Effects of Chinese Herbal Medicines on Growth Performance, Antioxidant Capacity, and Liver and Intestinal Health of Hybrid Snakehead (Channa maculata ♀ × Channa. argus ♂)

Abstract

Chinese herbal medicines have become a new green feed additive in the aquaculture industry. The aim of this study is to investigate the effects of traditional Chinese herbal medicines (Isatidis radix, Forsythia suspensa, and Schisandra chinensis) on the growth performance, antioxidant capacity, and intestinal microbiota of hybrid snakehead (Channa maculata ♀ × Channa argus ♂). A total of 600 fish (mean weight: 15.85 ± 0.15 g) were randomly assigned to five groups, including the control group (CG), I. radix extract group (IRE), F. suspensa extract group (FSE), S. chinensis extract group (SCE), and the Chinese herbal medicine mixture group (CHMM; a mixture of extracts of I. radix, F. suspensa, and S. chinensis at the ratio of 1:1:1) for 6 weeks. The results show that the IRE-supplemented diet improved the survival rate (SR), feed efficiency ratio (FE), and condition factor (CF) compared to others. Compared to the control group, the activity of superoxide dismutase (SOD) in plasma and intestine was significantly increased in the FSE and CHMM groups, whereas the content of malondialdehyde (MDA) in plasma and liver was significantly reduced in the SCE group. A 16s rRNA analysis indicates that dietary supplementation with FSE significantly promoted the proliferation of Fusobacteriota, while IRE supplementation increased the alpha diversity of intestinal bacteria. In conclusion, the addition of I. radix to the diet of hybrid snakehead improves growth, antioxidant capacity, and liver and intestine health, and modulates the intestinal microbiota of snakehead positively.

1. Introduction

Aquatic products provide an important source of high-quality protein for human consumption. However, the rapid expansion of aquaculture in recent years has resulted in serious water pollution and frequent outbreaks of fish diseases, which pose major challenges to the sustainable development of this industry [1]. The employment of antibiotics as additives in farming has efficaciously alleviated this predicament. Nevertheless, the chronic use of antibiotics also incurs consequences, such as drug residues and the formation of drug-resistant and mutant strains, which are to the detriment of human health [2]. Therefore, and in light of the prohibition on the use of antibiotics as feed additives, it is imperative to promptly identify viable alternatives that can effectively enhance the safeguarding of both animal-derived food products and human health. Traditional Chinese herbal medicines (CHMs) are highly valued for their abundant content of phenolic, polyphenolic, alkaloid, quinone, terpenoid, and polypeptide compounds. Many of these compounds have demonstrated efficacy as viable alternatives to antibiotics, chemicals, and other synthetic substances [3]. CHMs are also known to stimulate growth, and exhibit antioxidant, antimicrobial, and antiviral activity, as well as activating the immune responses of aquatic animals [4].

Although CHM additives have been increasingly used in aquaculture in recent years, the underlying mechanisms by which CHM extracts affect fish growth and metabolism are still unclear due to their wide variety and complex composition. I. radix is one of the plants used in CHM, and contains a variety of bioactive constituents, including polysaccharides, alkaloids, and lignans. In particular, the polysaccharide component serves as a key active ingredient, with immunomodulatory, antiviral, antibacterial, and anti-tumor properties [5]. A study has shown that I. radix can significantly alleviate growth retardation and liver and kidney dysfunction, as well as oxidative stress induced by herbicides, in Nile tilapia (Oreochromis niloticus) [6]. Furthermore, the addition of I. radix residue in feed has improved the egg production performance and intestinal microbiota of chickens [7]. The F. suspensa plant has a diverse range of pharmacological components, including lignans, flavonoids, volatile components, triterpenoids, and coumarin compounds that possess anti-inflammatory, antioxidant, and hepatoprotective effects [8]. Supplementation of F. suspensa in diets can improve the growth performance, antioxidant capacity, anti-inflammatory function, and intestinal health of sows [9]. The administration of F. suspensa improved intestinal homeostasis in mice with ulcerative colitis by modulating the gut microbiota composition and increasing levels of short-chain fatty acids (SCFAs) in the intestine [10]. S. chinensis contains lignans, polysaccharides, volatile oils, organic acids, vitamins, and other bioactive chemical constituents [11]. It exhibits potent anti-inflammatory and anti-cancer properties, exerts hepatoprotective and cardioprotective effects, and regulates blood pressure and lipid levels, as well as enhancing immune function [12]. Research shows that S. chinensis polysaccharides have the potential to enhance the innate immunity and disease resistance of crucian carp (Carassius auratus) [13] and may help combat ulcerative colitis by affecting the intestinal flora of mice [14]. Additionally, studies have shown that S. chinensis, as an additive added to feed, can improve the muscle quality of triploid crucian carp [15]. Although there have been some studies on the application of these Chinese herbs as feed additives in livestock and poultry feed, their potential as green additives for promoting growth, liver function, and intestinal health in aquatic animals remains underexplored.

The hybrid snakehead, which is the hybrid offspring of the male northern snakehead (Channa argus) and the female blotch snakehead (Channa maculata), is an important economic freshwater fish in China because of its remarkable characteristics of rapid growth, cold tolerance, and high survival rate [16]. Its annual production has exceeded 0.6 million tons since 2023 [17]. However, the implementation of a high-density culture inevitably gives rise to environmental pollution and disease-related challenges [18]. It is of great significance to find green additives to solve the problems caused by high-density culture. Therefore, this study aims to evaluate the impacts of three CHM extracts, I. radix, F. suspensa, S. chinensis, and a mixture of the three, on growth performance, antioxidant capacity, liver and gut health, and the intestinal microbiota of hybrid snakehead. This information could provide a reference to confirm the feasibility of using Chinese herbs as feed additives in aquaculture practices for snakeheads.

2. Materials and Methods

2.1. Diet Production

The Chinese herbal medicines utilized in this study consisted of dry roots from I. radix, F. suspensa, and S. chinensis. The specific extraction conditions were as follows: the herbs were crushed into coarse powder and were immersed in water in a suitable decoction device. After soaking for 2 h, the herbs were heated to boiling point and maintained at a gentle boil for 40 min before the separation of the decoction. The residual herbs were repeatedly decocted until the decoction was light. Finally, the combined decoctions were concentrated and dried by spray drying in the spray tower. For spray drying, a laboratory-type SD-BSDIC spray dryer (Labplant, UK) was used, and conditions were controlled for air inlet temperature, fan frequency, injection speed, and spray pressure conditions [19]. These extracts were provided by the Key Laboratory of the Ministry of Education for Medicinal Resources and Natural Pharmaceutical Chemistry, Shaanxi Normal University. The experiment included the control group (CG), the I. radix extract group (IRE), the F. suspensa extract group (FSE), the S. chinensis extract group (SCE), and the mixture extract group (CHMM: I. radix, F. suspensa, and S. chinensis in a ratio of 1:1:1 on a weight basis). Prior to the preparation of the experimental feed, it was necessary to grind the foundational feed and incorporate the extracts into the basal feed at a concentration of 1% (w/w). This was thoroughly mixed and made into 3 mm pellet feed. The pellets were then dried at 70 °C in an oven and stored at 4 °C for future use. The composition of the experimental diet, as shown in

Table 1. Formulation and proximate composition of basal diet (dry matter, g kg⁻¹).

Ingredients	CG	IRE	FSE	SCE	CHMM
Fish meal	320	320	320	320	320
Soybean meal	250	250	250	250	250
Corn gluten meal	120	120	120	120	120
Gluten flour	110	100	100	100	100
Cassava starch	80	80	80	80	80
Fish oil	30	30	30	30	30
Soybean oil	30	30	30	30	30
Vitamin premix 1	3.9	3.9	3.9	3.9	3.9
Mineral premix 2	50	50	50	50	50
Vitamin C	5	5	5	5	5
Choline chloride	1.1	1.1	1.1	1.1	1.1
Isatidis radix extract	-	10	-	-	-
Forsythia suspensa extract	-	-	10	-	-
Schisandra chinensis extract	-	-	-	10
Mixed extract (1:1:1)	-	-	-	-	10
Proximate composition
Crude protein (%)	43.20	43.12	42.88	43.25	43.41
Crude lipids (%)	7.51	7.42	7.36	7.47	7.48
Ash (%)	9.45	9.55	9.61	9.48	9.64
Moisture (%)	5.64	5.85	5.46	5.84	6.24
Carbohydrate (%)	34.20	33.50	33.41	33.28	33.89
Gross energy (kJ/g)	19.05	18.59	18.89	19.15	19.35

¹ Vitamin premix supplied by Guangzhou Nutriera Group Co., Ltd., Guangzhou, Guangdong, China. ² Mineral premixes (mg kg⁻¹ diet): NaCl, 500.0; MgSO₄ 7H₂O, 8155.6; NaH₂PO₄ 2H₂O, 12,500.0; KH₂PO₄, 16,000.0; CaHPO₄ 2H₂O, 7650.6; FeSO₄·7H₂O, 2286.2; C₆H₁₀CaO₆ 5H₂O, 1750.0; ZnSO₄ 7H₂O, 178.0; MnSO₄·H₂O, 61.4; CuSO₄ 5H₂O, 15.5; CoSO₄ 7H₂O, 0.9; KI, 1.5; Na₂SeO₃, 0.6.

, provides about 43% crude protein, mainly from fish meal and soybean meal, and 7.51% lipid from fish oil and soybean oil.

2.2. Experimental Fish and Management

All animal care and experimental protocols received approval from the Institutional Animal Care and Use Ethics Committee of the Chinese Academy of Fishery Sciences. The experiment was carried out in a recirculating aquaculture system at the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences (Guangzhou, Guangdong). At the beginning of the experiment, juvenile hybrid snakehead were acclimatized to a commercial diet for a duration of two weeks and were provided with basal feed twice daily. After stable domestication, fish of similar size (15.85 ± 0.15 g) were randomly assigned to 15 tanks (250-L), and each tank was stocked with 40 juveniles. Each experiment was conducted in triplicate. Fish were hand-fed to apparent satiation twice daily (at 8:00 and 17:00) for a duration of 6 weeks. The rearing conditions during the feeding period were as follows: water temperature, 26.5–28.2 °C; pH, 7.1–8.0; ammonia nitrogen, <0.1 mg L⁻¹; and dissolved oxygen, 5.6–6.5 mg L⁻¹.

2.3. Sample Collection

Fish fasted for 24 h after the last meal, then were counted and weighed. Two fish were randomly selected from each tank for the purpose of conducting whole-body composition analysis. Three fish were taken from each tank for body length and weight measurements, and the liver and visceral mass were dissected and weighed to calculate the hepatosomatic index (HSI), viscerosomatic index (VSI), and condition factor (CF). To analyze the plasma biochemistry, antioxidant parameters, and gene expression, another three fish were selected randomly from each tank and anesthetized with 60 mg L⁻¹ MS-222 (tricaine methanesulfonate; Sigma-Aldrich; St. Louis, MO, USA). Blood samples were collected from the caudal vasculature using a 1-mL syringe and centrifuged at 3000× g for 10 min at 4 °C. The supernatant was stored in a centrifuge tube at −80 °C for subsequent biochemical analysis. The intestines were removed, and the livers were quickly packaged into enzyme-free frozen tubes in liquid nitrogen. They were then stored at −80 °C for enzyme activity and gene expression analysis, as well as high-throughput sequencing of intestinal microbiota. A portion of the liver and intestine was fixed in 4% paraformaldehyde for paraffin sectioning.

2.4. Measurement and Methods

2.4.1. Growth Performance and Physical Indices

The below formulae are the calculations for the WGR, SGR, FE, FR, SR, CF, HSI, and VSI:

Weight gain rate (WGR, %) = 100 × [(final body weight (g) − initial body weight (g)]/initial body weight (g);

Specific growth rate (SGR, %/d) = 100 × [ln (final body weight (g)) − ln (initial body weight (g))]/days;

Feed efficiency ratio (FE, %) = (100 × fresh body weight gain (g))/dry feed intake (g);

Feeding rate (FR, % BW/d) = 100 × feed intake (g) / [days × (initial body weight (g) + final body weight (g))/2];

Feed conversion ratio (FCR) = feed intake (g)/[final body weight (g) − initial body weight (g)];

Survival rate (SR, %) = 100 × final fish number/initial fish number;

Condition factor (CF, g/cm³) = 100 × (final body weight (g)/body length³);

Hepatosomatic index (HSI, %) = 100 × [liver weight (g)/final body weight (g)];

Viscerosomatic index (VSI, %) = 100 × [viscera weight (g)/final body weight (g)].

2.4.2. Composition of the Diet

The chemical compositions of the feed and fish (moisture, ash, crude protein, crude fiber, and crude lipids) were analyzed following the official methods of AOAC [20]. Dry matter content was determined according to method 930.15 of AOAC. The determination of crude protein was conducted by multiplying the nitrogen content by a conversion factor of 6.25. The nitrogen measurement was performed in accordance with the AOAC method 984.13. The lipid and ash contents were measured according to methods 920.39 and 942.05 of AOAC, respectively.

2.4.3. Biochemical Indices

The liver and intestine were homogenized in 0.67% ice-cold normal saline (1:10 dilution). Subsequently, the homogenate was then centrifuged for 10 min (4 °C, 12,000 rpm), and the supernatant was utilized to evaluate the analysis of antioxidant enzymes. Plasma high-density lipoprotein cholesterol (HDL-C, cat. A112-1-1), low-density lipoprotein cholesterol (LDL-C, cat. A113-1-1), total cholesterol (TC, cat. A111-1-1), triglyceride (TG, cat. A110-1-1), blood urea nitrogen (BUN, cat. C013-2-1), glucose (GLU, cat. A154-2-1), alanine aminotransferase (ALT, cat. C009-2-1), aspartate aminotransferase (AST, cat. C010-2-1), and alkaline phosphatase (AKP, cat. A059-2) were assessed using commercial kits (Jiancheng Biotech Co., Ltd., Nanjing, China). The enzymatic activities of superoxide dismutase (SOD, cat. A001-3), catalase (CAT, A007-1-1), and malondialdehyde (MDA, cat. A003-1) were measured according to the instructions of the commercial assay kits (Jiancheng Biotech Co., Ltd., Nanjing, China).

2.5. Hepatic and Intestinal Histology Analysis

The liver and intestines were fixed in a 4% paraformaldehyde solution for 24 h, followed by being dehydrated in a series of alcohol solutions, equilibrated in xylene, and embedded in paraffin wax. The tissues were sectioned into thin slices measuring 6 μm and subsequently stained with hematoxylin and eosin (HE). These sections of the liver were stained with neutral Oil Red O to enable visualization of the accumulation of lipid droplets in the liver. Microscopic and image-acquisition analyses were performed using an Axio Imager A2 (Carl Zeiss AG, Oberkochen, Germany) microscope. The analysis and measurement of muscular thickness, villus height, villus width, and goblet cell count in the intestines were conducted utilizing Case Viewer software (version 2.4.0.119028).

2.6. Quantitative Real-Time PCR Analysis

The total RNA of liver and intestine was extracted using a TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The synthesis of cDNA was carried out using a Prime-Script RT reagent kit (TaKaRa; Otsu, Japan), in accordance with the manufacturer’s guidelines. The analysis of target genes via real-time PCR took place on a StepOnePlus Real-Time PCR System (ABI, Thermo Fisher Scientific, Waltham, MA, USA), employing SYBR Green Master Mix (Toyobo; Osaka-fu, Japan). Each sample was analyzed in triplicate, and the expression levels of the gene were computed using the 2^−ΔΔct method. The primers used are listed in

Table 2. The sequence information of primers involved in qRT-PCR.

Gene Names	Primer Sequence (5′-3′)	Product Size (bp)	PCR Amplification Efficiency	Melting Temperature, °C	GenBank No.
β-actin	F- GCCCTCTTCCAGCCTTCCTT R-AGTGTTGGCATACAGGTCTTTACGG	146	1.985	59	[21]
ef1a	F-GGAAAGGAAAAGACCCACAT R-TATCCACAGCCTTGATGACA	124	1.950	57	This study
ikba	F-AAAATGTTACCGTGCCAGGAC R-ATGTATCACCGTCGTCAGTC	160	1.998	59	[22]
nf-kb p65	F-CAGCCAAAACCAAGAGGGAT R-TCGGCTTCGTAGTAGCCATG	233	1.958	59	[22]
il-8	F-GAGTCTGAGCAGCCTGGGAGT R-CTGTTCGCCGGTTTTCAGTG	154	2.011	57	[21]
il-10	F-ATTTCTCCTCCTGTGGGTCCTGG R-TCTGATCTGGGAATAATCCTGTCTC	152	1.955	54	This study
sod	F-GGCCGAACCATGGTGATACA R-ACTGGGCAATGCCAATGACT	203	2.005	56	[21]
cat	F-TCGTCTCTTCTCCTACCCCG R-ACACGCACATTGGACCATCA	125	2.010	60	This study
keap1	F-GCTGTCATCAACCGACTTCTT R-TGTCTTCCATTCGTCCTTCTC	102	1.977	58	This study

Abbreviations: inhibitor of NF-κBα (iκbα), nuclear factor kappa B p65 subunit (nfκb-p65), interleukin-8 (il-8), interleukin-10 (il-10), Cu/Zn superoxide dismutase (sod), catalase (cat), Kelch-like ECH-associated protein 1 (keap1).

.

2.7. Intestine Microbiome Analysis

A total of 30 intestinal samples, comprising 6 replicate samples from each group, were utilized for the analysis of the intestinal microbiome. Utilizing proprietary primers 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′), a thermo-cycling PCR system (Omega Inc., Norcross, GA, USA) was employed to amplify the V3-V4 hypervariable region of the 16S rRNA gene. PCR products were analyzed using agarose gel electrophoresis and subsequently purified using the Omega DNA Purification Kit (Omega Inc., Norcross, GA, USA). After purification, PCR products were collected and paired-end sequencing (2 × 250 bp) was performed on the Illumina Novaseq 6000 platform (Illumina, San Diego, USA). The 16S rRNA gene sequencing of the sample was completed by Baimaik Biotechnology Co., Ltd. (Shanghai, China). USEARCH software (version 10.0) was used to group sequences that met more than 97% similarity criteria into an operational classification unit (OTU). OTUs were then annotated for classification using the Naive Bayes classifier in QIIME2 (confidence threshold 179) and the SILVA database (release 138.1). To evaluate the diversity of each sample species, QIIME2 (V2024.10) software was used to calculate the α diversity measure of the Chao1 index, Shannon index, Simpson index, and ACE (abundance-based coverage estimator). Principal coordinate analysis (PCoA) was used for β diversity analysis to evaluate species richness among samples.

2.8. Statistical Analysis

All data were presented as means ± standard error, and analysis was carried out utilizing SPSS 24.0 (Chicago, MI, USA) with Duncan’s multiple range test. One-way analysis of variance was performed on all data. Before conducting the analysis, the normal distribution of the data was evaluated through the Shapiro–Wilk test, while the homogeneity of variance was examined using Levene’s test. The Pearson correlation coefficient analysis was executed with R 4.1.0 (R Core Team, Vienna, Austria) and RStudio 1.4.1106 (RStudio, Boston, MA, USA). The Pearson correlation analysis and heatmap visualization between the levels of intestinal microbiota, classified at either the phylum or genus level, and the expression of gut inflammatory genes, growth performance, and intestinal antioxidant indices in hybrid snakeheads. The results are statistically significant at p < 0.05.

3. Results

3.1. Growth Performance

As shown in

Table 3. Effects of dietary supplementation with herbal extracts on growth performance of hybrid snakehead.

	CG	IRE	FSE	SCE	CHMM
1IBW (g)	15.83 ± 0.18	15.88 ± 0.35	15.94 ± 0.17	15.84 ± 0.19	15.81 ± 0.15
2FBW (g)	47.08 ± 1.8	44.37 ± 1.43	43.48 ± 1.93	29.15 ± 2.13	39.75 ± 4.11
3WGR (%)	197.53 ± 12.01 a	179.27 ± 11.55 a	172.82 ± 3.10 a	48.03 ± 8.87 c	110.67 ± 15.02 b
4SGR (%/d)	2.42 ± 0.09 a	2.28 ± 0.09 a	2.23 ± 0.03 a	0.86 ± 0.14 c	1.64 ± 0.16 b
5FE (%)	101.00 ± 6.03 a	103.49 ± 2.16 a	80.97 ± 2.32 a	36.76 ± 5.39 c	67.84 ± 2.28 b
6FR(%BW/d)	1.87 ± 0.10 a	1.88 ± 0.03 a	1.73 ± 0.05 ab	0.93 ± 0.01 b	1.76 ± 0.01 ab
7FCR(%)	0.85 ± 0.56 b	0.80 ± 0.38 b	0.92 ± 0.22 b	2.02 ± 0.25 a	0.99 ± 0.21 b
8SR (%)	85.83 ± 1.67 ab	93.33 ± 0.83 a	78.33 ± 1.64 bc	75.00 ± 2.22 c	80.00 ± 0.00 ab
9CF (g/cm3)	0.93 ± 0.04 b	1.29 ± 0.04 a	1.23 ± 0.01 a	0.81 ± 0.06 b	1.22 ± 0.05 a
10HSI (%)	1.48 ± 0.11	1.69 ± 0.18	1.48 ± 0.18	1.16 ± 0.23	1.27 ± 0.13
11VSI (%)	8.10 ± 0.32 a	8.22 ± 0.39 a	7.59 ± 0.54 ab	6.43 ± 0.67 b	7.10 ± 0.57 ab

In the same row, values with different small-letter superscripts mean significant differences (p < 0.05). ¹IBW: initial body weight; ²FBW: final body weight; ³WGR: weight gain rate; ⁴SGR: specific growth rate; ⁵FE: feed efficiency ratio; ⁶FR: feeding rate; ⁷FCR: feed conversion ratio; ⁸SR: survival rate; ⁹CF: condition factor; ¹⁰HSI: hepatosomatic index; ¹¹VSI: viscerosomatic index.

, at the end of the feeding trial, the survival rate of the IRE group (93.33%) was the highest, and it was markedly superior to that of the FSE and SCE groups (p < 0.05). The WGR and SGR of the CG, IRE, and FSE groups had no significant differences, but the SCE and CHMM groups were significantly lower compared to the control group, with the SCE group demonstrating the worst growth performance (p < 0.05). The values of FE and FR show similar trends among the groups. The IRE group represents the highest value, with the SCE group having the lowest FE and FR (p < 0.05). The FCR of the SCE group is significantly higher compared to that of the other groups. The CF of the CG and SCE groups was found to be significantly lower in comparison to the other groups, while the IRE groups exhibited the highest viscerosomatic index (VSI) (p < 0.05). No notable differences in hepatosomatic index (HSI) were detected among the various groups.

3.2. Hematological Indexes

Hematological parameters of juvenile hybrid snakehead fed different CHM diets are presented in

Table 4. Effects of dietary supplementation with herbal extracts on serum biochemical indices of hybrid snakehead.

	CG	IRE	FSE	SCE	CHMM
HDL-C (mmol/L)	1.59 ± 0.17 bc	4.03 ± 0.55 a	1.87 ± 0.32 b	2.06 ± 0.48 b	0.72 ± 0.13 c
LDL-C (mmol/L)	1.15 ± 0.15 bc	5.11 ± 0.60 a	2.02 ± 0.27 b	1.73 ± 0.72 c	0.58 ± 0.19 c
TG (mmol/L)	5.93 ± 0.88 a	3.77 ± 0.50 b	4.51 ± 0.42 ab	1.76 ± 0.19 c	1.67 ± 0.31 b
TC (mmol/L)	6.16 ± 0.31 a	5.84 ± 0.82 b	5.33 ± 0.65 b	5.32 ± 0.40 b	4.22 ± 0.68 b
GLU (mmol/L)	8.60 ± 1.82 ab	4.63 ± 1.22 b	11.46 ± 2.04 a	8.58 ± 2.00 b	6.99 ± 2.59 b
BUN (mmol/L)	6.64 ± 0.36 a	4.62 ± 0.49 b	4.50 ± 0.28 b	4.63 ± 0.29 b	4.36 ± 0.61 b
AKP (mmol/L)	3.97 ± 0.84 a	3.84 ± 0.51 a	2.52 ± 0.24 ab	2.01 ± 0.28 ab	1.30 ± 0.22 b
AST (mmol/L)	32.89 ± 3.11 a	19.05 ± 4.13 bc	23.14 ± 1.88 b	12.45 ± 3.76 c	20.21 ± 2.05 bc
ALT (mmol/L)	9.65 ± 1.06 a	8.59 ± 1.03 a	8.93 ± 0.90 a	5.17 ± 0.30 b	8.67 ± 1.54 a

In the same row, values with different small-letter superscripts mean significant differences (p < 0.05).

. The HDLC and LDLC levels in serum were significantly higher in the IRE group than in the other groups (p < 0.05). The TG, TC, and BUN levels in serum were significantly lower in the IRE, FSE, SCE, and CHMM groups compared to the control group (p < 0.05). The GLU level was significantly higher in the FSE group than in the others (p < 0.05). Compared to the control group, the AKP and AST levels in serum for groups with CHM extracts demonstrated varying degrees of significant reduction (p < 0.05). The SCE group exhibited a significant decrease in the ALT level (p < 0.05).

3.3. Liver Morphology

The observations pertaining to liver histology, as assessed through HE staining as well as through histochemical analysis utilizing Oil Red O, of the juvenile hybrid snakehead in this study are shown in Figure 1. Compared to the control group, the supplementation of herbal extracts into the diet exhibited varying degrees of efficacy in ameliorating liver damage. The control group exhibited a significant higher incidence of cell vacuolization, nuclei displacement, and lipid droplet aggregation compared to the IRE, FSE, and SCE groups.

3.4. Intestinal Morphology

The intestinal morphology of hybrid snakehead is shown in Figure 2. The intestinal morphology of hybrid snakehead could be improved through dietary supplementation with CHM extracts. The intestinal sections showed that the intestinal villi structure of each experimental group exhibited a more intact and distinct structure than that of the control group (Figure 2). The mean villi heights of the chorion intestine in the FSE group were the highest compared to the other groups. The muscular thickness was significantly higher in the IRE group than that in the control group (p < 0.05). Additionally, the number of goblet cells in both the IRE and FSE groups was significantly higher than those in the control group (p < 0.05) (Figure 3).

3.5. Antioxidant Indicators

As depicted in Figure 4A, the SOD activity in the serum of CHM-supplemented diets was significantly higher compared to the control, and especially the FSE and CHMM groups had significant differences from the control group (p < 0.05). No statistically significant differences in the activities of CAT were observed across all groups. The MDA content of the SCE group in the plasma and liver was significantly lower than that of other groups (Figure 4C,F), but the MDA content of the intestine had an opposite trend (p < 0.05) (Figure 4I). No statistically significant differences were observed in the activities of SOD and CAT in the liver among the experimental groups. The intestinal SOD activity in the SCE group was significantly higher than that in the control group (Figure 4G) (p < 0.05). The intestinal CAT activity in the IRE group was significantly higher than that in the other groups (p < 0.05).

3.6. Gene Expression in Liver and Intestine

The impact of CHMs on the relative expression levels of immune-related genes and antioxidant genes, including the inhibitor of nuclear factor kappa B alpha (IκBα), nuclear factor kappa B p65 subunit (nfκb-p65), interleukin-8 (il-8), interleukin-10 (il-10), Cu/Zn superoxide dismutase (sod), catalase (cat), and the Kelch-like ECH-associated protein 1 (keap1), in the intestine and liver of hybrid snakehead is shown in Figure 5. The expression levels of ikba in the liver were significantly upregulated in the CHMM group compared to the control group (p < 0.05) (Figure 5A). In comparison with the control group, the IRE and CHMM groups exhibited significantly upregulated relative expression levels of il-10. There were no significant differences in the expression of nfkb-p65 of all groups. The expression levels of il-8 in the SCE group were significantly upregulated compared to the others (p < 0.05). The expression level of sod in the liver was significantly elevated in the SCE group compared to the control group (p < 0.05). The cat expression levels in the liver were significantly elevated only in the SCE and CHMM groups compared to the IRE group (p < 0.05). The expression levels of keap 1 in the SCE and CHMM groups were significantly elevated compared to the other groups. As presented in Figure 5B, the nfkb-p65 expression levels in the intestine were significantly downregulated only in the SCE group compared to the IRE group (p < 0.05). Compared with the control group, the gene expression levels of il-8 in all groups with the CHM extracts were significantly downregulated (p < 0.05). The expression levels of sod in the CHMM group were significantly downregulated compared to the other groups. There were no significant differences in the expressions of ikba, il-10, cat, and keap1 among all groups.

3.7. Intestinal Microbiota

As shown in

Table 5. Diversity index on OTU level of intestinal microbiota of hybrid snakehead.

	Chao1	ACE	Simpson	Shannon	Coverage
CG	1148.52 ± 259.54 ab	1146.50 ± 259.43 ab	0.98 ± 0.15	8.05 ± 0.52 ab	0.999
IRE	1219.61 ± 134.93 a	1216.33 ± 134.97 a	0.99 ± 0.05	8.92 ± 0.53 a	0.999
FSE	731.07 ± 108.13 b	728.50 ± 107.94 b	0.90 ± 0.06	7.10 ± 1.03 ab	0.999
SCE	767.04 ± 74.03 ab	766.00 ± 74.29 ab	0.99 ± 0.01	8.31 ± 0.23 ab	0.999
CHMM	695.90 ± 109.95 b	693.83 ± 110.00 b	0.93 ± 0.22	6.79 ± 0.63 b	0.999

Note: Means with different letters in a column are significantly different (p < 0.05).

, the Chao 1, ACE, Simpson, and Shannon indexes were used to analyze the differences in alpha diversity among all groups. The coverage index neared unity, suggesting a thorough representation of the bacterial community and confirming that the gathered data reliably reflect the complete bacterial population. The Chao 1, ACE, and Shannon indexes in the IRE group were significantly higher than those of the FSE and CHMM groups (p < 0.05). There were no significant differences in the Simpson index among the groups. The PCoA analysis at the OTU level indicated significant differences in the composition of intestinal microbiota between the FSE and CHMM groups compared to the other groups (Figure 6A). The Venn diagram shows that 189 OTUs were common among the different groups (Figure 6B). Additionally, the numbers of unique OTUs in the intestines of the CG, IRE, FSE, SCE, and CHMM groups were 6244, 6698, 3967, 4154, and 3605, respectively.

At the phylum level, the composition of the intestinal microbiota in all groups primarily comprised Firmicutes, Proteobacteria, Bacteroidetes, Fusobacteriota, and Actinobacteriota (Figure 7A). Compared with the three groups of CG, IRE, and SCE, the FSE and CHMM groups exhibited a significant disparity in Fusobacteria, which presented as the predominant phylum in the FSE and CHMM groups, accounting for 25.57% and 12.98% of the total abundance. At the genus level, the intestinal microbiota primarily comprised Cetobacterium, Bacteroides, Plesiomonas, and unclassified_Bacteria, unclassified_Lachnospiraceae, and unclassified_Muribaculaceae, which constituted the dominant bacterial community in the intestines of the hybrid snakeheads (Figure 7B). Among them, the abundance of Cetobacterium was significantly higher in the FSE and CHMM groups than in the other groups, accounting for 25.45% and 12.80% of the total abundance. The comparative abundance of Plesiomonas in the IRE and SCE groups exhibited a decline in relation to the control group.

3.8. Correlation Between Intestinal Microbiota and Inflammatory Gene Expression, Antioxidant Indices, and Growth Performance

Figure 8 reveals the correlations between the abundance of intestinal microbiota, classified at either the phylum or genus level, and the expression of intestinal inflammatory genes, intestinal antioxidant indices, and growth performance in hybrid snakeheads. A positive correlation is observed between the abundance of Firmicutes and CAT activity, but a negative correlation with the WGR, SGR, and FCR is exhibited. However, the abundance of Acidobacteriota positively correlates with the WGR, SGR, and FCR (Figure 8A). At the genus level, Faecalibacterium and the anti-inflammatory gene il-10 show a strong positive correlation. Escherichia-Shigella, il-10, and ikba are also positively correlated. Furthermore, a significantly positive correlation is observed between Bacteroides and il-10, but a negative correlation is observed with sod. (Figure 8B).

4. Discussion

Many studies have demonstrated that CHM can effectively promote growth and development, as well as enhance the immunity of fish [23,24]. In this study, three CHM extracts and their mixtures were added to the diet at a 1% level to evaluate their effects on the survival, growth, and hepato-intestinal health of hybrid snakehead. The findings of this study indicate that the survival rate of hybrid snakehead was significantly enhanced when the feed was supplemented with 1% I. radix extract. Moreover, supplementation with IRE and FSE did not exert any detrimental effects on the growth performance and feed utilization of hybrid snakehead. Previous studies have shown that dietary supplementation with 3% Isatis tinctoria ultramucine powder improves the growth performance of grass carp (Ctenopharyngodon idellus) larvae [25], and similar effects have been found in hens [26]. It has also been confirmed in mammalian studies that dietary FSE supplementation improves the average daily gain and feed conversion rate of weaned piglets [27]. However, it is noteworthy that the growth performance and feed utilization efficiency of the SCE and CHMM groups in this study were significantly inferior to those of the other groups. This phenomenon may be attributed to the poor aqueous solubility and taste of lignans, which are the primary chemical components of S. chinensis extract. Ding’s study also noted that these pharmacologically active ingredients in S. chinensis are hydrophobic and are known for their unpleasant taste [28].

Serum biochemical indexes can provide important information about an animal’s antioxidant performance, nutrition metabolism, health, and immune ability. AKP, ALT, and AST are significant transaminases in fish, serving as indicators of hepatic health [29]. In this study, compared to the control group, the plasma AKP and AST levels in the groups supplemented with CHM exhibited varying degrees of reduction, indicating that these herbal extracts could effectively enhance liver function. Previous studies have reported decreased levels of serum AST or ALT in juvenile gibel carp (Carassius auratus gibelio var. CAS III) fed with Moringa (Moringa oleifera Lam.) [30], as well as in white shrimp (Litopenaeus vannamei) fed Astragalus membranaceus and Bupleurum chinense [31]. The SCE group showed a significant decline in the levels of AST and ALT, which was consistent with the liver-protecting pharmacological effects of S. chinensis [32]. TG and TC are key byproducts of lipid metabolism, and a rise in serum cholesterol typically coincides with a rise in triglycerides. LDLC and HDLC play roles in cholesterol transport, with LDLC carrying cholesterol from the liver to various tissues, while HDLC transports cholesterol back to the liver from other tissues [33]. In this study, the addition of CHM into the feed significantly decreased the plasma TG and TC levels in hybrid snakehead, indicating that these extracts from CHM can effectively enhance lipid metabolism. It has been suggested that the active components of these herbs, including polysaccharides, saponins, phenols, and flavonoids, can significantly influence the absorption of triglycerides and cholesterol in plasma, thereby contributing to a reduction in blood lipids in animals [34]. Additionally, the employment of frozen tissue sections and Oil Red O staining techniques also holds a considerable reference value for the determination of hepatic steatosis in fish [35]. In this study, liver morphologic observations showed that IRE, SCE, and FSE can significantly reduce lipid droplet deposition in the liver of hybrid snakehead. This phenomenon is consistent with the changes in plasma triglycerides, and suggests that adding herbal extracts can improve liver health. Furthermore, a study conducted on mice has demonstrated that the administration of three herbal dietary supplements led to a significant reduction in plasma lipid levels and the accumulation of cytoplasmic fat droplets in the liver [36].

It is widely recognized that endogenous antioxidant enzymes like SOD and CAT are crucial for eliminating harmful reactive oxygen species, protecting cells from oxidative damage. MDA, a byproduct of lipid peroxidation, is a biomarker for oxidative damage [37]. In this study, dietary supplementation with F. suspensa significantly increased plasma SOD activity. The same results were obtained for on-growing shrimp (Penaeus monodon) [38]. This result may be attributed to the fact that F. suspensa is abundant in flavonoids, which possess remarkable anti-free-radical and anti-antioxidant effects [39]. Some studies have shown that dietary CHM compounds significantly elevate the activities of total antioxidative capacity [40]. The liver antioxidant parameters of the hybrid snakehead showed that dietary supplementation with CHM had no significant effect on the activities of liver SOD and CAT, but significantly reduced the content of MDA, indicating that CHM could effectively protect liver health. However, the activities of SOD and CAT in intestine in the SCE group were significantly increased, while MDA increased accordingly. Consequently, we hypothesize that suboptimal pharmacokinetic behavior may have induced intestinal oxidative stress in the SCE group [28]. The reduction in both intestinal villus length and goblet cell number observed in the hybrid snakeheads supports this hypothesis. However, the mechanisms underlying the effects of these herbs on intestinal oxidative stress need to be further studied.

Inflammation is a characteristic of the innate immune response and is mainly cytokine-mediated. IκB or lack of alpha activity change can lead to the NF-κB activity disorder, various infectious diseases, autoimmune diseases, cancer, and genetic diseases [41]. IL-8 is a proinflammatory factor involved in the inflammatory response in the early stages. The generation of IL-10 is mainly linked to the regulatory T (Treg) cells, which are crucial for preserving balance in the intestines [42]. In the present study, the relative expression of iκba in the liver was significantly upregulated in the experimental group compared to the control group. Additionally, the expression levels of proinflammatory factor il-8 were significantly elevated in the SCE group, while the expression of the anti-inflammatory factor il-10 in the liver was suppressed. The expression of liver antioxidant-related genes suggests that the extracts derived from S. chinensis have potential hepatoprotective effects. It is noteworthy that dietary supplementation with I. radix extracts in this study significantly inhibited the expression of proinflammatory cytokine il-8, which may partly explain the protective effects of herbal extracts on intestinal health.

The growing interest in herbs or plant extracts stems from their potential to enhance performance through the maintenance of a healthy intestine environment. The morphology and structure of the intestines is essential for their normal function, and the intestinal villus exerts a considerable impact on the absorption of nutrients in fish [43]. The thickness of the muscularis in the intestinal wall serves as an indicator for assessing its functionality, thereby facilitating enhanced absorption of nutrients and promoting superior growth performance [44]. Our results show that the muscular thickness in the IRE group, and the number of goblet cells in the IRE and FSE groups exhibited a significant increase compared to the control. Fish rely on their intestinal microbiota to complete many important functions, including the digestion and absorption of nutrients, strengthening the immune system, and resisting harmful pathogens [45,46]. In the present study, the IRE group exhibited the highest value in both the alpha diversity and abundance of intestinal microbiota, with the highest number of OTUs. Our findings indicate that Proteobacteria and Firmicutes were predominant across all groups. This suggests their significant role in forming the majority of the microbiota and in sustaining microbial homeostasis in juvenile snakeheads. In addition, the FSE group significantly reduced the relative abundance of both Bacteroidota and Firmicutes, while increasing that of Fusobacteria. Fusobacteria are recognized as vitamin B12 producers and possess the ability to metabolize carbohydrates and peptides [47]. The correlation analysis reveals that Firmicutes are negatively correlated with growth performance, while positively correlated with the CAT activity. This suggests that an increase in the relative abundance of Firmicutes is beneficial to some extent in improving antioxidant capacity. Conversely, Acidobacteriota exhibited a significant positive correlation with growth performance. Members of the Acidobacteriota phylum have been linked to various metabolic processes, including carbohydrate metabolism, nitrogen metabolism, the production of exopolysaccharides, and the functioning of transporters [48].

The abundance of Cetobacterium significantly increased at the genus level in both the FSE and CHMM groups. Research indicates that Cetobacterium has the capacity to stimulate the parasympathetic nervous system via the metabolite acetic acid, thereby enhancing insulin secretion and improving glucose utilization in fish [49]. This activation serves a significant regulatory function in their overall health. The level of GLU in the FSE group was significantly higher than in the other groups, which may provide an opportunity for Cetobacterium to proliferate and function. The relative abundance of Plesiomonas in the IRE and SCE groups was lower than that in the control group, and some studies have suggested that Plesiomonas is the opportunistic pathogen of human–animal–fish [50]. Faecalibacterium is a significant producer of butyric acid, a compound known for its anti-inflammatory properties. It plays a crucial role in sustaining the activity of bacterial enzymes, safeguarding the digestive system against intestinal pathogens, and functions as a probiotic [51]. The correlation analysis shows a significant positive correlation with the anti-inflammatory factor il-10, and its abundance was significantly increased in the SCE group. Therefore, the proliferation of Faecalibacterium was stimulated, causing the increase in the expression of the anti-inflammatory gene il-10, and reducing intestinal inflammation to a certain extent. This mechanism has been confirmed in many studies [52]. The imbalance of Escherichia can induce intestinal inflammation, which was positively correlated with il-10 and ikba, suggesting that the increase of Escherichia within the normal range may improve the anti-inflammatory ability. Bacteroides were significantly positively correlated with il-10, and their abundance was beneficial to maintaining intestinal health and resisting inflammation.

5. Conclusions

In conclusion, the antioxidant capacity of hybrid snakehead was improved, specifically in the FSE group. Supplementation of diets with I. radix and F. suspensa could change the gut morphology and microflora of the hybrid snakehead. The above results demonstrate that supplementing the diet with I. radix extract effectively protected the intestine of juvenile hybrid snakehead by improving intestinal barrier function and reducing intestinal inflammation and oxidative stress, and consequently improved both the survival rate of juvenile hybrid snakehead and feed utilization efficiency. On this basis, it is necessary to further study the mechanism of the effect of active components of traditional Chinese medicine on the growth and health of fish.