temperature and pH conditions, the best enzymatic activity was determined in a 1% NaCl LB culture medium, reaching 336 U/mg protein. This indicates that although Exiguobacterium lives in the marine environment and can tolerate a NaCl concentration of more than 15% [23], the enzyme activity of alginate is highest in the 1% NaCl environment. Regarding the cause of the difference, it remains to be further explored whether it is the amount of enzyme production or the activity of enzymes that is influenced by NaCl.

3.2. Gene Sequencing and Protein Analysis of Exiguobacterium

The gene sequencing showed that there were three different types of algin lyase genes in Exiguobacterium, which we named Ebalg660, Ebalg664, and Ebalg665. The total lengths of Ebalg660, Ebalg664, and Ebalg665 were 2085 bp, 2094 bp, and 2082 bp, respectively. The predicted molecular weight of the three proteins was about 75 KDa. The results of amino acid sequence alignment of the three algin lyase (Figure 2) showed that the similarity between EbAlg660 and EbAlg 664 was 58%, the similarity between EbAlg 660 and EbAlg 665 was 36.9%, and the similarity between EbAlg 664 and EbAlg 665 was 48.6%. The above results indicate that, on the one hand, due to the existence of three different types of alginate lyase in Exiguobacterium, it has a very strong ability to hydrolyze algin; on the other hand, as to why the same Exiguobacterium strain contains three different types of alginate lyase, it is estimated that it is related to hydrolyzing different types of algin substrates because algin usually exists in three different polymerization types: PolyG (Poly-α-L-guluronic acid), PolyM (Poly-β-D-mannuronic acid), and PolyMG (mannuronic acid and guluronic acid heteropolymer) [29,30]. These three alginate lyases may have distinct preferences in hydrolyzing the three diverse types of polymer substrates above.

3.3. Expression of Alginate Lyase Gene in E. coli

In order to study the characteristics of three alginate lyase from Exiguobacterium, we cloned three genes, Ebalg660, Ebalg664, and Ebalg665, which were inserted into expression vector pet30a and heterogeneously expressed in E. coli BL21. According to the results of sequencing the recombinant strains and the SDS-PAGE results of recombinant proteins, three different genes were successfully transformed into E. coli BL21 and expressed. However, by measuring the alginate lyase activity of the recombinant protein (Figure 3), it was found that their activity levels were 76, 135, and 86 U/mg protein, respectively, which were lower than that of 336 U/mg protein of the original Exiguobacterium. Regarding the reasons for this result, the first one is that the original Exiguobacterium might have interacted jointly with all three alginates enzymes, resulting in its higher activity compared to the recombinant E. coli strain with only one algin lyase. On the other hand, as the recombinant enzyme is an intracellular protein, it cannot be secreted outside the cell to exert its function. Even if we employ ultrasound and lysozyme to promote bacterial lysis, we cannot ensure that the enzyme activity reaches its maximum value. Another possibility is that the recombinant protein forms an inclusion body, which is disadvantageous for the binding of the enzyme and the substrate, thereby significantly affecting its enzyme activity.

3.4. Expression of Alginate Lyase Gene in Pichia pastoris

In this study, Ebalg664, the gene with the highest alginate lyase activity in the heteroexpression of E. coli, was selected. Through codon optimization, the Ebalg664 was inserted into the expression vector pPICZaA and transformed to Pichia X33 for the expression of recombinant alginate lyase. By culturing the recombinant P. pastoris strain in a culture medium supplemented with methanol, the supernatant from 24 h to 96 h was collected to determine the alginate lyase activity. The supernatant of the original strain of Exiguobacterium was used as a control. The results showed that the activity of the recombinant enzyme increased rapidly after 24 h, reached its peak at 48 h, and then began to decline continuously, and the activity dropped to 40% of the maximum value by 96 h (Figure 4a). The SDS-PAGE results (Figure 4b) indicated that there were similar protein bands at the corresponding 75 KDa position in both the fermentation supernatant and the crude enzyme extraction, suggesting that the recombinant protein EbAlg664 was successfully expressed. In recent years, the use of P. pastoris as a vector for expressing alginate lyase has been a research focus [31,32,33]. Yang et al. (2020) successfully expressed the cAlgM and its thermally mutated variant in P. pastoris [34]. Li et al. (2018) identified the alginate lyase gene sagl in Flavobacterium sp. H63 and optimized its codons for expression in P. pastoris, achieving a maximum yield of recombinant SAgl in the fermentation supernatant of 915.5 U/mL [35]. Meanwhile, the recombinant enzyme activity of P. pastoris in this study reached 1306 U/mg protein, which was 3.9 times higher than that of the original Exiguobacterium strain (336 U/mg protein). In particular, compared with the same recombinant EbAlg664 in E. coli, the recombinant enzyme activity in P. pastoris was much higher, reaching 7.5 times that of the former (185 U/mg protein) (Figure 3). These results indicate that it is feasible to use the very mature transformation system of P. pastoris to heteroexpress the alginate lyase gene of Exiguobacterium and produce the recombinant alginate lyase.

3.5. Enzymatic Properties of Recombinant Alginate Lyase

Given that the activity of E. coli recombinase is relatively low, this study focuses on the recombinase of P. pastoris, using the original Exiguobacterium strain as a control, to investigate the optimal pH and temperature and the influences of different metal ions on their activity. It was found that the optimal temperature of alginate lyase for both the original Exiguobacterium and the recombinant P. pastoris Alg664 was 40 °C (Figure 5a), and the optimal pH was 6.0 (Figure 5b), which indicates that they belong to the acidic alginate lyase enzyme. However, the range of their optimal conditions varies slightly; for example, for original Exiguobacterium enzymes, the temperature range was 35–60 °C, where 80% of the enzyme activity can be preserved, but for the recombinant enzyme, only the range of 38–45 °C achieves 80% of the highest enzyme activity. At pH 5.0–7.5, the enzyme activity of the original enzymes remains at 80%, but the recombinant enzyme only maintains 80% enzyme activity in the range of pH 5.5–7.0, while enzyme activity drops to 60% at pH 5.0. The reason for the differences may be that the original strain contains three different alginate lyases, whose interactions result in a relatively wider range of adaptability.

The effects of various metal ions on the enzyme activity of recombinant EbAlg664 are shown in Figure 6. The figure shows that compared with the control without adding any ions, the enzyme activity of recombinant EbAlg was increased by 15.85% and 59.82% in the 10 mM Cu²⁺ and Co²⁺ conditions, respectively. This suggests that Cu²⁺ and Co²⁺ at these concentrations have a significant promoting effect on the enzyme activity of EbAlg, with Co²⁺ having a more pronounced promoting effect. These results are partially consistent with the results of Yue et al. (2016) [31]. By contrast, the enzyme activity of EbAlg was not significantly influenced by 1 mM Cu²⁺ and Co²⁺. Additionally, 1 mM and 10 mM Mg²⁺ and Fe³⁺ exhibited obvious inhibitory effects on the recombinase; 10 mM Mg²⁺ and Fe³⁺ could reduce the enzyme activity to 67.8% and 64.8%, respectively. Moreover, 1 mM and 10 mM EDTA, K⁺, and Na⁺ had no significant influence on the enzyme activity, which is consistent with the results of Liang et al. (2023) [33]. Furthermore, Mn²⁺, Zn²⁺, Ba²⁺, Ca²⁺, and Fe²⁺ showed inhibitory effects at a concentration of 1 mM, while the inhibitory effects at 10 mM were weakened but still lower than the control enzyme activity. Metal ions modulate enzyme activity primarily by influencing the structure of the enzyme’s active site, altering substrate binding affinity, and modifying the higher structure of the enzyme protein [36]. However, the amino acid composition of alginate lyases from various sources exhibits significant variability, and the impact of metal ions on their activities also differs. For instance, in this study, 10 mL of Cu²⁺ notably enhanced the enzymatic activity derived from Exiguobacterium, whereas it had an inhibitory effect on the alginate lyase from Microbulbifer thermotolerans [33].

4. Conclusions

This study centered on an Exiguobacterium strain and revealed that it possesses three distinct types of alginates lyase genes, which are expressed through extracellular secretion for the degradation of alginate. The expression of these three genes in E. coli revealed that their enzyme activity was lower than that of the original strain. After optimizing the codon of the Ebalg664, which exhibits the highest enzyme activity among the three alginate lyases, in P. pastoris, a recombinant alginate lyase EbAlg664 was successfully expressed and produced. The activity of the recombinant enzyme reached 1306 U/mg protein, which is 3.9 times that of the original Exiguobacterium enzymes. The results of enzymatic analysis showed that the temperature and pH stability of recombinant EbAlg664 were lower than that of the original alginate lyases. Cu²⁺ and Co²⁺ can promote recombinase activity, while Mg²⁺ and Fe³⁺ can decrease the activity of recombinase. The successful expression of recombinant alginate lyase in P. pastoris offers a theoretical and practical foundation for the industrial production of this enzyme. In the future, we will carry out further research on the relationship between the three alginate lyases in the original Exiguobacterium and attempt to further enhance the recombinant enzyme’s activity and stability. For instance, we may modify key amino acid residues by site-specific mutation. Additionally, we can boost the yield of the enzyme protein by elevating the activity of the promoter and strengthening gene expression.