Next Article in Journal
Effects of Sampling Design on Population Abundance Estimation of Ichthyoplankton in Coastal Waters
Next Article in Special Issue
Effects of Dietary Protein Levels on Growth Performance, Plasma Parameters, and Digestive Enzyme Activities in Different Intestinal Segments of Megalobrama amblycephala at Two Growth Stages
Previous Article in Journal
Effects of Maternal Stress on the Development of the Somatotropic Axis During the Larval and Juvenile Stages in Zebrafish (Danio rerio)
Previous Article in Special Issue
Dietary Alpha-Lipoic Acid Alleviated Hepatic Glycogen Deposition and Improved Inflammation Response of Largemouth Bass (Micropterus salmoides) Fed on High Dietary Carbohydrates
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 2
10.3390/fishes10020038
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Taurochenodeoxycholic Acid Improves Growth, Physiology, Intestinal Microbiota, and Muscle Development in Red Swamp Crayfish (Procambarus clarkii)

by
Xiaodi Xu
1,2,
Xiaochuan Zheng
1,2,
Changyou Song
1,2,
Xin Liu
1,2,
Qunlan Zhou
1,2,
Cunxin Sun
1,2,
Aimin Wang
3,
Aiming Zhu
4 and
Bo Liu
1,2,*
1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
3
College of Marine and Biology Engineering, Yancheng Institute of Technology, Yancheng 224007, China
4
Yancheng Academy of Fishery Science, Yancheng 224008, China
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(2), 38; https://doi.org/10.3390/fishes10020038
Submission received: 26 December 2024 / Revised: 19 January 2025 / Accepted: 20 January 2025 / Published: 22 January 2025
(This article belongs to the Special Issue Effect of Dietary Supplementation on the Growth and Immunity of Fish and Shellfish—2nd Edition)
Browse Figures
Versions Notes

Abstract

:
Taurochenodeoxycholic acid (TCDCA), one of the bile acids, is thought to be involved in the regulation of muscle nutrient metabolism and gut microbial homeostasis. However, the effect of dietary addition of TCDCA on Procambarus clarkii is unclear. Therefore, in this study, an 8-week feeding experiment was conducted to explore the potential regulatory mechanisms of TCDCA on P. clarkii growth, physiology, muscle quality and gut microbes. The results indicated that dietary addition of TCDCA not only improved growth performance (final weight; weight gain; and specific growth rate) but also increased muscle elasticity and protein content. In addition, dietary TCDCA promotes muscle growth and development by increasing myofiber length, which is consistent with the activation of the expression of genes related to protein utilization (TOR and AKT) and muscle proliferation and differentiation (MyHC, MLC1, MEF2A, MEF2B). Importantly, 16s rRNA sequencing demonstrated that dietary TCDCA had no significant effect on gut microbial composition (alpha diversity) but significantly increased microbial abundance at the genus level. Functional prediction analysis of differential microbes revealed that dietary TCDCA may promote metabolism by altering gut microbes, thereby promoting muscle quality. In conclusion, our study demonstrates that the dietary addition of TCDCA promotes P. clarkii growth and muscle quality and protein deposition by altering gut microbes.
Keywords:
TCDCA; muscle quality; protein deposition; gut microbiota; Procambarus clarkii
Key Contribution: This paper uncovered the function of TCDCA in the growth, muscle development, muscle nutrient quality, and gut microbiota of P. clarkii.

1. Introduction

Aquaculture is considered one of the sustainable sources of animal protein, with crustaceans being an economically important aquatic product. Healthy culture and disease prevention and control are key to the sustainable development of aquaculture [1,2]. With an increasing awareness of food safety and environmental protection, the research for safe and efficient feed additives has become a new trend in the industry [3]. Procambarus clarkii is a freshwater species which has become one of the important species in aquaculture industry due to its high nutritional value of muscle and soft and tender meat [4]. In 2023, P. clarkii production in China reached nearly 3.1 million tons, accounting for about 9.259% of the country’s total freshwater aquaculture production [5]. With the expansion of P. clarkii culture, a variety of feed additives have been widely used to improve its growth, immunity, and antioxidant capacity [6,7,8] and thus improve the efficiency of farming.
Bile acids (BAs), as a major component of bile, are initially synthesized from cholesterol in the liver and further into the intestine [9]. Bile acids have a variety of physiological functions, including improving growth performance [10], accelerating intestinal digestion and absorption of fat-soluble vitamins [11], and regulating glucose metabolism [12] and immune function [13]. Therefore, the dietary addition of bile acids is widely used in aquatic animals [14,15,16]. Although bile acids have beneficial effects in animals, it has not been reported whether crustaceans are able to synthesize bile acids themselves [17]. Taurochenodeoxycholic acid (TCDCA), as one of the bile acids, is thought to be involved in nutritional regulation and to have an adjunctive therapeutic role in metabolic or immune disorders [18,19]. Studies have shown that TCDCA treatment suppresses SGIV infection in Epinephelu spp. [20]. In mammals, TCDCA not only modulates immunity and inflammation but also treats apoptosis-related diseases [18,21]. However, TCDCA has been limitedly studied in aquaculture, and it is worth investigating whether the regulatory mechanisms of TCDCA in aquatic animals, including crustaceans, are similar to those in mammals.
Studies have shown that changes in gut microbes may increase susceptibility to disease and simultaneously enhance immune system function [22,23], such as diabetes [24] and insulin sensitivity [25]. When bile acids enter the intestine, they interact with the intestinal flora [26]. Studies have indicated that bile acids are able to inhibit the growth of harmful bacteria and remodel the structure and function of the intestinal flora. In addition, coupling bile acids further increases the diversity of the gut microbiota [27,28]. Our previous study suggested that intestine microbes and their specific bile acids contribute to the process of intestinal barrier damage in Macrobrachium rosenbergii [29]. A study in mammals noted that altered gut flora may trigger skeletal muscle atrophy via the bile acid-FXR pathway [30]. Conversely, studies have shown that dietary bile acids can significantly improve feed conversion and muscle quality in Larimichthys crocea [15], as well as increase protein deposition in Ctenopharyngodon idella [31]. However, in crustaceans, the role of dietary addition of TCDCA in regulating muscle metabolism as well as gut microbes has not been reported.
Therefore, this study will investigate the effects of dietary TCDCA on the growth, physiology, muscle nutrition, and development of P. clarkii. Furthermore, we used 16s sequencing to investigate the regulatory mechanisms of dietary TCDCA on intestinal flora. This study provides a reference for the development of novel exogenous additives for P. clarkii aquaculture and also lays the foundation for the study of the molecular mechanism of the effect of TCDCA on P. clarkii.

2. Materials and Methods

2.1. Ethics Statement

The animal experiments involved in this study were approved by the Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China). All relevant procedures were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals in China.

2.2. Experimental Design of TCDCA Feeding

Prawns were provided by Jiangsu Jinfeng Agricultural Technology Co., Ltd., (Yancheng, China) for this experiment. In terms of the TCDCA feeding validation trial, 360 prawns with a uniform initial weight (4.94 ± 0.02 g) were randomly assigned to two groups with four replicates and 45 individuals in each treatment (cement pond: length × width × water depth, 2.5 m × 2.0 m × 0.4 m). The experiment was designed to include two groups: the mixed-protein-source group was the control group, and the group supplemented with 300 mg/kg TCDCA (provided by Shanghai yuanye Bio-Technology Co., Ltd, Shanghai, China) was the TCDCA group. During the culture period, the CON and TCDCA groups were fed two times a day (6:00 and 21:00) until apparent satiety for a total of 8 weeks. The amount of remaining bait was observed after 30 min of feeding and the feeding rate was adjusted accordingly. The ingredients and proximal composition of the two diets are shown in Table 1. The starch used in this experiment was pre-gelatinized starch. All the raw materials were ground through a 60 mm mesh. After being carefully weighed, the fine powder was mixed with 6% oil (w/w) and 30% water (w/w) and further blended. The feed was pelleted by laboratory pelletizer (Guangzhou Huagong Optical Mechanical & Electrical Technology Co. Ltd., Guangzhou, China) into 2 mm diameter pellets. After drying the feed for 24 h at 65 °C, the feed was stored at −20 °C for feeding experiment. To reduce cannibalism, shelters were set up to avoid disturbance for P. clarkii, especially when they were under molting. Prawn aquaculture conditions were as follows: water temperature 28–32 °C, pH 7.2–7.8, DO > 6.0 mg/L, with a natural photoperiod.

2.3. Sample Collection

After the feeding experiment, the prawns were fasted for 24 h. All the prawns in each pond were counted and weighed to calculate the growth parameters. Nine prawns were taken from each group, muscle and intestinal samples were quickly collected, and the tissues were immediately frozen in liquid nitrogen and stored at −80 °C until analysis in subsequent experiments. Meanwhile, dorsal muscle was collected for muscle texture measurement. In addition, muscle tissue was fixed in glutaraldehyde and 4% paraformaldehyde for further analysis of muscle tissue structure. The remaining muscle tissue was frozen at −20 °C to measure muscle proximate composition.

2.4. Growth Performance

Growth indices were calculated according to the following formula:
Weight gain rate (WGR, %) = 100 × (Wt − W0)/W0
Specific growth rate (SGR, %/day) = 100 × (ln Wt − ln W0)/t
Feed intake (FI, g) = Wf/number
Feed conversion ratio (FCR) = (Wd/number)/(Wt − W0).
Hepatosomatic index (HSI, %) = 100 × Wh/Wt
Wt: final average weight (g); W0: initial average weight (g); Wd: total weight of feed intake (g); t: cultivation cycle (d); Wh: liver weight; Wf: weight of feed.

2.5. Proximate Composition Analysis of Muscle

In each group, 9 muscle samples were randomly taken and measured for texture, moisture content, ash, crude protein, and ether extract. In detail, the muscle samples were dried at 65 °C for 12 h and 105 °C for 4 h, and the moisture content was calculated by measuring the difference in mass of the samples before and after drying. By burning the muscle samples at high temperature (550 °C), the organic matter was completely oxidized and the remaining inorganic matter was the ash content. The nitrogen content of the muscle samples was determined using the Kjeldahl method, and the crude protein content was estimated from the average proportion of nitrogen in protein. Muscle samples were repeatedly heated and extracted in an organic solvent using petroleum ether Soxhlet extraction, and the residue was weighed to determine the ether extract content.

2.6. Histological Analysis of Muscle

The sampled muscles were fixed in 4% paraformaldehyde for at least 24 h, dehydrated with an ethanol gradient, embedded in paraffin, and cut into 5 µm sections (Leica, RM2255, Nussloch, Germany). The sections were stained with hematoxylin–eosin (H&E) and sealed with neutral resin, observed under a microscope, and photographed (Leica, DM4B, Germany) [32].

2.7. Transmission Electron Microscopy (TEM) Observation of Muscle

Muscle samples were cut into 4 mm3 tissue pieces, fixed with 2.5% glutaraldehyde at 4 °C for 24 h, then rinsed with 0.1 M phosphoric acid rinse solution 3 times, fixed with 1% osmium acid for 2 h, rinsed with PBS 3 times, and then subjected to gradient dehydration in different concentrations of ethanol (50, 70, 90, 95 and 100%). The samples were then permeabilized in 1:1 and 1:3 acetone and epoxy resin, respectively, and the samples were put into capsules or embedding plates, with the embedding agent epoxy resin added, and polymerized in a temperature chamber at 60 °C for 48 h. Ultra-thin sections of 70 nm were cut using an ultramicrotome (Leica ultracut UCT25, Los Angeles, CA, USA). Finally, the sections were double-stained with uranium–lead and dried overnight. Photographs were taken for observation using a transmission electron microscope (Hitachi, Tokyo, Japan).

2.8. 16s rRNA Sequencing

To explore the effect of TCDCA on the diversity and composition of P. clarkii gut microbes, six intestine samples from each group were selected for 16s rRNA sequencing according to the method previously described by Liu [33]. Simplistically, DNA was extracted from the intestine using the FastDNA kit (Mpbio, Santa Ana, CA, USA). Subsequently, the DNA was linearly amplified and coded using the bacterial 16s rRNA variable region V3–V4 primers (515F: 5′-GTGCCAGCMGCCGCGG-3′ and 907R: 5′-CCGTCAATTCMTTTRAGTTT-3′. Finally, high-throughput sequencing based on the Illumina Novaseq6000 platform (QIIME2-2021.11) was performed to obtain the raw sequence for 16s analysis.
The PE reads obtained from Illumina PE sequencing were first merged according to the overlap relationship (pandaseq (V2.11)), and the quality of the sequences was also quality-controlled and filtered (PRINSEQ (V0.20.4)). Finally, high-quality sequences were obtained from each sample. Then, de-priming, mass filtering, and denoise were performed by the DADA2 method using the software QIIME2 (qiime2-2021.11). Data from each sample were processed for random draw leveling and statistically sequenced quantities for ASV species annotation. Based on the abundance and annotation information of ASV, the number of sequences per sample at each taxonomic level (Phylum, Class, Order, Family, Genus, Species) was counted as a proportion of the total number of sequences.
The PCA diagrams, as well as the dilution curves for the Alpha Diversity Index, were plotted using R (V3.6.2). Braycurtis, Weighted Unifrac, and Unweighted Unifrac distances were calculated using the software QIIME2 and heatmaps of diversity indices were plotted using R (V3.6.2). Representative ASV sequences were compared to the KEGG PATHWAY database (https://www.kegg.jp/kegg/pathway.html, accessed on 10 June 2024) and the COG database (https://www.ncbi.nlm.nih.gov/research/, accessed on 10 September 2024) using the software PICRUSt2 (V2.1.2). cog-project/) for the functional prediction of microbes.

2.9. RT-PCR Analysis

Total RNA was extracted using the TRIzol method (Invitrogen, Carlsbad, CA, USA), and the RNA OD260/280 (1.8–2.0) ratio was detected to determine the quality of RNA. Reverse-transcription PCR was performed using the PrimeScript TM FAST RT reagent kit with gDNA Eraser (Takara, Dalian, China). RT-qPCR was performed on a BioRad CFX96 system (Bio-Rad, Shanghai, China) in conjunction with TB Green™Premix Ex Taq™II reagent. EIF was used as an internal reference gene to correct the expression level of the target gene. All primer sequences are shown in Table 2.

2.10. Statistical Analysis

Data were first tested for normality and homogeneity and analyzed using SPSS software (version 26.0) and expressed as mean ± standard error of the mean (SEM). Gene expression levels were calculated by 2−ΔΔct. Statistical differences between the two groups were analyzed by Student’s t-test.

3. Results

3.1. Growth Performance

The growth performance and biometric indices are detailed in Table 3. FW, WGR and SGR were significantly higher in the experimental group than in the control group (p < 0.05). However, FI, FCR, and HSI exhibited no statistical differences (p > 0.05). The results indicate that TCDCA supplementation improves the growth performance of P. clarkii.

3.2. Effects of TCDCA on Muscle Texture and Nutrient Content of P. clarkii

Subsequently, we further evaluated the effects of TCDCA addition on muscle texture and nutrient composition in P. clarkii. TCDCA addition did not increase the meat rate (Figure 1A), while it did affect muscle texture. The shearing force in the TCDCA group was higher than that in the control group, but adhesiveness was lower (Figure 1B). The findings suggest that TCDCA can render muscles more resilient. The differences in moisture, ether extract, and ash content between the control and TCDCA groups of P. clarkii muscles were not significant (Figure 1C,E,F, p > 0.05). Conversely, the crude protein levels in the TCDCA group were remarkably elevated (Figure 1D, p < 0.05), suggesting TCDCA addition may contribute to an increase in crude protein content in P. clarkii muscles. Together, TCDCA addition improved the muscle texture and nutrient content of P. clarkii.

3.3. Effect of TCDCA on Muscle Tissue Morphology of P. clarkii

Further investigation on morphology found muscle fiber density and length were considerably increased in the TCDCA group (Figure 2A,C). In detail, the TCDCA group exhibited a significant increase in muscle fiber diameter of over 80 μm (Figure 2B,C, p < 0.05). Ultra-microstructural observation revealed that TCDCA promoted the growth of P. clarkii sarcomeres (Figure 2B,C, p < 0.05). This finding suggests that TCDCA supplementation exerted a measurable impact on muscle structure.

3.4. Effects of TCDCA on Transcription Levels of Genes Related to Muscle Development in P. clarkii

Based on the above results, we further evaluated the expression of key genes in the signaling pathways on protein metabolism and muscle proliferation and differentiation. The genes related to protein synthesis (Figure 3A), such as TOR and AKT, were up-regulated in the TCDCA group, while 4E-BP1 and FOXO were down-regulated. Meanwhile, genes related to muscle proliferation and differentiation (Figure 3B), such as MyHC, MLC1, MEF2A, MEF2B were up-regulated, while MSTN was down-regulated in TCDCA. Accordingly, genes related to autophagy (Figure 3C), such as LC3 and ATG3, were suppressed in the TDCDA group. Additionally, ubiquitination-related genes (Ub) were inhibited in the TCDCA group (Figure 3D). These data reveal that TCDCA activates protein utilization and muscle proliferation and differentiation, affecting the muscle development of P. clarkii.

3.5. Analysis of Differential Intestinal Microbes Between Con and TCDCA Groups

TCDCA, as a bile acid, may influence muscle development by microorganisms. Therefore, we explored the role of the gut flora with 16s rRNA sequencing. Alpha diversity is mainly used to reflect species richness and evenness, as well as sequencing depth. The results indicated TCDCA supplementation did not affect alpha diversity, including ace, chao1, Shannon, simpson and coverage index (Figure 4A). Meanwhile, a PCA based on braycurtis was used to describe the alpha diversity (Figure 4B). The results indicated that the control and TCDCA groups were not well separated. These results suggest TCDCA had no effect on the general composition of the intestinal flora.
To further corroborate the shift in intestinal flora, LEfSe was used to analyze the microbial communities under TCDCA diets, as shown in Figure 4C,D. The most abundant phylotypes in the TCDCA group, from phylum to genus level, were c_Chloroflexales, o_Lactobacillales, o_Chloroflexales, o_Gemmatales, f_Chloroflexaceae, f_Lactobacillaceae, f_Gemmataceae, f_Microbacteriaceae, g_Chloronema, g_Lactobacillus, g_Fimbriiglobus, and g_Aurantimicrobium in TCDCA group (Figure 4C). The most abundant phylotypes in the Con group included g_Fusibacter and g_Fusibacteraceae (Figure 4C). Additionally, differences in microbial composition at the genus level were analyzed to further understand the effects of TCDCA; the results are shown in Figure 4D. TCDCA significantly increased bacterial abundance at the genus level. g_Chloronema, g_Tabrizicola, g_PeM15, g_Tropicimonas, g_Hyphomicrobium, g_Fimbriiglobus, and g_KD4-96 were considered key differential flora due to their higher relative abundance.

3.6. Effect of TCDCA on Intestinal Microbial Functions

The prediction of the function of intestinal microorganisms by KEGG function analysis is shown in Figure 5. The function prediction showed that the TDCDA group increased the abundance of metabolism pathways (protein metabolism, fatty acid metabolism, biosynthesis of metabolites, metabolism of cofactors and vitamins, xenobiotic biodegradation and metabolism, and nucleic acid metabolism) and excretory system. However, TCDCA decreased the abundance of drug resistance (beta-Lactam resistance). Therefore, TCDCA modified the gut flora to boost metabolism.

4. Discussion

Exogenous BA supplementation to aquafeeds has been demonstrated to enhance growth performance and feed utilization [39]. The results of our study indicated that the appropriate addition of TCDCA enhanced the growth performance of P. clarkii, especially body weight. Notably, there was no significant difference in HSI. According to Du et al. [40], adding BAs generally reduced liver fat deposits and enhanced the growth performance of aquatic animals. Consequently, we proposed that TCDCA supplementation could improve body weight in multiple manners rather than promoting hepatic metabolism.
The primary edible tissue of aquatic species is muscle, which makes up 30–80% of the entire body weight. Nutrient accumulation in aquatic animals often manifests as increased muscle mass [41]. Even though there was no discernible change in meat rate in the present experiment, the higher trend indicated TCDCA encouraged nutrient accumulation in muscle. Further muscle composition results showed that protein content in the TCDCA group increased significantly, which confirms that TCDCA may promote protein deposition in muscle to increase body weight. Jiang et al. [42] demonstrated that a moderate administration of bile acids improved the deposition of crude proteins in Oreochromis niloticus muscle. A study in Litopenaeus vannamei showed that exogenous bile acids could increase crude protein deposition to alleviate the reduction in muscle protein content caused by plant protein feeds [35]. Additionally, skeletal muscle protein deposition, which dictates muscle development, critically depends on the equilibrium between protein synthesis and degradation [43]. The mTOR signaling pathway plays an essential role in protein synthesis. The mTOR signaling pathway is regulated by transcription factors (AKT and FOXO) to impact downstream effector molecules, including 4E-BP1, governing the synthesis of proteins [44]. The two main mechanisms for intracellular protein degradation are autophagy and ubiquitination [45]. Autophagy degraded intracellular proteins and organelles to preserve cellular homeostasis and functionality [46]. Ubiquitination is an important post-translational modification of proteins which covalently binds ubiquitin molecules to target proteins and directs proteins for proteasomal degradation [47]. In this experiment, protein metabolism-related gene expression revealed that TCDCA promoted protein synthesis and inhibited protein catabolism, further elucidating that TCDCA supplementation improved muscle protein deposition in P. clarkii.
Important inherent characteristics of texture, including hardness, adhesion, bonding, elasticity, plasticity, flexibility, and shear, have a significant impact on the quality of muscles [48]. Muscle fibers, intramuscular connective tissue (IMCT), and intramuscular fat (IMF) are the primary components that affect the textural characteristics of muscle [49]. However, a complex interplay of internal and environmental variables impacts these qualities [50]. For P. clarkii, an appropriate increase in muscle hardness and elasticity and a decrease in adhesion are more sought after by consumers [51]. In this experiment, TCDCA addition greatly increased the shear force and decreased the adhesiveness of P. clarkii muscle, suggesting that TCDCA supplementation improved muscle quality. However, another study in Larimichthys crocea found that supplemental mixed bile acids increased muscle cohesiveness and gumminess [52]. Since various species have distinct metabolisms, bile acids may have varied impacts on muscle texture. Moreover, it has been shown that myofiber diameter is positively correlated with muscle shear and negatively correlated with adhesiveness [53]. Chen et al. [54] showed that bile acid supplementation significantly increased the mass and myofiber diameter of breast muscles in chickens on a high-fat diet and promoted the growth of muscle tissues, which is in agreement with our results. Therefore, we propose that the primary mechanism by which TCDCA modulates the structure of P. clarkii muscle tissue might involve muscle proliferation spurred on by an increase in myofiber diameter. In addition, changes in sarcomeres are one of the main causes of muscle hypertrophy [55]. The addition of TCDCA increased the sarcomere length in P. clarkii, according to ultra-microstructures, indicating that TCDCA also had a positive impact on muscle hypertrophy. Myogenic regulators such as Myocyte Enhancer Factor (MEF) and muscle growth inhibitor (MSTN), which suppresses the development of skeletal muscle, collaborate in concert to control muscle proliferation and hypertrophy [56]. Research has demonstrated that MSTN adversely affects myocyte proliferation and differentiation, as well as muscle growth and development. According to Acosta et al. [57], zebrafish with suppression of MSTN expression grow embryos more quickly and have bigger bodies. Under the cooperative control of elements like myosin light chain (MLC) and myosin heavy chain (MyHc), mononuclear myoblasts differentiate and fuse to produce multinucleated myotubes, which ultimately form myofibers [58]. In this experiment, TCDCA promoted muscle hyperplasia and hypertrophy in P. clarkii by affecting important regulatory factors, improving muscle quality.
An increasing amount of data points to the intimate interaction between the gut flora and BAs [59]. BAs impact host health and metabolism-related enzymes and pathways by selectively inhibiting the intestinal flora, which encourages the growth of BA-tolerant bacteria while inhibiting bile acid-sensitive bacteria [60]. Our results suggest that TCDCA supplementation had no effect on the α diversity of the gut flora. However, at the genus level, TCDCA supplementation increased the relative abundance of Chloronema, Tabrizicola, PeM15, Tropicimonas, and Hyphomicrobium. Chloronema is a filamentous anaerobic photosynthetic bacterium that can participate in protein metabolism due to its chloroplast antennae structure [61]. Tabrizicola have a complex protein synthesis capacity and encodes a wide range of proteins to support physiological functions [62]. It has been proposed that PeM15, an uncultured actinobacterium (Actinobacteria), might be one of the probiotics that aid aquatic animals withstand environmental changes [63]. Tropicimonas belongs to the Proteobacteria family and is engaged in degrading branched-chain alkanes and several host metabolic processes [64]. It has been discovered that primary bile salts in grass carp raised the relative abundance of Proteobacteria, impacting host health [65]. Hyphomicrobium is a proteobacterium that can utilize mono-carbons, such as methanol, as a carbon source through the serine pathway [66].
Therefore, we suggest that TCDCA supplementation may affect the metabolic function of the organism by regulating the intestinal flora abundance. Further functional predictions demonstrated that changes in intestinal flora predominantly impacted metabolic changes, in which protein metabolism was significantly enhanced. Therefore, we hypothesize that TCDCA enhanced intestinal protein metabolism by the changes in gut flora abundance, thus promoting muscle protein deposition and development to improve muscle quality.

5. Conclusions

In conclusion, dietary TCDCA improves growth performance, muscle development, and nutrient quality and ameliorates muscular autophagy and the gut microbiota relating to fatty acid and protein metabolism, as well as immunity. These data provide a theoretical basis for the application of TCDCA in P. clarkii aquaculture.

Author Contributions

Conceptualization, X.X. and B.L.; methodology, X.X. and C.S. (Changyou Song); software, X.Z.; validation, X.X. and X.L.; formal analysis, Q.Z.; investigation, X.X.; resources, A.W. and A.Z.; data curation, X.X. and C.S. (Cunxin Sun); writing—original draft preparation, X.X.; writing—review and editing, X.X. and C.S. (Changyou Song); visualization, X.X.; supervision, B.L.; project administration, B.L.; funding acquisition, C.S. (Changyou Song), X.Z. and B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key R&D Program of China, grant number 2023YFD2402000; the Jiangsu Province Agricultural Science and Technology Independent Innovation Fund, grant number CX(24)3065; the earmarked fund for Agriculture Research System of China, grant number CARS-48; the project of High Quality Fishery Development in Yancheng, China, grant number 2022yc003; the Central Public-interest Scientific Institution Basal Research Fund of Freshwater Fisheries Research Center, CAFS, grant number 2024JBFR06; and the Natural Science Foundation of Jiangsu Province for Youths, grant number BK20230178.

Institutional Review Board Statement

Ethics Committee Name: Animal Care and Use Committee of the Committee on the Ethics of Animal Experiments of the Freshwater Fisheries Research Center. Approval Code: LAECFFRC-2024-03-19. Approval Date: 19 March 2024.

Data Availability Statement

All data are available upon request.

Acknowledgments

The authors acknowledge Yancheng Shangshui Environmental Biotechnology Engineering Co., Ltd., Yancheng, China, for their kind help during the experiment.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Thornber, K.; Verner-Jeffreys, D.; Hinchliffe, S.; Rahman, M.M.; Bass, D.; Tyler, C.R. Evaluating antimicrobial resistance in the global shrimp industry. Rev. Aquac. 2020, 12, 966–986. [Google Scholar] [CrossRef]
  2. Farag, M.A.; Mansour, S.T.; Nouh, R.A.; Khattab, A.R. Crustaceans (shrimp, crab, and lobster): A comprehensive review of their potential health hazards and detection methods to assure their biosafety. J. Food Saf. 2023, 43, 10326. [Google Scholar] [CrossRef]
  3. Dawood, M.A.O.; Koshio, S.; Esteban, M.A. Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Rev. Aquac. 2018, 10, 950–974. [Google Scholar] [CrossRef]
  4. Qin, L.R.; He, J.H.; Rong, K.; Guo, C.; Liu, J.S.; Zhang, T.L.; Li, W. Changes in secondary sexual characteristics of female red swamp crayfish (Procambarus clarkii) and relationship to ovarian development: Implications for intensive breeding of seedlings. Aquaculture 2024, 592, 741156. [Google Scholar] [CrossRef]
  5. Ou, J.T.; Wang, X.; Luan, X.Q.; Yu, S.; Chen, H.; Dong, H.Z.; Zhang, B.H.; Xu, Z.Q.; Liu, Y.; Zhao, W.H. Comprehensive analysis of the mRNA and miRNA transcriptome implicated in the immune response of Procambarus clarkii to Spiroplasma eriocheiris. Microb. Pathog. 2024, 196, 106928. [Google Scholar] [CrossRef] [PubMed]
  6. Lin, Y.B.; Li, S.X.; Li, Y.L.; Fang, L.; Zhang, H.; Wang, Q.; Ruan, G.L. Effects of luteolin supplementation on growth, histology, antioxidant capacity, non-specific immunity and intestinal microbiota of the red swamp crayfish (Procambarus clarkii). Anim. Feed Sci. Tech. 2024, 313, 115986. [Google Scholar] [CrossRef]
  7. Kong, D.H.; Ji, Y.X.; Zhang, B.Y.; Li, K.C.; Liao, Z.Y.; Wang, H.; Zhou, J.X.; Wang, Q.J. Effects of hydroxy methionine zinc on growth performance, immune response, antioxidant capacity, and intestinal microbiota of red claw crayfish (Procambarus clarkii). Fish Shellfish Immun. 2024, 144, 109231. [Google Scholar] [CrossRef]
  8. Yang, D.; Sun, W.B.; Hou, M.D.; Xiao, C.B.; Jin, H.H.; Lin, Y.; Wang, D.P.; Ye, H.; Luo, H. Eucommia ulmoides Oliv. leaf extract: Effects on growth, antioxidant capacity, and lipid metabolism in Red swamp crayfish (Procambarus clarkii). Aquac. Rep. 2024, 39, 102425. [Google Scholar] [CrossRef]
  9. Di Ciaula, A.; Garruti, G.; Baccetto, R.L.; Molina-Molina, E.; Bonfrate, L.; Wang, D.Q.H.; Portincasa, P. Bile Acid Physiology. Ann. Hepatol. 2017, 16, S4–S14. [Google Scholar] [CrossRef]
  10. Adam, A.H.; Verdegem, M.; Soliman, A.A.; Zaki, M.; Khalil, R.H.; Nour, A.M.; Khaled, A.A.; Basuini, M.F.E.; Khalil, H.S. Effect of dietary bile acids: Growth performance, immune response, genes expression of fatty acid metabolism, intestinal, and liver morphology of striped catfish (Pangasianodon hypophthalmus). Aquac. Rep. 2023, 29, 101510. [Google Scholar] [CrossRef]
  11. Copple, B.L.; Li, T.G. Pharmacology of bile acid receptors: Evolution of bile acids from simple detergents to complex signaling molecules. Pharmacol. Res. 2016, 104, 9–21. [Google Scholar] [CrossRef] [PubMed]
  12. Fiorucci, S.; Distrutti, E.; Carino, A.; Zampella, A.; Biagioli, M. Bile acids and their receptors in metabolic disorders. Prog. Lipid Res. 2021, 82, 101094. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, L.; Sagada, G.; Wang, C.Y.; Liu, R.C.; Li, Q.; Zhang, C.; Yan, Y.Z. Exogenous bile acids regulate energy metabolism and improve the health condition of farmed fish. Aquaculture 2023, 562, 738852. [Google Scholar] [CrossRef]
  14. Li, L.; Liu, T.Y.; Li, J.R.; Yang, Y.C.; Liu, H.Y.; Zhang, P.Y. Effectiveness of bile acids as a feed supplement to improve growth performance, feed utilization, lipid metabolism, digestive enzymes, and hepatic antioxidant status in aquaculture animals: A meta-analysis. Aquac. Rep. 2024, 36, 102121. [Google Scholar] [CrossRef]
  15. Li, J.B.; Wang, Z.; Cao, X.F.; Wang, J.M.; Gong, Y.; Wang, X.E.; Lai, W.C.; Bu, X.Y.; Zheng, J.C.; Mai, K.S.; et al. Effects of supplemental mixed bile acids on growth performance, body composition, digestive enzyme activities, skin color, and flesh quality of juvenile large yellow croaker (Larimichthys crocea) in soybean oil based diet. Front. Mar. Sci. 2023, 10, 1149887. [Google Scholar] [CrossRef]
  16. Peng, X.R.; Feng, L.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhou, X.Q. Supplementation exogenous bile acid improved growth and intestinal immune function associated with NF-κB and TOR signalling pathways in on-growing grass carp (Ctenopharyngodon idella): Enhancement the effect of protein-sparing by dietary lipid. Fish Shellfish Immun. 2019, 92, 552–569. [Google Scholar] [CrossRef]
  17. Kumar, V.; Sinha, A.K.; Romano, N.; Allen, K.M.; Bowman, B.A.; Thompson, K.R.; Tidwell, J.H. Metabolism and Nutritive Role of Cholesterol in the Growth, Gonadal Development, and Reproduction of Crustaceans. Rev. Fish. Sci. Aquac. 2018, 26, 254–273. [Google Scholar] [CrossRef]
  18. Liu, Y.C.; Niu, K.M.; Wang, R.X.; Liang, X.X.; Lin, C.; Wu, X.; Zhai, Z.Y. Taurochenodeoxycholic acid inhibits intestinal epithelial cell proliferation and induces apoptosis independent of the farnesoid X receptor. Food Funct. 2023, 14, 5277–5289. [Google Scholar] [CrossRef]
  19. Bao, L.G.; Hao, D.C.; Wang, X.; He, X.L.; Mao, W.; Li, P.F. Transcriptome investigation of anti-inflammation and immuno-regulation mechanism of taurochenodeoxycholic acid. BMC Pharmacol. Toxicol. 2021, 22, 23. [Google Scholar] [CrossRef]
  20. Zhu, F.Y.; Xu, W.H.; Wang, W.J.; Liao, J.M.; Huang, Y.H.; Huang, X.H.; Qin, Q.W. Taurochenodeoxycholic acid exerts anti-viral activities upon SGIV infection via anti-inflammatory response. Aquaculture 2024, 578, 740124. [Google Scholar] [CrossRef]
  21. Wang, X.; Zhang, Z.Y.; He, X.L.; Mao, W.; Zhou, L.; Li, P.F. Taurochenodeoxycholic acid induces NR8383 cells apoptosis via PKC/JNK-dependent pathway. Eur. J. Pharmacol. 2016, 786, 109–115. [Google Scholar] [CrossRef] [PubMed]
  22. Song, C.Y.; Wen, H.B.; Liu, G.X.; Ma, X.Y.; Lv, G.H.; Wu, N.Y.; Chen, J.X.; Xue, M.M.; Li, H.X.; Xu, P. Gut Microbes Reveal Pseudomonas Medicates Ingestion Preference Protein Utilization and Cellular Homeostasis Under Feed Domestication in Freshwater Drum, Aplodinotus grunniens. Front. Microbiol. 2022, 13, 861705, Corrigendum in Front. Microbiol. 2023, 14, 1259988. [Google Scholar] [CrossRef] [PubMed]
  23. de Bruijn, I.; Liu, Y.Y.; Wiegertjes, G.F.; Raaijmakers, J.M. Exploring fish microbial communities to mitigate emerging diseases in aquaculture. FEMS Microbiol. Ecol. 2018, 94, 161. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, X.Y.; Shen, D.Q.; Fang, Z.W.; Jie, Z.Y.; Qiu, X.M.; Zhang, C.F.; Chen, Y.L.; Ji, L.N. Human Gut Microbiota Changes Reveal the Progression of Glucose Intolerance. PLoS ONE 2013, 8, e71108. [Google Scholar] [CrossRef]
  25. Chambers, E.S.; Byrne, C.S.; Morrison, D.J.; Murphy, K.G.; Preston, T.; Tedford, C.; Garcia-Perez, I.; Fountana, S.; Serrano-Contreras, J.I.; Holmes, E.; et al. Dietary supplementation with inulin-propionate ester or inulin improves insulin sensitivity in adults with overweight and obesity with distinct effects on the gut microbiota, plasma metabolome and systemic inflammatory responses: A randomised crossover trial. Gut 2019, 68, 1430–1438. [Google Scholar] [CrossRef]
  26. Lin, H.R.; Xu, F.Z.; Chen, D.Y.; Xie, K.L.; Yang, Y.D.; Hu, W.; Li, B.Y.; Jiang, Z.L.; Liang, Y.H.; Tang, X.Y.; et al. The gut microbiota-bile acid axis mediates the beneficial associations between plasma vitamin D and metabolic syndrome in Chinese adults: A prospective study. Clin. Nutr. 2023, 42, 887–898. [Google Scholar] [CrossRef]
  27. Goodrich, J.K.; Davenport, E.R.; Beaumont, M.; Jackson, M.A.; Knight, R.; Ober, C.; Spector, T.D.; Bell, J.T.; Clark, A.G.; Ley, R.E. Genetic Determinants of the Gut Microbiome in UK Twins. Cell Host Microbe 2016, 19, 731–743. [Google Scholar] [CrossRef]
  28. Dai, H.Y.; Shan, Z.Y.; Shi, L.; Duan, Y.H.; An, Y.C.; He, C.H.; Lyu, Y.; Zhao, Y.G.; Wang, M.L.; Du, Y.H.; et al. Mulberry leaf polysaccharides ameliorate glucose and lipid metabolism disorders via the gut microbiota-bile acids metabolic pathway. Int. J. Biol. Macromol. 2024, 282, 136876. [Google Scholar] [CrossRef]
  29. Zheng, X.C.; Xu, X.D.; Liu, M.Y.; Yang, J.; Yuan, M.; Sun, C.X.; Zhou, Q.L.; Chen, J.M.; Liu, B. Bile acid and short chain fatty acid metabolism of gut microbiota mediate high-fat diet induced intestinal barrier damage in Macrobrachium rosenbergii. Fish Shellfish Immun. 2024, 146, 109376. [Google Scholar] [CrossRef]
  30. Mancin, L.; Wu, G.D.; Paoli, A. Gut microbiota-bile acid-skeletal muscle axis. Trends Microbiol. 2023, 31, 254–269. [Google Scholar] [CrossRef]
  31. Zhou, J.S.; Chen, H.J.; Ji, H.; Shi, X.C.; Li, X.X.; Chen, L.Q.; Du, Z.Y.; Yu, H.B. Effect of dietary bile acids on growth, body composition, lipid metabolism and microbiota in grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2018, 24, 802–813. [Google Scholar] [CrossRef]
  32. Cheng, L.; Zhou, J.L.; Cheng, J.P. Bioaccumulation, tissue distribution and joint toxicity of erythromycin and cadmium in Chinese mitten crab (Eriocheir sinensis). Chemosphere 2018, 210, 267–278. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, B.; Song, C.Y.; Gao, Q.; Liu, B.; Zhou, Q.L.; Sun, C.X.; Zhang, H.M.; Liu, M.; Tadese, D.A. Maternal and environmental microbes dominate offspring microbial colonization in the giant freshwater prawn Macrobrachium rosenbergii. Sci. Total Environ. 2021, 790, 148062. [Google Scholar] [CrossRef] [PubMed]
  34. Wen, C.; Ma, S.; Tian, H.Y.; Jiang, W.B.; Jia, X.Y.; Zhang, W.X.; Jiang, G.Z.; Li, X.F.; Chi, C.; He, C.F.; et al. Evaluation of the protein-sparing effects of carbohydrates in the diet of the crayfish, Procambarus clarkii. Aquaculture 2022, 556, 738275. [Google Scholar] [CrossRef]
  35. Yang, H.J.; Mo, A.J.; Yi, L.Y.; Wang, J.H.; He, X.G.; Yuan, Y.C. Selenium attenuated food borne cadmium-induced intestinal inflammation in red swamp crayfish (Procambarus clarkii) via regulating PI3K/Akt/NF-κBpathway. Chemosphere 2024, 349, 140814. [Google Scholar] [CrossRef]
  36. Cai, M.L.; Zhang, Y.; Zhu, J.Q.; Li, H.H.; Tian, H.Y.; Chu, W.Y.; Hu, Y.; Liu, B.; Wang, A.M. Intervention of re-feeding on growth performance, fatty acid composition and oxidative stress in the muscle of red swamp crayfish (Procambarus clarkii) subjected to short-term starvation. Aquaculture 2021, 545, 737110. [Google Scholar] [CrossRef]
  37. Zhu, M.R.; Zhan, M.; Xi, C.J.; Gong, J.; Shen, H.S. Molecular characterization and expression of the autophagy-related gene Atg14 in WSSV-infected Procambarus clarkii. Fish Shellfish. Immunol. 2022, 125, 200–211. [Google Scholar] [CrossRef]
  38. Liu, J.; Du, H.; Liu, T.; Chen, C.; Yan, Y.; Liu, T.Q.; Liu, L.; Wang, E.L. Accurate reflection of hepatopancreas antioxidation and detoxification in Procambarus clarkii during virus infection and drug treatment: Reference gene selection, evaluation and expression analysis. Aquaculture 2022, 556, 738283. [Google Scholar] [CrossRef]
  39. Wang, Y.Y.; Xu, Z.F.; Li, M.L.; Shuai, K.; Lei, L.; Li, X.Q.; Leng, X.J. Supplemental bile acids in low fishmeal diet improved the growth, nutrient utilization of Pacific white shrimp. Aquac. Rep. 2023, 28, 101452. [Google Scholar] [CrossRef]
  40. Du, Y.H.; Wang, G.J.; Yu, E.M.; Xie, J.; Xia, Y.; Li, H.Y.; Zhang, K.; Gong, W.B.; Li, Z.F.; Xie, W.P.; et al. Dietary deoxycholic acid decreases fat accumulation by activating liver farnesoid X receptor in grass crap (Ctenopharyngodon idella). Aquaculture 2024, 578, 740123. [Google Scholar] [CrossRef]
  41. Weatherley, A.H.; Gill, H.S. The Biology of Fish Growth; Academic Press: Cambridge, MA, USA, 1987. [Google Scholar]
  42. Jiang, J.Y.; Lu, X.; Dong, L.X.; Tian, J.; Zhang, J.M.; Guo, Z.B.; Luo, Y.J.; Cui, Z.B.; Wen, H.; Jiang, M. Enhancing growth, liver health, and bile acid metabolism of tilapia (Oreochromis niloticus) through combined cholesterol and bile acid in diets. Anim. Nutr. 2024, 17, 335–346. [Google Scholar] [CrossRef] [PubMed]
  43. McCarthy, J.J.; Esser, K.A. Anabolic and catabolic pathways regulating skeletal muscle mass. Curr. Opin. Clin. Nutr. 2010, 13, 230–235. [Google Scholar] [CrossRef] [PubMed]
  44. Saxton, R.A.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef] [PubMed]
  45. Nedelsky, N.B.; Todd, P.K.; Taylor, J.P. Autophagy and the ubiquitin-proteasome system: Collaborators in neuroprotection. BBA-Mol. Basis Dis. 2008, 1782, 691–699. [Google Scholar] [CrossRef]
  46. Eskelinen, E.L. Autophagy: Supporting cellular and organismal homeostasis by self-eating. Int. J. Biochem. Cell B 2019, 111, 1–10. [Google Scholar] [CrossRef]
  47. Magnani, N.D.; Dada, L.A.; Sznajder, J.I. Ubiquitin-proteasome signaling in lung injury. Transl. Res. 2018, 198, 29–39. [Google Scholar] [CrossRef]
  48. Cheng, J.H.; Sun, D.W.; Han, Z.; Zeng, X.A. Texture and Structure Measurements and Analyses for Evaluation of Fish and Fillet Freshness Quality: A Review. Compr. Rev. Food Sci. F 2014, 13, 52–61. [Google Scholar] [CrossRef]
  49. Roy, B.C.; Bruce, H.L. Contribution of intramuscular connective tissue and its structural components on meat tenderness-revisited: A review. Crit. Rev. Food Sci. 2024, 64, 9280–9310. [Google Scholar] [CrossRef]
  50. Matarneh, S.K.; Silva, S.L.; Gerrard, D.E. New Insights in Muscle Biology that Alter Meat Quality. Annu. Rev. Anim. Biosci. 2021, 9, 355–377. [Google Scholar] [CrossRef]
  51. Zhou, M.Z.; Shi, G.P.; Deng, Y.; Wang, C.; Qiao, Y.; Xiong, G.Q.; Wang, L.; Wu, W.J.; Shi, L.; Ding, A.Z. Study on the physicochemical and flavor characteristics of air frying and deep frying shrimp (crayfish) meat. Front. Nutr. 2022, 9, 1022590. [Google Scholar] [CrossRef]
  52. Li, X.; Qu, K.; Liu, Y.; Dong, X.; Chi, S.; Yang, Q.; Tan, B.; Zhang, S.; Xie, S. Effects of Dietary Bile Acids Supplementation on Growth Performance, Sterol Metabolism, Bile Acids Enterohepatic Circulation, and Apoptosis of Juvenile Pacific White Shrimp (Litopenaeus Vannamei). SSRN 2023. [Google Scholar] [CrossRef]
  53. Bouton, P.E.; Harris, P.V.; Shorthose, W.R. Possible relationships between shear, tensile, and adhesion properties of meat and meat structure. J. Texture Stud. 1975, 6, 297–314. [Google Scholar] [CrossRef]
  54. Chen, L.; Shi, Y.H.; Li, J.B.; Shao, C.M.; Ma, S.; Shen, C.; Zhao, R.Q. Dietary bile acids improve breast muscle growth in chickens through FXR/IGF2 pathway. Poult. Sci. 2024, 103, 103346. [Google Scholar] [CrossRef] [PubMed]
  55. Nicol, R.L.; Frey, N.; Pearson, G.; Cobb, M.; Richardson, J.; Olson, E.N. Activated MEK5 induces serial assembly of sarcomeres and eccentric cardiac hypertrophy. EMBO J. 2001, 20, 2757–2767. [Google Scholar] [CrossRef] [PubMed]
  56. Johnston, I.A. Muscle development and growth: Potential implications for flesh quality in fish. Aquaculture 1999, 177, 99–115. [Google Scholar] [CrossRef]
  57. Acosta, J.; Carpio, Y.; Borroto, I.; González, O.; Estrada, M.P. Myostatin gene silenced by RNAi show a zebrafish giant phenotype. J. Biotechnol. 2005, 119, 324–331. [Google Scholar] [CrossRef]
  58. Dumont, N.A.; Rudnicki, M.A. Characterizing satellite cells and myogenic progenitors during skeletal muscle regeneration. Methods Mol. Biol. 2017, 1560, 179–188. [Google Scholar] [CrossRef]
  59. Jia, W.; Xie, G.X.; Jia, W.P. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat. Rev. Gastro Hepatol. 2018, 15, 111–128. [Google Scholar] [CrossRef]
  60. Barut, I.; Kaya, S. The Diagnostic Value of C-Reactive Protein in Bacterial Translocation in Experimental Biliary Obstruction. Adv. Clin. Exp. Med. 2014, 23, 197–203. [Google Scholar] [CrossRef]
  61. Furt, F.; Lemoi, K.; Tüzel, E.; Vidali, L. Quantitative analysis of organelle distribution and dynamics in Physcomitrella patens protonemal cells. BMC Plant Biol. 2012, 12, 70. [Google Scholar] [CrossRef]
  62. Tarhriz, V.; Eyvazi, S.; Shakeri, E.; Hejazi, M.S.; Dilmaghani, A. Antibacterial and Antifungal Activity of Novel Freshwater Bacterium Tabrizicola aquatica as a Prominent Natural Antibiotic Available in Qurugol Lake. Pharm. Sci. 2020, 26, 88–92. [Google Scholar] [CrossRef]
  63. Cai, X.; Yu, Y.; Wang, Y.; Zhang, Z.; Liao, M.; Li, B.; Liu, X.; Zhu, H.; Rong, X. Effects of potassium monopersulfate on water environment index and microbial community structure of Litopenaeus vannamei in pond culture system. J. Shanghai Ocean Univ. 2022, 31, 452–461. (In Chinese) [Google Scholar]
  64. Harwati, T.U.; Kasai, Y.; Kodama, Y.; Susilaningsih, D.; Watanabe, K. Tropicimonas isoalkanivorans gen. nov., sp. nov., a branched-alkane-degrading bacterium isolated from Semarang Port in Indonesia. Int. J. Syst. Evol. Micr. 2009, 59, 388–391. [Google Scholar] [CrossRef]
  65. Xiong, F.; Wu, S.G.; Zhang, J.; Jakovlic, I.; Li, W.X.; Zou, H.; Li, M.; Wang, G.T. Dietary Bile Salt Types Influence the Composition of Biliary Bile Acids and Gut Microbiota in Grass Carp. Front. Microbiol. 2018, 9, 2209. [Google Scholar] [CrossRef]
  66. Attwood, M.M.; Harder, W. The Oxidation and Assimilation of C2 Compounds by Hyphomicrobium sp. Microbiology 1974, 84, 350–356. [Google Scholar] [CrossRef]
Fishes 10 00038 g001
Figure 1. The effects of TCDCA on muscle texture and nutrient content of P. clarkii. (A), meat rate; (B), radar map on muscle texture; (C), moisture content; (D), crude protein; (E), ether extract (crude lipid); (F), ash. Data were analyzed by Student’s t-test; * represent p < 0.05, results are indicated as mean ± SEM, n = 9.
Figure 1. The effects of TCDCA on muscle texture and nutrient content of P. clarkii. (A), meat rate; (B), radar map on muscle texture; (C), moisture content; (D), crude protein; (E), ether extract (crude lipid); (F), ash. Data were analyzed by Student’s t-test; * represent p < 0.05, results are indicated as mean ± SEM, n = 9.
Fishes 10 00038 g001
Fishes 10 00038 g002
Figure 2. The effect of TCDCA on the muscle tissue morphology of P. clarkii. (A), H&E staining of muscle fiber; (B), TEM morphology of muscle fiber, red arrows represent the sarcomere length; (C) statistics of sarcomere length, muscle fiber diameter distribution, and myofiber diameter comparison between Con and TCDCA. Data were analyzed by Student’s t-test; * represent p < 0.05, results are indicated as mean ± SEM, n = 9.
Figure 2. The effect of TCDCA on the muscle tissue morphology of P. clarkii. (A), H&E staining of muscle fiber; (B), TEM morphology of muscle fiber, red arrows represent the sarcomere length; (C) statistics of sarcomere length, muscle fiber diameter distribution, and myofiber diameter comparison between Con and TCDCA. Data were analyzed by Student’s t-test; * represent p < 0.05, results are indicated as mean ± SEM, n = 9.
Fishes 10 00038 g002
Fishes 10 00038 g003
Figure 3. Effects of TCDCA on the transcription levels of genes related to muscle development in P. clarkii. (A), relative expression of genes related to protein synthesis signaling molecules and transcription factors; (B), relative expression of genes related to myosin and muscle regulatory factors; (C), relative expression of genes related to autophagy factors; (D), relative expression of genes related to ubiquitination factors. Red data mean p < 0.05.
Figure 3. Effects of TCDCA on the transcription levels of genes related to muscle development in P. clarkii. (A), relative expression of genes related to protein synthesis signaling molecules and transcription factors; (B), relative expression of genes related to myosin and muscle regulatory factors; (C), relative expression of genes related to autophagy factors; (D), relative expression of genes related to ubiquitination factors. Red data mean p < 0.05.
Fishes 10 00038 g003
Fishes 10 00038 g004
Figure 4. Intestinal microbes between Con and TCDCA groups in P. clarkia. (A), alpha diversity analysis, ns represent p > 0.05; (B), Principal Component Analysis (PCA); (C), microbial community biomarkers: LEfSe analysis identified the taxa with the most remarkable differences in abundance among the three taxa; (D), microbial comparation analysis between Con and TCDCA groups at the genus level. In (C,D), “c_, o_, f_, g_, s_” are the prefixes of the bacteria.
Figure 4. Intestinal microbes between Con and TCDCA groups in P. clarkia. (A), alpha diversity analysis, ns represent p > 0.05; (B), Principal Component Analysis (PCA); (C), microbial community biomarkers: LEfSe analysis identified the taxa with the most remarkable differences in abundance among the three taxa; (D), microbial comparation analysis between Con and TCDCA groups at the genus level. In (C,D), “c_, o_, f_, g_, s_” are the prefixes of the bacteria.
Fishes 10 00038 g004
Fishes 10 00038 g005
Figure 5. Functional prediction of intestinal microbes under TCDCA. KEGG functional annotation. Red color represents up-regulated functions, and blue color represents down-regulated functions.
Figure 5. Functional prediction of intestinal microbes under TCDCA. KEGG functional annotation. Red color represents up-regulated functions, and blue color represents down-regulated functions.
Fishes 10 00038 g005
Table 1. Components and proximate analysis of CON and TCDCA diets.
Table 1. Components and proximate analysis of CON and TCDCA diets.
CONTCDCA
Components (% dry matter)
Fish meal5.05.0
Soybean meal25.025.0
Rapeseed meal18.018.0
Pork powder3.03.0
Peanut meal5.05.0
Rice bran4.04.0
Salt0.30.3
Spray-dried blood cell powder5.05.0
Squid paste3.03.0
Shrimp meal3.03.0
Starch18.7918.76
Soybean oil3.03.0
Ecdysone (2%)0.010.01
Vitamin premix a1.01.0
Mineral premix b1.01.0
Choline chloride (50%)0.50.5
Calcium dihydrogen phosphate2.02.0
Carboxymethyl cellulose0.50.5
Bicarbonate1.51.5
Microcrystalline methionine0.40.4
TCDCA 0.00.03
Total100.0100.0
Proximate analysis (%)
Dry matter (DM)83.0382.27
Crude protein, CP (%)32.7833.21
Crude lipid (Ether extract), EE (%)5.686.08
Gross energy (MJ/kg)15.8916.09
Note: a Premix supplied the following vitamins (g/kg): vitamin A, 4 g; vitamin D3, 0.02 g; vitamin E, 10 g; vitamin K3, 10 g; thiamin, 10 g; riboflavin, 10 g; calcium pantothenate, 20 g; pyridoxine, 20 g; cyanocobalamin, 0.01 g; biotin, 0.2 g; folic acid, 0.5 g; niacin, 40 g; inositol, 400 g; vitamin C, 20 g; microcrystalline cellulose, 455.27 g. b Premix supplied the following minerals (g/kg): potassium iodate, 0.6 g; sodium selenite pentahydrate, 0.08 g; potassium dihydrogen phosphate, 320 g; magnesium sulfate, 200 g; manganese sulfate monohydrate, 20 g; copper chloride dihydrate, 2 g; zinc sulfate heptahydrate, 60 g; ferrous sulfate heptahydrate, 50 g; sodium chloride, 100 g; cobalt chloride hexahydrate, 2 g; microcrystalline cellulose, 245.32 g.
Table 2. Primer sequences for real-time PCR.
Table 2. Primer sequences for real-time PCR.
GeneForward (5′-3′)Reverse (5′-3′)PL (bp)Reference
EIFGGAATAAGGGGACGAAGACCGCAAACACACGCTGGGAT126[34]
TORGAAGGCATGCTGCGGTATTGCGCAGGCTTTGGGTCTCTTA122[34]
S6KACAGCCGAGAATCGCAAGAAATCACCATTATCGGGTCCGC153[34]
4E-BP1ACCTGCCAGTGATACCAGGATGGCTCCTCTGAAATCGTTCC80[34]
AKTCCTTGGGGCGTCTACTCCTATCCTCATAATCCTCACTTTCCT176database
FOXOACGCGCTAACACCATGGAAGGACTCTCACTCAGCGACGAA158[35]
MyHCAAGCCAACCGTACCCTCAAAGTAGCACGTTCTCTGCATTCA174database
MLC1TGAGAAGGTCGGAGGCAAGTGCCATTCTCAGATTTGTCGT155[36]
MEF2ACATCTTCCAACCATCCTGGGGTTTGCTCAACGGGGTATCA125[36]
MEF2BACCAGCACCACCTTCACATTGAAGATGGACCCAAATGTGAA133[36]
MSTNAGCAACAGCAACAACAAGGAGCAGGAAGGGACATTTACCG136[36]
LC3TGAGTAGTCCGTCTCGGTGTCCATGTAGAGGAACCCGTCG169[37]
ATG2GTACTTCCCGTGGTCGGATGCCATCCACGAACCTGAGAGG175[37]
ATG3GCCAAGACAACCACCATAGCAGAGCCGAGGTGTCTGGTAG201database
ATG9TCATACATCCAGGGTTCGCCGGGCAAAGGAACAAACGTCC189database
ATG12TGGAGGGGAAGGACTTACGGAGCTTTCCCTTAGCAGTCTTC203[37]
ATG16AGATGGATGGCACAGAAGGCGTTCACTTGCTTGGGCTCAC178database
ATG18CGTGTTGTAGTGGAGGAGCACGTGGCTGCTTTTGAATCGT194database
ubTCCAGCCTCTCCTGCCTTCCTTCCTTATCCTGAATCTTTGCC172[38]
Psma1CTTTACCTCATTGACCCATCTCACAACCATAGTATCCATTACACAT149database
psmd1ACTCATACAGCAAACAGAATCCCGTCCACCAGCATCAATAA147database
psmd6AGCTTTTGCTAAAACCTACGTCCCAATCTCCTCCCTCT159database
Psmc1TGTCTCCATTCTCTCCTTTGTTTGAGGTGCCTTCTCTAGCT148database
Note: the database was the RNA-seq results conducted by the aquatic animal disease and nutrition lab of FFRC.
Table 3. The effects of TCDCA on the growth performance of P. clarkii.
Table 3. The effects of TCDCA on the growth performance of P. clarkii.
CONTCDCAp Value
Initial weight, IW (g)4.93 ± 0.0124.94 ± 0.0310.795
FW (g)33.16 ± 1.03337.09 ± 0.9830.044
WGR (%)572.24 ± 19.25651.01 ± 22.0670.043
SGR (%/day)3.67 ± 0.0543.88 ± 0.0570.043
FI (g)25.69 ± 0.23529.32 ± 3.4310.098
FCR0.91 ± 0.0330.91 ± 0.0760.985
HSI (%)5.72 ± 0.2166.24 ± 0.2990.161
Note: Data are expressed as means with SEM (IW, FW, WGR, SGR, FI, and FCR were detected for all the P. clarkii that were collected; HSI was calculated for 9 P. clarkii collected). p values less than 0.05 represent significant differences according to Student’s t-test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, X.; Zheng, X.; Song, C.; Liu, X.; Zhou, Q.; Sun, C.; Wang, A.; Zhu, A.; Liu, B. Taurochenodeoxycholic Acid Improves Growth, Physiology, Intestinal Microbiota, and Muscle Development in Red Swamp Crayfish (Procambarus clarkii). Fishes 2025, 10, 38. https://doi.org/10.3390/fishes10020038

AMA Style

Xu X, Zheng X, Song C, Liu X, Zhou Q, Sun C, Wang A, Zhu A, Liu B. Taurochenodeoxycholic Acid Improves Growth, Physiology, Intestinal Microbiota, and Muscle Development in Red Swamp Crayfish (Procambarus clarkii). Fishes. 2025; 10(2):38. https://doi.org/10.3390/fishes10020038

Chicago/Turabian Style

Xu, Xiaodi, Xiaochuan Zheng, Changyou Song, Xin Liu, Qunlan Zhou, Cunxin Sun, Aimin Wang, Aiming Zhu, and Bo Liu. 2025. "Taurochenodeoxycholic Acid Improves Growth, Physiology, Intestinal Microbiota, and Muscle Development in Red Swamp Crayfish (Procambarus clarkii)" Fishes 10, no. 2: 38. https://doi.org/10.3390/fishes10020038

APA Style

Xu, X., Zheng, X., Song, C., Liu, X., Zhou, Q., Sun, C., Wang, A., Zhu, A., & Liu, B. (2025). Taurochenodeoxycholic Acid Improves Growth, Physiology, Intestinal Microbiota, and Muscle Development in Red Swamp Crayfish (Procambarus clarkii). Fishes, 10(2), 38. https://doi.org/10.3390/fishes10020038

Article Metrics

Back to TopTop