Next Article in Journal
Climate Resilience in Farm Animals: Transcriptomics-Based Alterations in Differentially Expressed Genes and Stress Pathways
Previous Article in Journal
Honey Bioactive Molecules: There Is a World Beyond the Sugars
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
BioTech
Volume 13
Issue 4
10.3390/biotech13040048
biotech-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

High-Resolution Melting Analysis Potential for Saccharomyces cerevisiae var. boulardii Authentication in Probiotic-Enriched Food Matrices

by
Monika Borkowska
*,
Michał Kułakowski
and
Kamila Myszka
Department of Biotechnology and Food Microbiology, Poznan University of Life Sciences, Wojska Polskiego 48, 60-637 Poznan, Poland
*
Author to whom correspondence should be addressed.
BioTech 2024, 13(4), 48; https://doi.org/10.3390/biotech13040048
Submission received: 4 September 2024 / Revised: 25 October 2024 / Accepted: 12 November 2024 / Published: 14 November 2024
(This article belongs to the Section Agricultural and Food Biotechnology)
Browse Figures
Versions Notes

Abstract

:
To date, the only probiotic yeast with evidence of health-promoting effects is Saccharomyces cerevisiae var. boulardii. The expanded market including dietary supplements and functional foods supplemented with Saccharomyces cerevisiae var. boulardii creates an environment conductive to food adulterations, necessitating rapid testing to verify product probiotic status. Herein, qPCR-HRM analysis was tested for probiotic yeast identification. The effectiveness of the primer pairs’ set was examined, designed to amplify heterogeneous regions in (a) rDNA sequences previously designed to identify food-derived yeast and (b) genes associated with physiological and genotypic divergence of Saccharomyces cerevisiae var. boulardii. Preliminary tests of amplicons’ differentiation power enabled the selection of interspecies sequences for 18SrRNA and ITS and genus-specific sequences HO, RPB2, HXT9 and MAL11. The multi-fragment qPCR-HRM analysis was sufficient for culture-dependent Saccharomyces cerevisiae var. boulardii identification and proved effective in the authentication of dietary supplements’ probiotic composition. The identification of S. cerevisiae var. boulardii in complex microbial mixtures of kefir succeeded with more specific intragenus sequences HO and RPB2. The predominance of S. cerevisiae var. boulardii in the tested matrices, quantitatively corresponded to the probiotic-enriched food, was crucial for identification with qPCR–HRM analysis. Considering the reported assumptions, qPCR-HRM analysis is an appropriate tool for verifying probiotic-enriched food.
Keywords:
Saccharomyces cerevisiae var. boulardii; identification; probiotic; dietary supplement; probiotic-enriched food; qPCR-HRM
Key Contribution: qPCR-HRM analysis with intragenus primer pairs enabled Saccharomyces cerevisiae var. boulardii identification in the microbial mix with its predominance corresponding to the required dose of health-promoting microorganisms for the food product labelled as probiotic.

1. Introduction

Health-promoting effects were predominantly demonstrated for specific probiotic strains of the bacteria genera Lactobacillus and Bifidobacterium [1,2], while the only yeast with a probiotic status evidenced clinically is Saccharomyces cerevisiae var. boulardii (Sb) [3,4,5]. The clinical studies did not show any major side effects related to Sb. However, some cases of Sb fungemia have been documented [6,7,8,9,10], prompting a search for methods of Saccharomyces cerevisiae (Sc) intraspecies differentiation.
The taxonomic position of Sb has been controversial over the years [4,11,12,13,14,15]. McFarland indicated some crucial divergences at the physiological (i.e., lack of ability to use galactose as carbon source and lack of ability to produce ascospores) and molecular levels (i.e., individual chromosome and gene copy numbers) between Sb and Sc [16]. Using comparative genomic hybridization for whole-genome analysis, Sb’s physiological and genotypic distinctive features were confirmed [17]. The observations concerned the specific properties of Ty elements (yeast retrotransposons) and the copy number of genes in its subtelomeric regions. These were confirmed in the subsequent genomic comparative study, which additionally showed that Sb strains are closely related to Sc wine strains [18]. Pais and colleagues hypothesized that different phenotypes exhibited by Sb and Sc might result from variations in gene expression control. They demonstrated that Sb did not share conserved promoter regions and transcription factor binding sites with Sc [19].
So far, the search for methods of intraspecies differentiation of Sc has mainly involved clinical studies. By combining randomly amplified polymorphic DNA-PCR, restriction fragment length polymorphism analysis of rDNA spacer regions and pulsed-field gel electrophoresis, all examined Sc isolates were discriminated in clinical research. Moreover, probiotic Sb strains were demonstrated to form a separate cluster within the species [20]. Additionally, for intraspecies differentiation of probiotic and clinical Sc strains, a powerful microsatellite-based technique was developed [21]. Furthermore, a high level of discrimination was achieved by hybridization with retrotransposon Ty917 [22]. Finally, a rapid multiplex PCR method unequivocally identified probiotic-derived Sc isolates [23].
High-Resolution Melting (HRM) analysis is a state-of-the-art technique that enables the differentiation at the single base resolution of DNA fragments amplified in qPCR. It is an alternative single-tube approach with no time-consuming post-PCR processing or the need for sequencing to detect DNA polymorphisms. HRM analysis was initially used in clinical research and diagnostics, but its robust potential and technological advancements enable it to expand into other areas of the life sciences. In food sciences, HRM analysis has already been used for the differentiation of food-derived yeast species including Saccharomyces spp. [24], sourdough yeast [25,26] and spoilage yeast [27,28,29]. All procedures presented a high potential for HRM analysis in yeast species differentiation based on the amplification of regions within rRNA genes or ITS non-coding sequences characterized by low intraspecific variability and high interspecific polymorphism [30,31]. The vast majority of the studies cited dealt with culture-dependent identification. The culture-independent identification of sourdough yeast by HRM analysis did not yield conclusive results [25,26].
This paper presents pioneering research focused on the development of an efficient tool for the rapid identification of Sb, not only in pure culture but especially in microbiologically complex food matrices. The efficiency of previously designed primer pairs for rDNA sequences and newly presented intragenus primer pairs associated with physiological and genotypic characteristics of Sb were verified in the promising qPCR–HRM analysis. The utility of selected primer pairs was verified in dietary supplements presenting the single yeast composition. The current state of the regulations and the expanded supplement market create an environment conducive to food adulterations, necessitating rapid testing to verify product status. The problem may soon affect a much wider range of foods. Concerning probiotic yeast, intense research activity arose in developing functional foods supplemented with Sb not only as a probiotic agent, but also as a key element for the generation of bioactives, increasing the antioxidant capacity [32,33], improving nutritional value [34], or for the stabilization of LAB strains throughout fermentation and storage [35,36]. Therefore, the effectiveness of the designed analysis was also checked for multi-yeast mixtures corresponding in composition to kefir, a natural source of probiotic yeast origin [37,38].

2. Materials and Methods

2.1. Biological Material

2.1.1. Strains

The following reference strains were used in the optimization of qPCR–HRM analysis focused on identifying probiotic strains of Saccharomyces cerevisiae: (i) Saccharomyces boulardii CNCM I-745 (Enterol, Biocodex, Gentilly, France) (Sb745) and Saccharomyces boulardii CNCM-I-3799 (Oslonik max extra, TZF Polfa, Warsaw, Poland) (Sb3799) isolated from probiotic preparations under this project; (ii) and collection strains Saccharomyces cerevisiae ATCC 9763 (ScATCC9763) and Saccharomyces cerevisiae Ethanol Red (Lesaffre; Marcq-en-Baroeul, France) (ScEtRed). Additionally, (i) Kluyveromyces marxianus DSM 5422 (German Collection of Microorganisms and Cell Cultures GmbH; Braunschweig, Germany) (Km), (ii) food-derived isolates Saccharomyces cerevisiae (ScD) and Pichia fermentans (PfD) deposited in the microbial collection of Department Biotechnology and Food Microbiology (DBFM) in Poznan University of Life Sciences (PULS) and (iii) Lactobacillus delbrueckii subsp. lactis DSM 20072 (German Collection of Microorganisms and Cell Cultures GmbH; Germany) (Ldsubl) were used in the subsequent stages of testing the qPCR–HRM. All strains were kept as glycerol stocks at −80 °C. Yeast strains were recovered on YPD agar plates [(g L−1): yeast extract, 10 (Biomaxima, Lublin, Poland); bactopeptone, 20 (BTL, Łódź, Poland); glucose, 20 (POCh, Gliwice, Poland); and agar, 15 (BTL)] and lactic acid bacteria (LAB) were retrieved with De Man, Rogosa and Sharpe (M.R.S) agar (BTL).

2.1.2. Probiotic Supplements

Four probiotic preparations classified as dietary supplements and available in local pharmacies were analyzed with the optimized qPCR–HRM method. The composition of the chosen products is shown in Table 1.

2.2. Microbiological Methods

2.2.1. S. boulardii Reference Strains

The reference strains of Sb used in this study were isolated from two different commercial products, one with proven therapeutic effects and the other classified as a dietary supplement. To revive the yeast, the contents of each capsule (250 mg) were suspended in 20 mL of YPD in a sterile 50 mL Falcon tube. The mixture was then shaken at 150 rpm at 30 °C overnight. Afterwards, the log serial dilutions were made from the overnight culture. 100 µL of each dilution was transferred in duplicate onto Yeast extract Glucose Chloramphenicol agar (YGC) (BTL, Łódź, Poland). Incubation was carried out overnight at 30 °C. Single colonies were then reinoculated onto fresh YGC agar. The yeast isolates were first verified based on morphological characteristics with microscopy and then subjected to MALDI TOF mass spectrometry identification.

2.2.2. Sporulation Test

Procedure of Sporulation Induction

For determination of the ascospore formation, 5 mL of YPD medium in a 50 mL Falcon tube was inoculated with a fresh yeast colony. Each culture was incubated at 30 °C in a shaking incubator at 150 rpm for 18–20 h. 200 µL of the overnight culture was transferred into 5 mL of liquid YPD and incubated at 30 °C in a shaking incubator until the cell suspension reached OD equal to 1. Then the culture was centrifuged at 1811× g for 5 min and the supernatant was discarded. The pellet was resuspended in 5 mL of pre-sporulation medium (g L−1: yeast extract, 10; pepton, 20; potassium acetate, 10 (POCh, Gliwice, Poland)) and grew for 18–24 h at 30 °C in shacking incubator. The culture was centrifuged at 1811× g for 5 min and the supernatant was discarded. Finally, the pellet was resuspended in 5 mL of sporulation medium (g L−1: potassium acetate, 10) and allowed to sporulate for 48 h at 30 °C in a shaking incubator. The tested strains were subjected to the sporulation procedure in two independent replicates.

Cells’ Ziehl-Neelsen Staining

The basic dye, concentrated carbol fuchsin (g L−1: fuchsin, 33.3 (Chempur, Piekary Śląskie, Poland), phenol, 66.7 (Chempur) and 167 mL of ethanol (POCh, Gliwice, Poland)), was applied to the fixed smear of yeast on a degreased basic slide for 15 min. During staining the slide was heated with a burner (to the so-called “three pairs”). Then the preparation was discolored in a 3% solution of hydrochloric acid (Honeywell, Charlotte, NC, USA) in ethanol (POCh, Gliwice, Poland) (acid alcohol). Afterwards, the contrast dye 0.1% (w/v) methylene blue (Chempur) was applied for 10 min. Finally, the preparation was observed in the light microscope Primo star (Zeiss, Oberkochen, Germany) under 1000× magnification using immersion.

2.2.3. The Mixtures of Lactic Acid Bacteria and Yeast Cells

A measurement of 5 mL of fresh M.R.S Broth or liquid YPD in a 50 mL Falcon tube was inoculated with a bacterial (Ldsubl) or yeast colony (ScD, Sb745, Km, PfD), respectively. The cultures were incubated at 30 °C with 250 rpm shaking for 20 h. The average cells’ concentration of each overnight culture was determined using CellDrop FL (DeNovix INC, Wilmington, NC, USA). Subsequently, mixtures of microorganisms were prepared in saline water (0.85% w/v NaCl). Suspensions included ScD and Sb745 cells, where Sb accounted for 10% (Mx_0.1), 50% (Mx_0.5) and 90% (Mx_0.9) of the total amount of yeast cells. Another group of suspensions consisted of those that contained a fixed number of Ldsubl cells and yeast cells with a 60% share of ScD (Mx_Sc) or Sb (Mx_Sb), 38% of Km and 2% of PfD. In this series of mixtures, the ratio of Sc cells to Sb cells was the same as in suspensions composed only of Sc cells (Figure S1).

2.3. MALDI-TOF Mass Spectrometry

MALDI-TOF mass spectrometry analysis was performed in the Microbiological Laboratory of the Jagiellonian Center of Innovation (Cracow, Poland). MALDI-TOF mass spectrometer Microflex LT (Bruker Daltonics, Bremen, Germany) was applied for matrix-assisted laser desorption/ionization with time-of-flight analysis. The identification of microorganisms was based on the specific profile of ribosomal proteins compared to a representative database of bacteria, yeast-like fungi, filamentous fungi and dermatophytes, utilizing the MALDI Biotyper system (Bruker Daltonics). The level of the identification confidence was indicated by the identification indicator (Ii). Values of Ii greater or equal to 2.00 indicate high-confidence identification. Values within the range of 1.70 to 1.99 indicate low-confidence identification, while values below 1.69 indicate that no species identification is possible.

2.4. Total Genomic DNA Extraction Procedures

2.4.1. Total Genomic DNA Isolation from Yeast Culture

Preceding DNA extraction, the studied yeast strains were freshly cultured on YPD agar at 30 °C for 20 h. DNA was extracted using the Genomic mini AX yeast spin kit (A&A Biotechnology, Gdynia, Poland), following the manufacturer’s protocol. The procedure included a step of yeast lysis with lyticase at 30 °C combined with vigorous vortexing. Extracted DNA quality was confirmed by applying agarose gel electrophoresis, following a standard method [39]. Exclusively DNA samples with sharp and intense bands were used in qPCR. DNA concentration and purity were assessed using a UV spectrophotometer, NanoDrop ND-1000 (Thermo Fisher Scientific, Wilmington, NC, USA). The OD 260/280 ratio of the DNA samples for amplification ranged between 1.8 and 2.0. The extracted DNA was stored at −20 °C.

2.4.2. Total Genomic DNA Isolation from Dietary Supplements and Microbial Mixtures

The capsule contents of each dietary supplement were crushed in liquid nitrogen in a mortar. The fresh yeast and bacterial cultures were used for preparing mixtures (Section 2.2.3). Following this, 2 mL of each mixture was pelleted by centrifugation. Total genomic DNA was extracted from 100 mg of each food supplement and each mixture pellet using Genomic mini AX Food kit (A&A Biotechnology, Gdynia, Poland). The procedure was conducted according to the manufacturer’s protocol. The first step was lysis with proteinase K at 30 °C, followed by vigorous vortexing. DNA was isolated and purified from the lysate with column work through gravity and then eluted, precipitated and dissolved in sterile water. The concentration and purity of the isolated DNA were determined using a UV spectrophotometer NanoDrop ND-1000 (Thermo Fisher Scientific, Wilmington, NC, USA). The quality and integrity of the DNA samples were verified through agarose gel electrophoresis according to a standard method [39]. The extracted DNA was stored at −20 °C.

2.5. Quantitative Real-Time PCR—High-Resolution Melting Analysis (qPCR–HRM)

2.5.1. Applied Primer Pairs

rDNA sequences (18S rRNA, 26S rRNA and ITS region) of the studied yeast strains were amplified with primer pairs designed previously [40]. As part of this work, additional primer pairs were designed. S. cerevisiae S288C genes’ sequences were downloaded from the NCBI database. The accession numbers of sequences are shown in Table 2. The multiple sequence alignment tool from NCBI was applied to align and compare the targeted sequences to Saccharomyces spp. The sequence alignment was analyzed for DNA regions showing intragroup heterogeneity, flanked by conservative sequence segments enabling the attachment of primers. Amplicon length was kept within the range of 100 to 250 bp. The primers were designed with the Primer3-BLAST tool and synthesized by Merck KGaA (Darmstadt, Germany). Initially, annealing temperature optimization of all primer pairs was performed using Perpetual OptiTaq PCR MasterMix according to the manufacturer’s instructions (EURx, Gdansk, Poland) in a temperature gradient of 58–63 °C. The amplification efficiency was verified through agarose gel electrophoresis according to a standard method [39]. TDA8 primer pair was eliminated from the further study due to a lack of amplification on Sc samples in the optimization step. Furthermore, amplification products of all studied primer pairs were positively verified for expected lengths (Figure S2).

2.5.2. qPCR Protocol

PCR mixtures contained 5 µL of commercial qPCR master mix with Eve Green dye (Bio-Rad Laboratories, Inc., Hercules, CA, USA), 0,5 µL of 10 µM forward and reverse primer and 1–4 µL of DNA sample (5 ng of single-yeast DNA or 20 ng of microbial-mix DNA per reaction) in a total volume of 10 µL. All reactions were performed in clear-walled PCR 96-well plates using the CFX96 cycler (Bio-Rad Laboratories, Hercules, CA, USA). The amplification conditions were as follows: 95 °C for 3 min was followed by 30–40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C (primer pairs for sequence segment within 18SrRNA, 26SrRNA, ITS, TEF1alpha, HO, RPB2, MAL11 and HXT9) or 58 °C (primer pairs for CCA1) for 30 s and extension at 72 °C for 30 s. Melting curves data were collected over a temperature range between 65 °C and 95 °C. Data acquisition was conducted in increments of 0.2 °C, with each step lasting 10 s. All DNA samples were analyzed in technical duplicates in at least two independent runs. To check the purity of reagents, No Template Control (NTC) for each primer pair was run in parallel.

2.5.3. HRM Analysis

Precision Melt Analysis Software (PMAS) (Bio-Rad Laboratories, Inc.) was used to analyze the generated qPCR amplicons. The pre- and post-melt regions, as well as the intersection points of the melt curves in a temperature-shifted view, were carefully evaluated. Adjustments were made for each amplicon as necessary. The clustering settings were adjusted to improve the sensitivity detection of the melt curve shape change. A melting temperature (Tm) threshold difference of 0.2 °C was set for all melt curve analyses, and PMAS automatically assigned clustering confidence scores.

2.6. Statistical Analysis

The statistical significance of the differences observed based on clustering in HRM analysis of yeast strains for the four examined regions (18SrRNA, 26SrRNA, ITS, TEF1alpha) was assessed using DarWin software version 6.0.21. The phylogenetic tree was constructed based on the unweighted pair-group method with the arithmetic averages (UPGMA).

3. Results

3.1. Characteristic of Saccharomyces cerevisiae var. boulardii Reference Strains

Two reference strains were confirmed with high confidence by MALDI-TOF mass spectrometry to belong to genus Saccharomyces cerevisiae. Ii was 2.16 and 2.09 for Sb745 and Sb3799, respectively. The reference strains did not show the ability to sporulate (Figure 1a,b), and no amplification of regions MAL11 and HXT9 was detected for either (Figure 1e,f).

3.2. Differentiation of Saccharomyces cerevisiae Strains Using Interspecies Primer Pairs in qPCR-HRM Analysis

For all sequences tested, a homogeneous product was obtained for each sample as evidenced by single peaks (Figure 2a). HRM analysis of the 18SrRNA region amplicon showed individual clustering of Sc and probiotic Sb strains at the differentiation thresholds used. The other species used in the study, the Km collection strain and the PfD isolate, were grouped separately (Figure 2b, 18SrRNA). The maximum RFU difference between the Sb and Sc clusters was 0.03, a slightly larger difference of 0.1 was between the Sb and Sc clusters combined and the PfD cluster, and the largest difference of 0.3 was between the Sb and Sc clusters combined and the Km cluster. For the non-coding ITS sequence, all strains belonging to Sc species, including the probiotic ones, were in one cluster. Km and PfD control strains formed separate clusters (Figure 2b, ITS). The maximum RFU difference was 0.6 between the Sb/Sc cluster and Km. Slightly less difference, 0.4, was shown by comparing the Sb/Sc and PfD clusters (Figure 2b, ITS). According to HRM analysis, the qPCR reaction with the primer pair for the 26SrRNA region yielded a uniform product for all Sc strains as well as the Km strain. In this case, only PfD was grouped separately (Figure 2b, 26SrRNA). Amplification of a region selected within TEF1alpha resulted in a product whose denaturation profile was the same for all Sc and Sb tested except ScEtRed. The TEF1alpha region products obtained for the negative control strains were clustered individually (Figure 2b, TEF1alpha). The melting temperatures of the amplicons of each of the genomic DNA regions tested did not differ within the Sc species significantly (Table S1). HRM-based clustering of the selected sequences analyzed with DarWin software showed that the reference probiotic strains tested are genetically very similar and phylogenetically a variant of the species Sc (Figure S3).

3.3. Differentiation of Saccharomyces cerevisiae Strains Using Intragenus Primer Pairs in qPCR-HRM Analysis

No products were demonstrated for Km and PfD control templates using primer pairs designed for the genus Saccharomyces (Figure 3 and Figure S2). Furthermore, no amplification of the MAL11 and HXT9 regions was observed for the reference strains Sb (Figure 3, MAL11, HXT9, Figure 1e,f). In addition, no sequence amplification in the MAL11 region was detected for the ScEtRed template (Figure 3, MAL11, Figure S2). For all sequences tested, a homogeneous product was obtained for the remaining samples, as evidenced by single peaks (Figure 3a). The peak melting curves of RPB2 amplicons for ScD had shoulders, indicative of polymorphisms in amplified sequence. HRM software grouped Sb probiotic strains and ScD isolate in one cluster at CCA1 region analysis (Figure 3, CCA1). A similar result was the joint clustering of probiotic strains and ScEtRed regarding the melting temperature and profile of HO sequence (Figure 3, HO). The maximum RFU difference in the HO melting profile was 0.1 between the Sb745 cluster and the ScATCC9763 cluster (Figure 3b, HO). The amplicon obtained with the primer pair designed for RPB2 was essential in the differentiation of the probiotic strains against the other Sc tested in this study. The RFU difference between the clusters was 0.2 (Figure 3b, RPB2). Significant differences were found in the melting temperatures of CCA1 PCR products for all Sc strains tested, including the two probiotic strains. Significantly, the melting temperature of RPB2 amplicon was the same for both Sb strains and differed from the others by 0.2 °C (Table S1).

3.4. Identification of Probiotic Yeast in Dietary Supplements with qPCR-HRM Based on a Verified Set of Primer Pairs

In the present study, a genetic analysis of four probiotic supplements available in pharmacies was performed. Their composition is presented in Table 1. DNA extracts obtained from the preparations along with reference templates of Sb745 and ScATCC9763 were subjected to the qPCR reactions with the selected primer pairs. According to HRM analysis, the 18SrRNA sequences for each of the test samples were grouped with the references. The same effect was observed for the amplicons of the ITS region (Figure 4(1a,b)). If Saccharomyces-specific primer pairs were used, only PS2, PS3 and PS4 samples were found to cluster with the Sb745 reference for HO sequences, as well as RPB2. The PS1 sample remained in separate clusters for both studied sequences with ScATCC9763 amplicons (Figure 4(2a,b)). PS1 strain was identified by MALDI-TOF mass spectrometry as Saccharomyces cerevisiae with high confidence (Ii was 2.15). The amplification of MAL11 and HXT9 regions on the DNA template of the PS1 supplement was found (Figure 1e,f). In addition, the isolated strain of the PS1 supplement was able to sporulate (Figure 1c).

3.5. Identification of Probiotic Yeasts in Microbial Mixtures with qPCR-Based HRM Analysis

The mixed suspensions (Mx) for DNA isolation containing a fixed amount of Ldsubl (log 8 CFU mL−1), Km (3.8 log 6 CFU mL−1) and PfD (2 log 5 CFU mL−1) cells were prepared. Successively, the suspensions Mx_Sc, Mx_0.1, Mx_0.5, Mx_0.9 and Mx_Sb contained increasing numbers of Sb745 cells. In addition, suspensions S_0.1, S_0.5 and S_0.9 were prepared, containing only ScD and Sb745 cells, which were combined in analogous ratios to suspensions Mx (Figure S1). DNA was extracted from the obtained cells’ pellets with a kit designed for foods. The resulting templates and Sb745 positive control DNA were amplified using the primer pairs for 18SrRNA, ITS, HO and RPB2 regions. Considering the 18SrRNA sequence, the melting temperatures (Tm) of the amplicons obtained for the following samples were in the range of 83.80–84.0 °C (Figure 5a). In the same range remained the Tm of the 18SrRNA amplification products of the yeast species studied, namely ScD, Km and PfD (Table S1). The software grouped all tested samples into one cluster (Figure 5b). More clusters were obtained in HRM analysis of ITS sequences (Figure 5d). The first grouped the reference strain Sb745 and mixtures with Sb745 and ScD (S_0.1, S_0.5 i S_0.9). In this cluster were amplicons with a Tm of 82.2 °C (Figure 5c), which corresponded to the melting point of the ITS product for ScD (Table S1). The remaining clusters included samples containing Km, PfD, ScD and Sb745 in different proportions (Figure 5d). These amplification products showed double peaks with Tm of 81.6 °C and 84.4 °C. (Figure 5c). The Tm indicated in the figure corresponded to the melting temperatures of ITS sequences of Km and PfD species, respectively (Table S1). In each case, the product with a melting point corresponding to PfD was quantitatively predominant. Exploring the HO sequence, the Mx_Sb, Mx_0.9 and S_0.9 samples were clustered with the positive control in the HRM analysis. The remaining Mx_Sc, Mx_0.1, Mx_0.5, S_0.1 and S_0.5 were grouped in a separate cluster (Figure 5e). The same result was obtained for HRM analysis of RPB2 amplicons (Figure 5g). For both marker sequences, a gradational distribution of differential melting curves was observed depending on the initial Sb745 cell content of the sample. The smaller the proportion of Sb745 cells in the suspension mix, the further the differential melting curve was from the reference curve. Regarding the adopted clustering parameters, the denaturation curve profiles of Mx_0.5 and S_0.5 products significantly differed from the Sb745 reference, as shown in the detailed graphs (Figure 5f,h). The melting point of the HO product of all the mixtures tested was 79.0 °C, which is consistent with Table S1 data on HO Tm for ScD and Sb745 samples. The Tm of RBP2 products amplified with Sb745 and Mx_Sb DNA templates was 79.8 °C and corresponded to Sb745 amplicons. RPB2 amplification products of the other mixed samples achieved Tm of 79.4–79.6 °C, in which range the melting point of the ScD sequence falls (Table S1).

4. Discussion

The purpose of this study was to develop a qPCR-HRM-based analysis to identify Sb in probiotic-fortified foods. The comparative genomic research demonstrated that Sb and Sc share more than 99% genomic relatedness as determined by Average Nucleotide identity (ANI) [18]. The aforementioned strong genetic similarity was confirmed herein through performed HRM analysis using the four analyzed regions: 18SrRNA, 26SrRNA, ITS and TEF1alpha. The generated dendrogram grouped all Sc strains with a separate sub-cluster of reference probiotic Sb strains.
Reviewing the melting temperatures of each of the rDNA amplicons obtained in qPCR, there were no significant differences between the Sc and Sb strains tested. A pair of primers designed for the 18SrRNA region tested on pure cultures enabled the clustering of subtype Sb outside the Sc cluster. HRM analysis results concerning 26SrRNA and ITS sequences resulted in joint clustering of Sb and Sc strains. In comparative genomic studies, the sequence ITS1-5.8S rDNA-ITS2 of Sb displayed some subtle differences and 99% resemblance. Regarding the sequence of the D1/D2 domain of the 26SrRNA there was a similarity value of 100% compared to the Sc genomes. The probability of constructing an effective differentiation sequence within rDNA is very low, with the scarcity of polymorphisms and the strict requirements for HRM analysis [4,14,22]. The problematic rDNA regions were used in attempts to differentiate species of the genus Saccharomyces using HRM analysis. Four primer combinations were designed spanning the 26SrRNA polymorphic region of 10 Saccharomyces species aligned. The highest discrimination level was achieved with five clusters for 10 type strains examined [24]. The combination of 26SrRNA and ITS regions in another HRM analysis of Saccharomyces species enabled discrimination of the most studied yeasts at the species level. However, differentiation of Sc, Sb and Saccharomyces uvarum in the pure cultures or the mixed samples failed [26].
Genes encoding actin (ACT1), translation elongation factor (TEF1alpha), RNA polymerase subunit (RPB1) and COX2, were considered more effective for the differentiating of the problematic, closely related species [41,42,43]. Moreover, TEF1alpha sequencing and MALDI-TOF mass-spectrometry were found more relevant for differentiation within the Pichia cactophila clade than sequencing of standard barcoding regions ITS and D1/D2 [44]. Nowadays, Sc promoter regions were found not to be fully conserved, in terms of nucleotide sequence nor predicted transcription factor (TF) binding sites, in homolog Sb genes. Some of the differentially expressed genes in Sb strains were found to have gained or lost TF binding sites in their promoter regions [19]. Therefore, a pair of primers for the yeast polymorphic region within TEF1alpha were included in this work. This was effective in interspecies discrimination while showing a very low degree of intraspecies differentiation. Only the ScEtRed strain remained in a distinct cluster from the other Sc and Sb strains tested. The results revealed that the Sb probiotic strains are closer to wine strains of Sc than industrial or baking strains [18].
As intended, the primer pairs designed for this work for regions within CCA1, HO, RPB2, HXT9 and MAL11 were not amplified in species other than Sc. Amplification of HXT9 and MAL11 sequences was found only in Sc strains. The exception was ScEtRed, which showed no MAL11 amplification. ScEtRed closely relates to wine strains therefore it might show high similarities to Sb [45]. MLST (Multilocus Sequence Typing) involved the sequencing of four nuclear genes CCA1, CYT1 (ubiquinol-cytochrome-c reductase catalytic subunit gene), HMX1 (heme oxygenase gene), NUP116 (FG-nucleoporin gene) and ITS region resulted in the uniform clade of clinical isolates and commercial probiotic yeasts [23]. In this study, a primers pair designed for the CCA1 sequence was not sufficient to provide differentiation of probiotic strains. In contrast, the expected effect was found for the RPB2 sequence. Moreover, HRM analysis with RPB2 amplicon effectively clustered separately newly isolated Saccharomyces paradoxus strain. HO sequence clustered Sb strains with ScEtRed indicating the close affinity of Sb and Sc wine strains.
Comparative analysis with regions in 18S rRNA and ITS confirmed the presence of Sc strains in the dietary supplements tested. Moreover, the selected intraspecies sequences, HO and RPB2, confirmed the presence of Sb in PS2, PS3, PS4, and Sc in PS1, according to their composition as declared by the manufacturers. The preparations did not include detailed specifications of the yeast strains declared. As established, MAL11, MAL13 (transcription factor gene), and ARN2 (siderophore transporter gene) were present in more than 70% of the strains of different subgroups of Sc strains but were absent in all the probiotic strains. The large hexose transporter family comprises HXT11 and HXT9 which were absent from all strains of Sb [18]. Therefore, HXT9 and MAL11 sequences were amplified on PS2–PS4 templates. As a result, no amplification products of the MAL11 region were confirmed, while only for PS2 the HXT9 amplicon was not detected. Thus, the strains included in the examined supplements, except PS2, do not completely correspond to those with health-promoting properties.
HRM analysis of DNA extracted from seed mixtures showed reduced sensitivity detection of the selected template compared to the analysis of mixed DNA samples [46]. The yield of bacterial DNA from sourdough fermented with different strains of the same species may differ up to 100,000-fold even if the organisms are present at the same cell counts [47]. The observations support the assumption that the structure of the food matrix could lower the recovery of the nuclear or organellar DNA. It was declared that qPCR-HRM analysis detects but does not identify organisms if they account for 0.1–1% of the bacterial and yeast population, respectively [48]. Therefore, the effectiveness of selected sequences in identifying probiotic strains was tested using DNA templates obtained in extraction from mixtures containing three yeast species. Mixtures were prepared that microbiologically corresponded in composition to kefirs [37,49,50,51,52]. The application of commercial kefirs in the study failed. The reason was the very low yeast content, no more than log 2 CFU mL−1 of cells was determined in commercial products. Due to very small differences in melting temperature (Tm) and melting profile of 18SrRNA amplicons for Sb745, ScD, Km and PfD all mix-yeast samples were clustered together. If the ITS sequence was considered, common clustering of samples containing only strains of Sc species was observed (Sb745 and ScD). In contrast, the other samples with additional Km and PfD presence formed several separate clusters. ITS region showed the greatest variability in DNA primary structure amongst the analyzed rDNA sequences. Consequently, it has the highest strength of interspecies differentiation in the HRM analysis. Amplification with a pair of ITS primers on DNA extracted from mixtures yielded heterogeneous products as a result of the increased affinity of the primers for the Pf sequence, as a consequence of nucleotide changes in the annealing regions of the Sc and Km sequences [40].
The designed intragenus primer pairs for HO or RPB2 regions were the best in the identification of Sb in the microbial mixtures. The RPB2 sequence had the highest differentiation power. The reference probiotic strain was identifiable by qPCR-HRM when the mixture contained at least log 7 CFU mL−1 of Sb cells, and Sb745 significantly exceeded the ScD strain quantitatively. Figure 5h shows that the presence of other yeast species does not significantly change the product melting profile for M_Sb. In contrast, a reduction in the number of Sb745 cells to ScD resulted in a significant increase in difference RFU of 0.2 to the reference. The limits for accurate quantification of Sc in wine artificially contaminated, with real-time PCR using specific primers, were established for log 5 CFU mL−1 in sweet wine and log 6 CFU mL−1 in red wine [53]. Such high detection thresholds by qPCR indicate that the stated threshold for identification of Sb cells using qPCR-HRM analysis is plausible. A required minimum dose of health-boosting microorganisms is log 6 CFU mL−1 or CFU g−1 for the food product to be labelled as a probiotic [54]. Since the viability of microorganisms is the key to achieving health benefits (log 6–log 7 CFU per g during the expected shelf-life of the probiotic food or beverage, according to WHO/FAO, 2006, some researchers even suggest increasing the dose up to log 7 CFU mL−1 or CFU g−1 [55]. This is sufficient enough to detect and identify the probiotic strain of Sb yeast in probiotic-enriched foods with qPCR-HRM analysis using the genus specific primer pairs.

5. Conclusions

Preliminary validation of qPCR-HRM analysis using primer pairs’ set and species-diverse yeast samples enabled the selection of interspecies sequences and genus-specific sequences with appropriate differentiation power for Sb identification among Sc strains. The designed multi-fragment genetic analysis was sufficient for Sb identification in pure culture and proved effective in the authentication of dietary supplements’ probiotic composition.
Successful high-resolution melting analysis highly relies on the purity of the DNA template, but also on the quantity, which must be comparable to the reference template. Consequently, challenges may arise in detecting, and especially in identifying, microorganisms within the microbiologically complex food matrices. In the present study, the identification of Sb in the microbial mixtures of kefir succeeded using specific intragenus sequences. Additionally, the established qPCR-HRM analysis enabled the identification of Sb in the microbial mix with the predominance of Sb, corresponding to the required dose of health-promoting microorganisms for the food product to be labelled as probiotic.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biotech13040048/s1, Figure S1: Microbial mixtures’ quantitative composition; Figure S2: Amplicons’ length verification; Figure S3: Dendrogram illustrating the similarity level of all studied yeast strains; Table S1: The melting temperature (Tm) [°C] analysis results for all studied targets and sequences.

Author Contributions

Conceptualization, M.B.; Methodology, M.B., M.K. and K.M.; Investigation, M.B., M.K. and K.M.; Resources, M.B., K.M.; Data Curation, M.B.; Writing—Original Draft Preparation, M.B.; Writing—Review and Editing, M.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a subvention from the PULS fund (number 506.771.03.00) received from the Ministry of Science and Higher Education.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. Expert Consensus Document: The International Scientific Association for Probiotics and Prebiotics Consensus Statement on the Scope and Appropriate Use of the Term Probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [PubMed]
  2. Fijan, S. Microorganisms with Claimed Probiotic Properties: An Overview of Recent Literature. Int. J. Environ. Res. Public Health 2014, 11, 4745–4767. [Google Scholar] [CrossRef] [PubMed]
  3. Łukaszewicz, M. Saccharomyces Cerevisiae Var. Boulardii—Probiotic Yeast. In Probiotics; InTech Press: Las Vegas, NV, USA, 2012. [Google Scholar] [CrossRef]
  4. Fietto, J.L.R.; Araújo, R.S.; Valadão, F.N.; Fietto, L.G.; Brandão, R.L.; Neves, M.J.; Gomes, F.C.O.; Nicoli, J.R.; Castro, I.M. Molecular and Physiological Comparisons between Saccharomyces cerevisiae and Boulardii. Can. J. Microbiol. 2004, 50, 615–621. [Google Scholar] [CrossRef] [PubMed]
  5. Czerucka, D.; Piche, T.; Rampal, P. Review article: Yeast as Probiotics—Saccharomyces boulardii. Aliment. Pharmacol. Ther. 2007, 26, 767–778. [Google Scholar] [CrossRef]
  6. Cesaro, S.; Chinello, P.; Rossi, L.; Zanesco, L. Saccharomyces cerevisiae Fungemia in a Neutropenic Patient Treated with Saccharomyces boulardii. Support. Care Cancer 2000, 8, 504–505. [Google Scholar] [CrossRef]
  7. Thygesen, J.B.; Glerup, H.; Tarp, B. Saccharomyces boulardii Fungemia Caused by Treatment with a Probioticum. BMJ Case Reports 2012, 27, bcr0620114412. [Google Scholar] [CrossRef]
  8. Santino, L.; Alari, A.; Bono, S.; Tetp, E.; Bernardini, A.; Magrini, L.; Di Somma, S.; Teggi, A. Saccharomyces cerevisiae fungemia, a possible consequence of the treatment of Clostridium difficile colitis with a probioticum. Int. J. Immunopathol. Pharmacol. 2014, 27, 143–146. [Google Scholar] [CrossRef]
  9. Ellouze, O.; Berthoud, V.; Mervant, M.; Parthiot, J.P.; Girard, C. Septic Shock Due to Saccharomyces boulardii. Med. Et Mal. Infect. 2016, 46, 104–105. [Google Scholar] [CrossRef]
  10. Kara, I.; Yıldırım, F.; Özgen, Ö.; Erganiş, S.; Aydoğdu, M.; Dizbay, M.; Gürsel, G.; Kalkanci, A. Saccharomyces cerevisiae Fungemia after Probiotic Treatment in an Intensive Care Unit Patient. J. Mycol. Med. 2018, 28, 218–221. [Google Scholar] [CrossRef]
  11. Cardinali, G.; Martini, A. Electrophoretic Karyotypes of Authentic Strains of the Sensu Strict0 Group of the Genus Saccharomyces? Int. J. Syst. Bacteriol. 1994, 44, 791–797. [Google Scholar] [CrossRef]
  12. Molnar, O.; Messner, R.; Prillinger, H.; Stahl, U.; Slavikova, E. Genotypic Identification of Saccharomyces Species Using Random Amplified Polymorphic DNA Analysis. Syst. Appl. Microbiol. 1995, 18, 136–145. [Google Scholar] [CrossRef]
  13. McCullough, M.J.; Clemons, K.V.; McCusker, J.H.; Stevens, D.A. Species Identification and Virulence Attributes of Saccharomyces boulardii (Nom. Inval.). J. Clin. Microbiol. 1998, 36, 2613–2617. [Google Scholar] [CrossRef] [PubMed]
  14. Van Der Aa Kühle, A.; Jespersen, L. The Taxonomic Position of Saccharomyces boulardii as Evaluated by Sequence Analysis of the D1/D2 Domain of 26S RDNA, the ITS1-5.8S RDNA-ITS2 Region and the Mitochondrial Cytochrome-c Oxidase II Gene. Syst. Appl. Microbiol. 2003, 26, 564–571. [Google Scholar] [CrossRef] [PubMed]
  15. Kurtzman, C.P.; Robnett, C.J. Identification and Phylogeny of Ascomycetous Yeasts from Analysis of Nuclear Large Subunit (26S) Ribosomal DNA Partial Sequences. Antonie Van Leeuwenhoek 1998, 73, 331–371. [Google Scholar] [CrossRef]
  16. McFarland, L.V. Saccharomyces boulardii is not Saccharomyces cerevisiae. Clin. Infect. Dis. 1996, 22, 200–201. [Google Scholar] [CrossRef]
  17. Edwards-Ingram, L.; Gitsham, P.; Burton, N.; Warhurst, G.; Clarke, I.; Hoyle, D.; Oliver, S.G.; Stateva, L. Genotypic and Physiological Characterization of Saccharomyces boulardii, the Probiotic Strain of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2007, 73, 2458–2467. [Google Scholar] [CrossRef]
  18. Khatri, I.; Tomar, R.; Ganesan, K.; Prasad, G.S.; Subramanian, S. Complete Genome Sequence and Comparative Genomics of the Probiotic Yeast Saccharomyces boulardii. Sci. Rep. 2017, 7, 371. [Google Scholar] [CrossRef]
  19. Pais, P.; Oliveira, J.; Almeida, V.; Yilmaz, M.; Monteiro, P.T.; Teixeira, M.C. Transcriptome-Wide Differences between Saccharomyces cerevisiae and Saccharomyces cerevisiae Var. Boulardii: Clues on Host Survival and Probiotic Activity Based on Promoter Sequence Variability. Genomics 2021, 113, 530–539. [Google Scholar] [CrossRef]
  20. Mitterdorfer, G.; Mayer, H.K.; Kneifel, W.; Viernstein, H. Clustering of Saccharomyces boulardii Strains within the Species S. Cerevisiae Using Mol. Typing Techniques. J. Appl. Microbiol. 2002, 93, 521–530. [Google Scholar] [CrossRef]
  21. Hennequin, C.; Thierry, A.; Richard, G.F.; Lecointre, G.; Nguyen, H.V.; Gaillardin, C.; Dujon, B. Microsatellite Typing as a New Tool for Identification of Saccharomyces cerevisiae Strains. J. Clin. Microbiol. 2001, 39, 551–559. [Google Scholar] [CrossRef]
  22. Posteraro, B.; Sanguinetti, M.; Romano, L.; Torelli, R.; Novarese, L.; Fadda, G. Molecular Tools for Differentiating Probiotic and Clinical Strains of Saccharomyces cerevisiae. Int. J. Food Microbiol. 2005, 103, 295–304. [Google Scholar] [CrossRef] [PubMed]
  23. Imre, A.; Rácz, H.V.; Antunovics, Z.; Rádai, Z.; Kovács, R.; Lopandic, K.; Pócsi, I.; Pfliegler, W.P. A New, Rapid Multiplex PCR Method Identifies Frequent Probiotic Origin among Clinical Saccharomyces Isolates. Microbiol. Res. 2019, 227, 126298. [Google Scholar] [CrossRef]
  24. Nadai, C.; Bovo, B.; Giacomini, A.; Corich, V. New Rapid PCR Protocol Based on High-Resolution Melting Analysis to Identify Saccharomyces cerevisiae and Other Species within Its Genus. J. Appl. Microbiol. 2018, 124, 1232–1242. [Google Scholar] [CrossRef] [PubMed]
  25. Ripari, V.; Gänzle, M.G.; Berardi, E. Evolution of Sourdough Microbiota in Spontaneous Sourdoughs Started with Different Plant Materials. Int. J. Food Microbiol. 2016, 232, 35–42. [Google Scholar] [CrossRef]
  26. Bazalová, O.; Cihlář, J.Z.; Dlouhá, Z.; Bár, L.; Dráb, V.; Kavková, M. Rapid Sourdough Yeast Identification Using Panfungal PCR Combined with High Resolution Melting Analysis. J. Microbiol. Methods 2022, 199, 106522. [Google Scholar] [CrossRef] [PubMed]
  27. Erdem, M.; Kesmen, Z.; Özbekar, E.; Çetin, B.; Yetim, H. Application of High-Resolution Melting Analysis for Differentiation of Spoilage Yeasts. J. Microbiol. 2016, 54, 618–625. [Google Scholar] [CrossRef]
  28. Kesmen, Z.; Büyükkiraz, M.E.; Özbekar, E.; Çelik, M.; Özkök, F.Ö.; Kılıç, Ö.; Çetin, B.; Yetim, H. Assessment of Multi Fragment Melting Analysis System (MFMAS) for the Identification of Food-Borne Yeasts. Curr. Microbiol. 2018, 75, 716–725. [Google Scholar] [CrossRef]
  29. Kesmen, Z.; Özbekar, E.; Büyükkiraz, M.E. Multifragment Melting Analysis of Yeast Species Isolated from Spoiled Fruits. J. Appl. Microbiol. 2018, 124, 522–534. [Google Scholar] [CrossRef]
  30. Baleiras-Couto, M.M.; Eijsma, B.; Hofstra, H.; Huis In’T Veld, J.H.; Van Der Vossen, J.M. Evaluation of Molecular Typing Techniques to Assign Genetic Diversity among Saccharomyces cerevisiae Strains. Appl. Environ. Microbiol. 1996, 62, 41–46. [Google Scholar] [CrossRef]
  31. Valente, P.; Gouveia, C.; De Lemos, G.A.; Pimentel, D.; Van Elsas, J.D.; Mendonqa-Hagler, L.C.; Hagler, A.N. PCR Amplification of the RDNA Internal Transcribed Spacer Region for Differentiation of Saccharomyces Cultures. FEMS Microbiol. Lett. 1996, 137, 253–256. [Google Scholar] [CrossRef]
  32. Rekha, C.R.; Vijayalakshmi, G. Bioconversion of Isoflavone Glycosides to Aglycones, Mineral Bioavailability and Vitamin B Complex in Fermented Soymilk by Probiotic Bacteria and Yeast. J. Appl. Microbiol. 2010, 109, 1198–1208. [Google Scholar] [CrossRef] [PubMed]
  33. Değirmencioğlu, N.; Gurbuz, O.; Şahan, Y. The Monitoring, Via an In Vitro Digestion System, of the Bioactive Content of Vegetable Juice Fermented with Saccharomyces cerevisiae and Saccharomyces boulardii. J. Food Process. Preserv. 2016, 40, 798–811. [Google Scholar] [CrossRef]
  34. Zamora-Vega, R.; Montañez-Soto, J.L.; Martínez-Flores, H.E.; Flores-Magallón, R.; Muñoz-Ruiz, C.V.; Venegas-González, J.; De Jesús Ariza Ortega, T. Effect of Incorporating Prebiotics in Coating Materials for the Microencapsulation of Sacharomyces boulardii. Int. J. Food Sci. Nutr. 2012, 63, 930–935. [Google Scholar] [CrossRef]
  35. Chan, M.Z.A.; Tan, L.T.; Heng, S.W.Q.; Liu, S.Q. Effect of Co-Fermentation of Saccharomyces boulardii CNCM-I745 with Four Different Probiotic Lactobacilli in Coffee Brews on Cell Viabilities and Metabolic Activities. Fermentation 2023, 9, 219. [Google Scholar] [CrossRef]
  36. Karaolis, C.; Botsaris, G.; Pantelides, I.; Tsaltas, D. Potential Application of Saccharomyces boulardii as a Probiotic in Goat’s Yoghurt: Survival and Organoleptic Effects. Int. J. Food Sci. Technol. 2013, 48, 1445–1452. [Google Scholar] [CrossRef]
  37. Goktas, H.; Dikmen, H.; Demirbas, F.; Sagdic, O.; Dertli, E. Characterisation of Probiotic Properties of Yeast Strains Isolated from Kefir Samples. Int. J. Dairy Technol. 2021, 74, 715–722. [Google Scholar] [CrossRef]
  38. Gut, A.M.; Vasiljevic, T.; Yeager, T.; Donkor, O.N. Characterization of Yeasts Isolated from Traditional Kefir Grains for Potential Probiotic Properties. J. Funct. Foods 2019, 58, 56–66. [Google Scholar] [CrossRef]
  39. Sambrook, J.; Russell, D. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. [Google Scholar]
  40. Borkowska, M.; Celińska, E. Multiple Region High Resolution Melting-Based Method for Accurate Differentiation of Food-Derived Yeasts at Species Level Resolution. Food Microbiol. 2023, 109, 104120. [Google Scholar] [CrossRef]
  41. Cappello, M.S.; Poltronieri, P.; Blaiotta, G.; Zacheo, G. Molecular and Physiological Characteristics of a Grape Yeast Strain Containing Atypical Genetic Material. Int. J. Food Microbiol. 2010, 144, 72–80. [Google Scholar] [CrossRef]
  42. Eizaguirre, J.I.; Peris, D.; Rodríguez, M.E.; Lopes, C.A.; De Los Ríos, P.; Hittinger, C.T.; Libkind, D. Phylogeography of the Wild Lager-Brewing Ancestor (Saccharomyces eubayanus) in Patagonia. Environ. Microbiol. 2018, 20, 3732–3743. [Google Scholar] [CrossRef]
  43. Hulin, M.; Harrison, E.; Stratford, M.; Wheals, A.E. Rapid Identification of the Genus Dekkera/Brettanomyces, the Dekkera Subgroup and All Individual Species. Int. J. Food Microbiol. 2014, 187, 7–14. [Google Scholar] [CrossRef] [PubMed]
  44. Guitard, J.; Atanasova, R.; Brossas, J.Y.; Meyer, I.; Gits, M.; Marinach, C.; Vellaissamy, S.; Angoulvant, A.; Mazier, D.; Hennequin, C. Candida Inconspicua and Candida Norvegensis: New Insights into Identification in Relation to Sexual Reproduction and Genome Organization. J. Clin. Microbiol. 2015, 53, 1655–1661. [Google Scholar] [CrossRef] [PubMed]
  45. Gronchi, N.; De Bernardini, N.; Cripwell, R.A.; Treu, L.; Campanaro, S.; Basaglia, M.; Foulquié-Moreno, M.R.; Thevelein, J.M.; Van Zyl, W.H.; Favaro, L.; et al. Natural Saccharomyces cerevisiae Strain Reveals Peculiar Genomic Traits for Starch-to-Bioethanol Production: The Design of an Amylolytic Consolidated Bioprocessing Yeast. Front. Microbiol. 2022, 12, 768562. [Google Scholar] [CrossRef] [PubMed]
  46. Emenyeonu, L.C.; Croxford, A.E.; Wilkinson, M.J. The Potential of Aerosol EDNA Sampling for the Characterisation of Commercial Seed Lots. PLoS ONE 2018, 13, e0201617. [Google Scholar] [CrossRef]
  47. Zheng, J.; Ruan, L.; Sun, M.; Gänzle, M. A Genomic View of Lactobacilli and Pediococci Demonstrates That Phylogeny Matches Ecology and Physiology. Appl. Environ. Microbiol. 2015, 81, 7233–7243. [Google Scholar] [CrossRef]
  48. Lin, X.B.; Gänzle, M.G. Quantitative High-Resolution Melting PCR Analysis for Monitoring of Fermentation Microbiota in Sourdough. Int. J. Food Microbiol. 2014, 186, 42–48. [Google Scholar] [CrossRef]
  49. Wang, S.Y.; Chen, H.C.; Liu, J.R.; Lin, Y.C.; Chen, M.J. Identification of Yeasts and Evaluation of Their Distribution in Taiwanese Kefir and Viili Starters. J. Dairy Sci. 2008, 91, 3798–3805. [Google Scholar] [CrossRef]
  50. Kalamaki, M.S.; Angelidis, A.S. Isolation and Molecular Identification of Yeasts in Greek Kefir. Int. J. Dairy Technol. 2017, 70, 261–268. [Google Scholar] [CrossRef]
  51. Özer, B.; Kirmaci, H.A. Fermented Milks: Products of Eastern Europe and Asia. In Encyclopedia of Food Microbiology, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2014; pp. 900–907. [Google Scholar] [CrossRef]
  52. Nejati, F.; Junne, S.; Kurreck, J.; Neubauer, P. Quantification of Major Bacteria and Yeast Species in Kefir Consortia by Multiplex TaqMan QPCR. Front. Microbiol. 2020, 11, 1291. [Google Scholar] [CrossRef]
  53. Martorell, P.; Querol, A.; Fernández-Espinar, M.T. Rapid Identification and Enumeration of Saccharomyces cerevisiae Cells in Wine by Real-Time PCR. Appl. Environ. Microbiol. 2005, 71, 6823–6830. [Google Scholar] [CrossRef]
  54. White, J.; Hekmat, S. Development of Probiotic Fruit Juices Using Lactobacillus rhamnosus GR-1 Fortified with Short Chain and Long Chain Inulin Fiber. Fermentation 2018, 4, 27. [Google Scholar] [CrossRef]
  55. Fiocco, D.; Longo, A.; Arena, M.P.; Russo, P.; Spano, G.; Capozzi, V. How Probiotics Face Food Stress: They Get by with a Little Help. Crit. Rev. Food Sci. Nutr. 2020, 60, 1552–1580. [Google Scholar] [CrossRef] [PubMed]
Biotech 13 00048 g001
Figure 1. Verification of sporulation and HXT9 or MAL11 presence in Sc strains. Microscopic images of yeast cells of Sb745 (a), Sb3799 (b), ScPS1 (c), ScD (d) strains. The cells’ suspensions were induced to sporulate under starvation conditions and then stained with the Ziehl–Neelsen method. The arrows indicate stained ascospores (c,d). Electrophoretic separation of HXT9 (e) and MALL1 (f) amplicons obtained in PCR for S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD and ScPS1), K. marxianus (Km) and P. fermentans (Pf). M—DNA Marker 100 bp LOAD (Syngen Biotech, Wroclaw, Poland).
Figure 1. Verification of sporulation and HXT9 or MAL11 presence in Sc strains. Microscopic images of yeast cells of Sb745 (a), Sb3799 (b), ScPS1 (c), ScD (d) strains. The cells’ suspensions were induced to sporulate under starvation conditions and then stained with the Ziehl–Neelsen method. The arrows indicate stained ascospores (c,d). Electrophoretic separation of HXT9 (e) and MALL1 (f) amplicons obtained in PCR for S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD and ScPS1), K. marxianus (Km) and P. fermentans (Pf). M—DNA Marker 100 bp LOAD (Syngen Biotech, Wroclaw, Poland).
Biotech 13 00048 g001
Biotech 13 00048 g002
Figure 2. Differentiation of yeast with interspecies primer pairs in qPCR-HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA, ITS, 26SrDNA and TEF1alpha regions. DNA templates of S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD), K. marxianus (Km) and P. fermentans (PfD) strains were amplified in technical duplicate.
Figure 2. Differentiation of yeast with interspecies primer pairs in qPCR-HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA, ITS, 26SrDNA and TEF1alpha regions. DNA templates of S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD), K. marxianus (Km) and P. fermentans (PfD) strains were amplified in technical duplicate.
Biotech 13 00048 g002
Biotech 13 00048 g003
Figure 3. Differentiation of Sc strains using intragenus primer pairs in qPCR-HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of CCA1, HO, RPB2, MAL11and HXT9 regions. DNA templates of S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD), K. marxianus (Km) and P. fermentans (PfD) strains were amplified in technical duplicate. NA—not amplified.
Figure 3. Differentiation of Sc strains using intragenus primer pairs in qPCR-HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of CCA1, HO, RPB2, MAL11and HXT9 regions. DNA templates of S. cerevisiae var. boulardii reference strains (Sb745, Sb3799), S. cerevisiae strains (ScATCC9763, ScEtRed, ScD), K. marxianus (Km) and P. fermentans (PfD) strains were amplified in technical duplicate. NA—not amplified.
Biotech 13 00048 g003
Biotech 13 00048 g004
Figure 4. Identification of Sb in dietary supplements with qPCR-HRM. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA and ITS regions (1), HO and RPB2 regions (2). DNA template of S. cerevisiae var. boulardii reference strain (Sb745) as positive control, S. cerevisiae reference (ScATCC9763) and the dietary supplements’ DNA templates (PS1, PS2, PS3, PS4) were amplified in technical duplicate.
Figure 4. Identification of Sb in dietary supplements with qPCR-HRM. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA and ITS regions (1), HO and RPB2 regions (2). DNA template of S. cerevisiae var. boulardii reference strain (Sb745) as positive control, S. cerevisiae reference (ScATCC9763) and the dietary supplements’ DNA templates (PS1, PS2, PS3, PS4) were amplified in technical duplicate.
Biotech 13 00048 g004
Biotech 13 00048 g005
Figure 5. Identification of Sb745 in microbial mixtures with qPCR-based HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA. Melt peaks (c)—the arrows indicate species-specific peaks at Tm 81.6 °C, 82.2 °C and 84.4 °C for Km, ScD and PfD, respectively, and difference curves (d) grouped as color-marked clusters detected for ITS amplicon. Difference curves grouped as color-marked clusters obtained by qPCR-HRM analysis of HO sequence presented for all samples (e) and selected samples (f), and RPB2 sequence presented for all samples (g) and selected samples (h). DNA templates of S. cerevisiae var. boulardii reference strain (Sb745) as positive control and the microbial mixtures’ DNA extracts (Mx_Sb, Mx_0.9, Mx_0.5, Mx_0.1, Mx_Sc, S_0.9, S_0.5, S_0.1) were amplified in technical duplicate.
Figure 5. Identification of Sb745 in microbial mixtures with qPCR-based HRM analysis. Melt peaks (a) and difference curves grouped as color-marked clusters (b) were obtained by qPCR-HRM analysis of 18SrDNA. Melt peaks (c)—the arrows indicate species-specific peaks at Tm 81.6 °C, 82.2 °C and 84.4 °C for Km, ScD and PfD, respectively, and difference curves (d) grouped as color-marked clusters detected for ITS amplicon. Difference curves grouped as color-marked clusters obtained by qPCR-HRM analysis of HO sequence presented for all samples (e) and selected samples (f), and RPB2 sequence presented for all samples (g) and selected samples (h). DNA templates of S. cerevisiae var. boulardii reference strain (Sb745) as positive control and the microbial mixtures’ DNA extracts (Mx_Sb, Mx_0.9, Mx_0.5, Mx_0.1, Mx_Sc, S_0.9, S_0.5, S_0.1) were amplified in technical duplicate.
Biotech 13 00048 g005
Table 1. Composition of tested dietary supplements.
Table 1. Composition of tested dietary supplements.
LABELCOMPOSITION
PS1Saccharomyces cerevisiae
PS2Lactiplantibacillus plantarum, Bifidobacterium breve, Saccharomyces boulardii
PS3Saccharomyces boulardii and fructooligosaccharides
PS4Saccharomyces boulardii, L. rhamnosus GG, fructooligosaccharides
Table 2. Description of the primer pairs designed to amplify up to 250 bp regions within seven genes. Accession numbers correspond to the sequences of Saccharomyces cerevisiae S288C.
Table 2. Description of the primer pairs designed to amplify up to 250 bp regions within seven genes. Accession numbers correspond to the sequences of Saccharomyces cerevisiae S288C.
GENEPRIMERS
NAME (SYMBOL)ACCESSION NUMBERRANGE [bp]LABELSTART STOPSEQUENCE (5′->3′)PRODUCT LENGTH [bp]
Homothallic switching endonuclease (HO)NC_001136.146,810–47,130HO_Fw46,81746,836TGAAGTTGTTCCCCCAGCAA198
HO_Rv47,01446,995GGCGAAGGCCCTGAATCTTA
DNA-directed RNA polymerase II core subunit (RPB2)NC_001147.6615,169–615,510RPB2_Fw615,217615,239ACGGTTCAAAACCTGAGAAACAC229
RPB2_Rv615,445615,424AGGTCCATTATTGGCCCAACTT
tRNA adenylyl transferase (CCA1)NC_001137.3522,230–522,503CCA1_Fw522,282522,302CCAGATGCTTGGATTTCTCGG213
CCA1_Rv522,494522,474AGCCATTGACTCTTCGGATCA
Hexose transporter (HXT9)NC_001142.919,800–20,028HXT9_Fw19,82419,846AGAATGGGTTTGATCGTCTCAAT197
HXT9_Rv20,02019,996AGGCCAGAAATAATTCTTCCAATGA
Alpha-glucosidase permease (MAL11)NC_001139.91,074,890–1,075,090MAL11_Fw1,074,8911,074,910TTTCTCACCAACCACCAGGG196
MAL11_Rv1,075,0861,075,065ACATGACCAGTTACTCCAACAT
Topoisomerase I damage affected (TDA8)NC_001133.913,363–13,743TDA8_Fw13,38013,399GGGCTGTTAGGTCATCGTCA182
TDA8_Rv13,56113,542GCCCGATAACATTGCAGGGA
Translation elongation factor 1-alpha (TEF1alpha)NC_001142.4701,120–701,420TEF1_Fw701,138701,159ACCCAAAGACTGTTCCATTCGT238
TEF1_Rv701,375701,355GGCACAGTACCAATACCACCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Borkowska, M.; Kułakowski, M.; Myszka, K. High-Resolution Melting Analysis Potential for Saccharomyces cerevisiae var. boulardii Authentication in Probiotic-Enriched Food Matrices. BioTech 2024, 13, 48. https://doi.org/10.3390/biotech13040048

AMA Style

Borkowska M, Kułakowski M, Myszka K. High-Resolution Melting Analysis Potential for Saccharomyces cerevisiae var. boulardii Authentication in Probiotic-Enriched Food Matrices. BioTech. 2024; 13(4):48. https://doi.org/10.3390/biotech13040048

Chicago/Turabian Style

Borkowska, Monika, Michał Kułakowski, and Kamila Myszka. 2024. "High-Resolution Melting Analysis Potential for Saccharomyces cerevisiae var. boulardii Authentication in Probiotic-Enriched Food Matrices" BioTech 13, no. 4: 48. https://doi.org/10.3390/biotech13040048

APA Style

Borkowska, M., Kułakowski, M., & Myszka, K. (2024). High-Resolution Melting Analysis Potential for Saccharomyces cerevisiae var. boulardii Authentication in Probiotic-Enriched Food Matrices. BioTech, 13(4), 48. https://doi.org/10.3390/biotech13040048

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop