Next Article in Journal
Towards Personalized Medicine Mediated by in Vitro Virus-Based Interactome Approaches
Previous Article in Journal
Functional Identification of Proteus mirabilis eptC Gene Encoding a Core Lipopolysaccharide Phosphoethanolamine Transferase
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 15
Issue 4
10.3390/ijms15046703
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma

by
Hee Nam Kim
1,
Nan Young Kim
2,
Li Yu
2,
Yeo-Kyeoung Kim
3,
Il-Kwon Lee
2,
Deok-Hwan Yang
3,
Je-Jung Lee
3,
Min-Ho Shin
1,4,
Kyeong-Soo Park
5,
Jin-Su Choi
4 and
Hyeoung-Joon Kim
2,3,*
1
Center for Creative Biomedical Scientists, Chonnam National University, Gwangju 501-746, Korea
2
Environmental Health Center for Childhood Leukemia and Cancer, Chonnam National University Hwasun Hospital, Jeollanamdo 519-763, Korea
3
Department of Hematology/Oncology, Chonnam National University Hwasun Hospital 160 Ilsim-ri, Hwasun-eup, Hwasun-gun, Jellanam-do 519-809, Korea
4
Department of Preventive Medicine, Chonnam National University Medical School, Gwangju 501-746, Korea
5
Department of Preventive Medicine, College of Medicine, Seonam University, Namwon 590-711, Korea
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2014, 15(4), 6703-6716; https://doi.org/10.3390/ijms15046703
Submission received: 3 March 2014 / Revised: 11 April 2014 / Accepted: 11 April 2014 / Published: 21 April 2014
(This article belongs to the Section Molecular Pathology, Diagnostics, and Therapeutics)
Versions Notes

Abstract

:
The damage caused by oxidative stress and exposure to cigarette smoke and alcohol necessitate DNA damage repair and transport by multidrug resistance-1 (MDR1). To explore the association between polymorphisms in these genes and non-Hodgkin lymphoma risk, we analyzed 15 polymorphisms of 12 genes in a population-based study in Korea (694 cases and 1700 controls). Four genotypes of DNA repair pathway genes (XRCC1 399 GA, OGG1 326 GG, BRCA1 871 TT, and WRN 787 TT) were associated with a decreased risk for NHL [odds ratio (OR)XRCC1 GA = 0.80, p = 0.02; OROGG1 GG = 0.70, p = 0.008; ORBRCA1 TT = 0.71, p = 0.048; ORWRN TT = 0.68, p = 0.01]. Conversely, the MGMT 115 CT genotype was associated with an increased risk for NHL (OR = 1.25, p = 0.04). In the MDR1 gene, the 1236 CC genotype was associated with a decreased risk for NHL (OR = 0.74, p = 0.04), and the 3435 CT and TT genotypes were associated with an increased risk (OR3435CT = 1.50, p < 0.0001; OR3435TT = 1.43, p = 0.02). These results suggest that polymorphisms in the DNA repair genes XRCC1, OGG1, BRCA1, WRN1, and MGMT and in the MDR1 gene may affect the risk for NHL in Korean patients.

1. Introduction

The occurrence of non-Hodgkin lymphoma (NHL) has increased steadily over the last few decades. Environmental exposure, such as tobacco, alcohol consumption and diet, family history, immune dysfunction, immune stimulation, and infection, have all been associated with the risk for NHL [1–5]. In addition, many studies have suggested that genetic variation also plays a role in the pathogenesis of NHL [6–10].
DNA damage induced by oxidative stress and exposure to environmental chemical carcinogens such as smoking and benzene is repaired via DNA repair pathways. Polymorphisms in genes encoding these pathways can decrease or increase DNA repair activity and subsequently, contribute to the progression of various cancers [11].
DNA repair plays a major role in maintaining genomic stability via several pathways. The base excision repair (BER) pathway repairs damaged bases or single-strand DNA breaks; nucleotide excision repair (NER) excises a variety of helix-distorting DNA lesions; and homologous recombination (HR) and non-homologous end joining (NHEJ) repair double-strand breaks and direct damage reversal. Several polymorphisms identified in genes of the BER pathway (XRCC1 and OGG1), NER pathway (ERCC1, XPC, and ERCC2/XPD), HR pathway (RAD51, BRCA1, XRCC3, and WRN), and NHEJ pathway (XRCC4 and MGMT) have been shown to be associated with risks for various cancers [7,10,12–15].
P-glycoprotein (P-gp), which is encoded by the human multidrug resistance-1 gene (MDR1, ABCB1), has a protective effect in cells [16,17]. As an ATP-dependent drug efflux pump, P-gp transports a wide variety of lipophilic compounds from inside to outside the cell [18–20]. Two synonymous polymorphisms, C1236T and C3435T, and one nonsynonymous polymorphism, G2677T/A, are the most common polymorphisms in the coding region of MDR1. These polymorphisms are associated with increased MDR1 mRNA expression levels [21–24].
Although several studies have reported associations between some polymorphisms in these genes and the risk for NHL [10,25–30], the results have not been consistent. To our knowledge there has been no report describing an association between MDR1 polymorphisms and the risk for NHL. In the present study, we investigated whether polymorphisms in DNA repair genes or MDR1 are associated with risk for 694 NHL and 378 diffuse large B-cell lymphoma (DLBCL) and 140 T-cell lymphoma subtype, by analyzing 15 polymorphisms in 12 genes (Table 1).

2. Results

The distribution of polymorphisms in the DNA repair genes and MDR1 (ABCB1) among the NHL cases and the controls are shown in Tables 2 and 3. The control genotype frequencies were within Hardy–Weinberg equilibrium and did not significantly differ between men and women (data not shown). The genotype frequencies of these polymorphisms except RAD51 rs1801321 by us were similar to HapMap project. There is no report of RAD51 rs1801321 in Asian population in HapMap project and the SNP500Cancer Database.
Among the DNA repair genes, the polymorphism genotypes XRCC1 399 GA and WRN 787 TT were associated with a decreased risk for NHL (odds ratio (OR)XRCC1 GA = 0.80, p = 0.02; ORWRN 787 TT = 0.68, p = 0.01). The OGG1 326 GG and BRCA1 871 TT genotypes were associated with a decreased risk for NHL (OROGG1 GG = 0.70, p = 0.008; ORBRCA1 TT = 0.71, p = 0.048), DLBCL (OROGG1 GG = 0.68, p = 0.02; ORBRCA1 TT = 0.62, p = 0.04), and T-cell lymphoma (OROGG1 GG = 0.59, p = 0.04; ORBRCA1 TT = 0.42, p = 0.04). Conversely, the MGMT 115 CT genotype was associated with an increased risk for NHL (OR = 1.25, p = 0.04) and DLBCL (OR = 1.37, p = 0.02).
For ABCB1 polymorphisms, the 1236 CC genotype was associated with a decreased risk for NHL (OR = 0.74, p = 0.04) and DLBCL (OR = 0.64, p = 0.02), whereas the 3435 CT genotype was associated with an increased risk for NHL (OR = 1.50, p < 0.0001), DLBCL (OR = 1.52, p = 0.01), and T-cell lymphoma (OR = 1.51, p = 0.03). Using subjects with the T-T-T haplotype of ABCB1 1236, 2677, and 3435 as a reference group, the C-G-C haplotype was associated with a decreased risk for NHL (OR = 0.83, p = 0.04) and DLBCL (OR = 0.77, p = 0.03), whereas the C-G-T haplotype was associated with an increased risk for NHL (OR = 1.67, p = 0.02) and T-cell lymphoma (OR = 2.48, p = 0.007). No association was found between any other polymorphism evaluated in the present study and the risk for NHL.

3. Discussion

In the present population-based case-control study, we investigated whether genetic polymorphisms in DNA repair genes and MDR1 were associated with the risk for developing NHL in a Korean population. For the DNA repair gene polymorphisms, the XRCC1 399 GA, OGG1 326 GG, BRCA1 871 TT, WRN 787 TT, and MGMT 115 CT genotypes were associated with the risk for NHL, as were the ABCB1 1236 CC and 3435 TT genotypes. The C-G-C, C-G-T, and T-G-T haplotypes of ABCB1 1236, 2677, and 3435 were significantly associated.
XRCC1, a central scaffolding protein for DNA ligase III [35], and OGG1, which encodes a DNA glycosylase that catalyzes the removal of 8-OH-Gua adducts [36,37], have been implicated in the BER system for the repair of damaged bases or single-strand DNA breaks. Previous studies suggest that XRCC1 Arg399Gln has been associated with higher levels of DNA adducts, and sister chromatid exchanges [12] and, thus, may lead to carcinogenesis. However, conversely with this hypothesis, our results showed that XRCC1 399 GA genotype was associated with a decreased risk for NHL, which is similar to a previous report from Australia [28]. The OGG1 326 GG genotype was associated with a decreased risk for NHL and DLBCL and T-cell subtype in this study. There is various evidence for OGG1 326Cys functional effect, such as lower DNA repair activity and the catalytic efficiency compared with 326Ser [38–40], or no difference in enzyme activity [41].
WRN and BRCA1 in the HR pathway are involved in recombination and the repair of double-strand breaks. Our result showed that the WRN 787 TT genotype was associated with a decreased risk of only NHL, and NHL including DLBCL and T-cell lymphoma for BRCA1 871 TT genotype. The WRN Leu787Leu polymorphism is a synonymous SNP and lies in the helicase domain of the WRN protein. The function of these polymorphisms is still unknown. Therefore, the biological function of these polymorphisms for the responsible effect on gene expression and linkage disequilibrium with the functional SNP should be investigated.
The product of MGMT (also known as AGT or ATase) in the DR pathway reverses O6-alkylation damage in DNA by transferring the alkyl group to a cysteine residue in the enzyme [42,43]. In the present study, MGMT 115 CT genotype was associated with a decreased risk for NHL and DLBCL. This finding is similar to that of Shen et al. [28]. The function of codon 115 in the MGMT gene is unknown [44,45], but, the possible effect of DNA guanine O6-alkylation damage by Leu115Phe may be due to a linkage between this variant and other functional variants [46,47].
Inconsistencies between our results and those of previous studies may be attributable to different frequencies of polymorphisms in different ethnicities, differences in sample sizes, or differences in environmental exposure.
Our result showed that ABCB1 1236 CC genotype was associated with a decreased risk, but, in contrast, ABCB1 3435 CT genotype was associated with an increased risk for NHL and DLBCL. The C-G-C haplotype was associated with a decreased risk for NHL and DLBCL, whereas the C-G-T haplotype was associated with an increased risk for NHL and T-cell lymphoma. Function of the C1236T was still unknown, while various effects of the ABCB1 C3435T and G2677T/A polymorphisms have been observed, such as increased mRNA levels or no effect [21–24], silent C3435T polymorphism-altered P-gp activity [48–51], and reduced activity [52]. Several reports have suggested that these results may due to linkage disequilibrium with the 3435 and 2677 polymorphisms [24,33], allele-specific differences in mRNA folding [53,54], or numerous environmental factors [55].
However, this study has some imitations. These selected SNPs could not represent each gene, and functional analysis of these polymorphisms was not fully characterized. Moreover, the environmental factors were not considered. Due to the limitation of the power to detect associations, multiple comparisons were not considered in the present analysis. Thus, although some genotypes showed associations, there may be some false-positive associations. Future epidemiological studies with larger sample sizes stratified by other environmental factors such as lifestyle and chemical exposure are also necessary to confirm our findings.

4. Experimental Section

4.1. Study Population

The patients enrolled in this study were adults aged ≥15 years who had been diagnosed with NHL at Chonnam National University Hospital, Hwasun-gun, Korea between January 1997 and June 2008. There were 694 NHL cases, consisting of 420 men and 274 women, with a mean age of 55.4 ± 14.8 years (range, 15–89 years). 694 NHL cases consisted of 378 DLBCL, 140 T-cell lymphomas and 176 other lymphomas. 378 DLBCL were included only diffuse large B-cell lymphoma. 140 T-cell lymphomas consisted of peripheral T-cell lymphoma-unspecified, extranodal natural killer cell/T-cell lymphoma, anaplastic large cell lymphoma, angioimmunoblastic T-cell lymphoma, T-cell type lymphoblastic lymphoma and cutaneous T-cell NHL. 176 other lymphomas were included all other subtypes including follicular lymphoma, except Hodgkin disease.
The control group (n = 1700) was randomly selected from the general population in the same geographical areas as the cases and was composed of participants in the Thyroid Disease Prevalence Study, which was performed in the Yeonggwang and Muan counties of Jeollanam-do Province and Namwon City of Jeollabuk-do Province, Korea, from July 2004 to January 2006. A total of 4018 subjects (mean age, 50.6 ± 14.6 years; range, 20–74 years) were randomly selected by a 5-year age strata and gender. Of these, 3486 were eligible for this study. Among the eligible patients, 1700 (48.8% of the eligible subjects; 821 men and 879 women; mean age, 52.2 ± 14.3 years) underwent clinical examinations. At the time of peripheral blood collection, all cases and control subjects provided informed consent to participate in this study.
The NHL cases for this study were provided by the Chonnam National University Hwasun Hospital National Biobank of Korea, a member of the National Biobank of Korea, which is supported by the Ministry of Health, Welfare and Family Affairs. This study was approved by the Institutional Review Board of the Chonnam National University Hwasun Hospital in Hwasun, Korea.

4.2. Genotyping

Genomic DNA was extracted from peripheral blood using a QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol. Genotyping to analyze polymorphisms was performed using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) analysis, Simplex Pyrosequencing assays, high-resolution melt (HRM) analysis, and electrophoresis methods. Table 1 shows the primer sequences, methods, and references applied in this study. The Simplex Pyrosequencing assay was performed as previously described [8]. Specific primers and the sequencing primer were designed using Pyrosequencing SNP primer design software (v1.0.6, Biotage, Uppsala, Sweden). HRM genotyping was performed in 10-μL reaction volumes with 200 nM PCR primer, 1 μM Syto 9 fluorescent dye, 0.5 U f-Taq polymerase, and 40 ng of genomic DNA, using a Rotor-Gene 6000 high-resolution melter (Corbett Research, Sydney, Australia). RFLP genotyping was performed using the appropriate primers and restriction enzymes (Table 1).
Quality control (QC) for each genotyping, 96 samples of each genotyping assay were identified in 100% concordance by sequencing and 40 replicate samples were repeated with 100% compliance.

4.3. Statistical Analysis

The statistical significance of differences between the patient and control groups was estimated by logistic regression analysis. Control group was compared with DLBCL and T-cell lymphoma as well as NHL separately. The expected frequency of control genotypes was evaluated using the Hardy-Weinberg equilibrium test. Adjusted odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using logistic regression models with adjustments for age and gender, to estimate the association between each genotype and NHL. Subjects with wild-type genotypes were considered to represent the baseline risk. Haplotype frequencies for ABCB1 were evaluated using PHASE v2.1 software based on the Bayesian inference algorithm ( http://stephenslab.uchicago.edu/software.html) [56]. Analyses were performed using SPSS software version 11.0 (SPSS, Chicago, IL, USA).

5. Conclusions

In the present study, we investigated the XRCC1 399 GA, OGG1 326 GG, BRCA1 871 TT, WRN 787 TT, and the ABCB1 1236 CC genotypes were associated with a decreased risk for NHL. Conversely, the MGMT 115 CT and ABCB1 3435 CT and TT genotypes were associated with an increased risk for NHL. Our results suggest that polymorphisms in the DNA repair genes XRCC1, OGG1, BRCA, WRN1, and MGMT and in MDR1 may affect the risk for NHL in Korean patients.

Acknowledgments

This study was supported by a grant from Environmental Health Center for Childhood Leukemia and Cancer.
  • Author ContributionsH.N.K. interpreted the results and wrote the paper. N.Y.K., I.-K.L. and L.Y. designed methods and performed all experiments. K.-S.P., J.-S.C. and M.-H.S. supported control samples and statistical analysis. Y.-K.K., D.-H.Y. and J.-J.L. participated in the data collect and their interpretation. H.-J.K. discussed analyses, interpretation and supervised the project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chiu, B.C.; Weisenburger, D.D.; Zahm, S.H.; Cantor, K.P.; Gapstur, S.M.; Holmes, F.; Burmeister, L.F.; Blair, A. Agricultural pesticide use, familial cancer, and risk of non-Hodgkin lymphoma. Cancer Epidemiol. Biomark. Prev 2004, 13, 525–531. [Google Scholar]
  2. Grulich, A.E.; Vajdic, C.M.; Cozen, W. Altered immunity as a risk factor for non-Hodgkin lymphoma. Cancer Epidemiol. Biomark. Prev 2007, 16, 405–408. [Google Scholar]
  3. Morton, L.M.; Hartge, P.; Holford, T.R.; Holly, E.A.; Chiu, B.C.; Vineis, P.; Stagnaro, E.; Willett, E.V.; Franceschi, S.; la Vecchia, C.; et al. Cigarette smoking and risk of non-Hodgkin lymphoma: A pooled analysis from the International Lymphoma Epidemiology Consortium (interlymph). Cancer Epidemiol. Biomark. Prev 2005, 14, 925–933. [Google Scholar]
  4. Morton, L.M.; Zheng, T.; Holford, T.R.; Holly, E.A.; Chiu, B.C.; Costantini, A.S.; Stagnaro, E.; Willett, E.V.; dal Maso, L.; Serraino, D.; et al. Alcohol consumption and risk of non-Hodgkin lymphoma: A pooled analysis. Lancet Oncol 2005, 6, 469–476. [Google Scholar]
  5. Nieters, A.; Deeg, E.; Becker, N. Tobacco and alcohol consumption and risk of lymphoma: Results of a population-based case-control study in Germany. Int. J. Cancer 2006, 118, 422–430. [Google Scholar]
  6. De Roos, A.J.; Gold, L.S.; Wang, S.; Hartge, P.; Cerhan, J.R.; Cozen, W.; Yeager, M.; Chanock, S.; Rothman, N.; Severson, R.K. Metabolic gene variants and risk of non-Hodgkin’s lymphoma. Cancer Epidemiol. Biomark. Prev 2006, 15, 1647–1653. [Google Scholar]
  7. Dogru-Abbasoglu, S.; Aykac-Toker, G.; Hanagasi, H.A.; Gurvit, H.; Emre, M.; Uysal, M. The Arg194Trp polymorphism in DNA repair gene XRCC1 and the risk for sporadic late-onset Alzheimer’s disease. Neurol. Sci 2007, 28, 31–34. [Google Scholar]
  8. Kim, H.N.; Lee, I.K.; Kim, Y.K.; Tran, H.T.; Yang, D.H.; Lee, J.J.; Shin, M.H.; Park, K.S.; Shin, M.G.; Choi, J.S.; et al. Association between folate-metabolizing pathway polymorphism and non-Hodgkin lymphoma. Br. J. Haematol 2008, 140, 287–294. [Google Scholar]
  9. Purdue, M.P.; Lan, Q.; Kricker, A.; Grulich, A.E.; Vajdic, C.M.; Turner, J.; Whitby, D.; Chanock, S.; Rothman, N.; Armstrong, B.K. Polymorphisms in immune function genes and risk of non-Hodgkin lymphoma: Findings from the New South Wales non-Hodgkin Lymphoma Study. Carcinogenesis 2007, 28, 704–712. [Google Scholar]
  10. Shen, M.; Zheng, T.; Lan, Q.; Zhang, Y.; Zahm, S.H.; Wang, S.S.; Holford, T.R.; Leaderer, B.; Yeager, M.; Welch, R.; et al. Polymorphisms in DNA repair genes and risk of non-Hodgkin lymphoma among women in Connecticut. Hum. Genet 2006, 119, 659–668. [Google Scholar]
  11. Mohrenweiser, H.W.; Jones, I.M. Variation in DNA repair is a factor in cancer susceptibility: A paradigm for the promises and perils of individual and population risk estimation? Mutat. Res 1998, 400, 15–24. [Google Scholar]
  12. Duell, E.J.; Wiencke, J.K.; Cheng, T.J.; Varkonyi, A.; Zuo, Z.F.; Ashok, T.D.; Mark, E.J.; Wain, J.C.; Christiani, D.C.; Kelsey, K.T. Polymorphisms in the DNA repair genes XRCC1 and ERCC2 and biomarkers of DNA damage in human blood mononuclear cells. Carcinogenesis 2000, 21, 965–971. [Google Scholar]
  13. Jamroziak, K.; Balcerczak, E.; Cebula, B.; Janus, A.; Mirowski, M.; Robak, T. No influence of 3435C>T ABCB1 (MDR1) gene polymorphism on risk of adult acute myeloid leukemia and P-glycoprotein expression in blast cells. Ther. Drug Monit 2006, 28, 707–711. [Google Scholar]
  14. Janssen, K.; Schlink, K.; Gotte, W.; Hippler, B.; Kaina, B.; Oesch, F. DNA repair activity of 8-oxoguanine DNA glycosylase 1 (OGG1) in human lymphocytes is not dependent on genetic polymorphism Ser326/Cys326. Mutat. Res 2001, 486, 207–216. [Google Scholar]
  15. Krupa, R.; Blasiak, J. An association of polymorphism of DNA repair genes XRCC1 and XRCC3 with colorectal cancer. J. Exp. Clin. Cancer Res 2004, 23, 285–294. [Google Scholar]
  16. Borst, P.; Evers, R.; Kool, M.; Wijnholds, J. A family of drug transporters: The multidrug resistance-associated proteins. J. Natl. Cancer Inst 2000, 92, 1295–1302. [Google Scholar]
  17. Ueda, K.; Cornwell, M.M.; Gottesman, M.M.; Pastan, I.; Roninson, I.B.; Ling, V.; Riordan, J.R. The MDR1 gene, responsible for multidrug-resistance, codes for P-glycoprotein. Biochem. Biophys. Res. Commun 1986, 141, 956–962. [Google Scholar]
  18. Ambudkar, S.V.; Dey, S.; Hrycyna, C.A.; Ramachandra, M.; Pastan, I.; Gottesman, M.M. Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu. Rev. Pharmacol. Toxicol 1999, 39, 361–398. [Google Scholar]
  19. Sarkadi, B.; Muller, M.; Homolya, L.; Hollo, Z.; Seprodi, J.; Germann, U.A.; Gottesman, M.M.; Price, E.M.; Boucher, R.C. Interaction of bioactive hydrophobic peptides with the human multidrug transporter. FASEB J 1994, 8, 766–770. [Google Scholar]
  20. Sharom, F.J.; Yu, X.; DiDiodato, G.; Chu, J.W. Synthetic hydrophobic peptides are substrates for P-glycoprotein and stimulate drug transport. Biochem. J 1996, 320, 421–428. [Google Scholar]
  21. Wang, D.; Sadee, W. Searching for polymorphisms that affect gene expression and mRNA processing: Example ABCB1 (MDR1). AAPS J 2006, 8, E515–E520. [Google Scholar]
  22. Nakamura, T.; Sakaeda, T.; Horinouchi, M.; Tamura, T.; Aoyama, N.; Shirakawa, T.; Matsuo, M.; Kasuga, M.; Okumura, K. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects. Clin. Pharmacol. Ther 2002, 71, 297–303. [Google Scholar]
  23. Siegmund, W.; Ludwig, K.; Giessmann, T.; Dazert, P.; Schroeder, E.; Sperker, B.; Warzok, R.; Kroemer, H.K.; Cascorbi, I. The effects of the human MDR1 genotype on the expression of duodenal P-glycoprotein and disposition of the probe drug talinolol. Clin. Pharmacol. Ther 2002, 72, 572–583. [Google Scholar]
  24. Kim, R.B.; Leake, B.F.; Choo, E.F.; Dresser, G.K.; Kubba, S.V.; Schwarz, U.I.; Taylor, A.; Xie, H.G.; McKinsey, J.; Zhou, S.; et al. Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin. Pharmacol. Ther 2001, 70, 189–199. [Google Scholar]
  25. Hill, D.A.; Wang, S.S.; Cerhan, J.R.; Davis, S.; Cozen, W.; Severson, R.K.; Hartge, P.; Wacholder, S.; Yeager, M.; Chanock, S.J.; et al. Risk of non-Hodgkin lymphoma (NHL) in relation to germline variation in DNA repair and related genes. Blood 2006, 108, 3161–3167. [Google Scholar]
  26. Smedby, K.E.; Lindgren, C.M.; Hjalgrim, H.; Humphreys, K.; Schollkopf, C.; Chang, E.T.; Roos, G.; Ryder, L.P.; Falk, K.I.; Palmgren, J.; et al. Variation in DNA repair genes ERCC2, XRCC1, and XRCC3 and risk of follicular lymphoma. Cancer Epidemiol. Biomark. Prev 2006, 15, 258–265. [Google Scholar]
  27. Wang, S.S.; Davis, S.; Cerhan, J.R.; Hartge, P.; Severson, R.K.; Cozen, W.; Lan, Q.; Welch, R.; Chanock, S.J.; Rothman, N. Polymorphisms in oxidative stress genes and risk for non-Hodgkin lymphoma. Carcinogenesis 2006, 27, 1828–1834. [Google Scholar]
  28. Shen, M.; Purdue, M.P.; Kricker, A.; Lan, Q.; Grulich, A.E.; Vajdic, C.M.; Turner, J.; Whitby, D.; Chanock, S.; Rothman, N.; et al. Polymorphisms in DNA repair genes and risk of non-Hodgkin’s lymphoma in New South Wales, Australia. Haematologica 2007, 92, 1180–1185. [Google Scholar]
  29. Shen, M.; Menashe, I.; Morton, L.M.; Zhang, Y.; Armstrong, B.; Wang, S.S.; Lan, Q.; Hartge, P.; Purdue, M.P.; Cerhan, J.R.; et al. Polymorphisms in DNA repair genes and risk of non-Hodgkin lymphoma in a pooled analysis of three studies. Br. J. Haematol 2010, 151, 239–244. [Google Scholar]
  30. Kim, I.S.; Kim, D.C.; Kim, H.G.; Eom, H.S.; Kong, S.Y.; Shin, H.J.; Hwang, S.H.; Lee, E.Y.; Kim, S.; Lee, G.W. DNA repair gene XRCC1 polymorphisms and haplotypes in diffuse large B-cell lymphoma in a Korean population. Cancer Genet. Cytogenet 2010, 196, 31–37. [Google Scholar]
  31. Hu, J.J.; Smith, T.R.; Miller, M.S.; Mohrenweiser, H.W.; Golden, A.; Case, L.D. Amino acid substitution variants of APE1 and XRCC1 genes associated with ionizing radiation sensitivity. Carcinogenesis 2001, 22, 917–922. [Google Scholar]
  32. Huo, X.; Lu, C.; Huang, X.; Hu, Z.; Jin, G.; Ma, H.; Wang, X.; Qin, J.; Shen, H.; Tang, J. Polymorphisms in BRCA1, BRCA1-interacting genes and susceptibility of breast cancer in Chinese women. J. Cancer Res. Clin. Oncol 2009, 135, 1569–1575. [Google Scholar]
  33. Tang, K.; Ngoi, S.M.; Gwee, P.C.; Chua, J.M.; Lee, E.J.; Chong, S.S.; Lee, C.G. Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations. Pharmacogenetics 2002, 12, 437–450. [Google Scholar]
  34. Ameyaw, M.M.; Regateiro, F.; Li, T.; Liu, X.; Tariq, M.; Mobarek, A.; Thornton, N.; Folayan, G.O.; Githang’a, J.; Indalo, A.; et al. MDR1 pharmacogenetics: Frequency of the C3435T mutation in exon 26 is significantly influenced by ethnicity. Pharmacogenetics 2001, 11, 217–221. [Google Scholar]
  35. Masson, M.; Niedergang, C.; Schreiber, V.; Muller, S.; Menissier-de Murcia, J.; de Murcia, G. XRCC1 is specifically associated with poly(ADP-ribose) polymerase and negatively regulates its activity following DNA damage. Mol. Cell. Biol 1998, 18, 3563–3571. [Google Scholar]
  36. Boiteux, S.; Radicella, J.P. The human OGG1 gene: Structure, functions, and its implication in the process of carcinogenesis. Arch. Biochem. Biophys 2000, 377, 1–8. [Google Scholar]
  37. Sunaga, N.; Kohno, T.; Shinmura, K.; Saitoh, T.; Matsuda, T.; Saito, R.; Yokota, J. OGG1 protein suppresses G:C→T:A mutation in a shuttle vector containing 8-hydroxyguanine in human cells. Carcinogenesis 2001, 22, 1355–1362. [Google Scholar]
  38. Chen, A.; Kleiman, F.E.; Manley, J.L.; Ouchi, T.; Pan, Z.Q. Auto-ubiquitination of the BRCA1/BARD1 RING ubiquitin ligase. J. Biol. Chem 2002, 277, 22085–22092. [Google Scholar]
  39. Dherin, C.; Radicella, J.P.; Dizdaroglu, M.; Boiteux, S. Excision of oxidatively damaged DNA bases by the human α-hOgg1 protein and the polymorphic α-hOgg1(Ser326Cys) protein which is frequently found in human populations. Nucleic Acids Res 1999, 27, 4001–4007. [Google Scholar]
  40. Kohno, T.; Shinmura, K.; Tosaka, M.; Tani, M.; Kim, S.R.; Sugimura, H.; Nohmi, T.; Kasai, H.; Yokota, J. Genetic polymorphisms and alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene 1998, 16, 3219–3225. [Google Scholar]
  41. Blessing, H.; Kraus, S.; Heindl, P.; Bal, W.; Hartwig, A. Interaction of selenium compounds with zinc finger proteins involved in DNA repair. Eur. J. Biochem 2004, 271, 3190–3199. [Google Scholar]
  42. Kaina, B.; Christmann, M.; Naumann, S.; Roos, W.P. MGMT: Key node in the battle against genotoxicity, carcinogenicity and apoptosis induced by alkylating agents. DNA Repair 2007, 6, 1079–1099. [Google Scholar]
  43. Pegg, A.E.; Fang, Q.; Loktionova, N.A. Human variants of O6-alkylguanine-DNA alkyltransferase. DNA Repair 2007, 6, 1071–1078. [Google Scholar]
  44. Inoue, R.; Abe, M.; Nakabeppu, Y.; Sekiguchi, M.; Mori, T.; Suzuki, T. Characterization of human polymorphic DNA repair methyltransferase. Pharmacogenetics 2000, 10, 59–66. [Google Scholar]
  45. Cohet, C.; Borel, S.; Nyberg, F.; Mukeria, A.; Bruske-Hohlfeld, I.; Constantinescu, V.; Benhamou, S.; Brennan, P.; Hall, J.; Boffetta, P. Exon 5 polymorphisms in the O6-alkylguanine DNA alkyltransferase gene and lung cancer risk in non-smokers exposed to second-hand smoke. Cancer Epidemiol. Biomark. Prev 2004, 13, 320–323. [Google Scholar]
  46. Heighway, J.; Margison, G.P.; Santibanez-Koref, M.F. The alleles of the DNA repair gene O6-alkylguanine-DNA alkyltransferase are expressed at different levels in normal human lung tissue. Carcinogenesis 2003, 24, 1691–1694. [Google Scholar]
  47. Krzesniak, M.; Butkiewicz, D.; Samojedny, A.; Chorazy, M.; Rusin, M. Polymorphisms in TDG and MGMT genes—Epidemiological and functional study in lung cancer patients from Poland. Ann. Hum. Genet 2004, 68 Pt 4, 300–312. [Google Scholar]
  48. Ambudkar, S.V.; Kimchi-Sarfaty, C.; Sauna, Z.E.; Gottesman, M.M. P-glycoprotein: From genomics to mechanism. Oncogene 2003, 22, 7468–7485. [Google Scholar]
  49. Drescher, S.; Schaeffeler, E.; Hitzl, M.; Hofmann, U.; Schwab, M.; Brinkmann, U.; Eichelbaum, M.; Fromm, M.F. MDR1 gene polymorphisms and disposition of the P-glycoprotein substrate fexofenadine. Br. J. Clin. Pharmacol 2002, 53, 526–534. [Google Scholar]
  50. Goto, M.; Masuda, S.; Saito, H.; Uemoto, S.; Kiuchi, T.; Tanaka, K.; Inui, K. C3435T polymorphism in the MDR1 gene affects the enterocyte expression level of CYP3A4 rather than P-gp in recipients of living-donor liver transplantation. Pharmacogenetics 2002, 12, 451–457. [Google Scholar]
  51. Hoffmeyer, S.; Burk, O.; von Richter, O.; Arnold, H.P.; Brockmoller, J.; Johne, A.; Cascorbi, I.; Gerloff, T.; Roots, I.; Eichelbaum, M.; et al. Functional polymorphisms of the human multidrug-resistance gene: Multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 3473–3478. [Google Scholar]
  52. Salama, N.N.; Yang, Z.; Bui, T.; Ho, R.J. MDR1 haplotypes significantly minimize intracellular uptake and transcellular P-gp substrate transport in recombinant LLC-PK1 cells. J. Pharm. Sci 2006, 95, 2293–2308. [Google Scholar]
  53. Shen, L.X.; Basilion, J.P.; Stanton, V.P., Jr. Single-nucleotide polymorphisms can cause different structural folds of mRNA. Proc. Natl. Acad. Sci. USA 1999, 96, 7871–7876. [Google Scholar]
  54. Frittitta, L.; Ercolino, T.; Bozzali, M.; Argiolas, A.; Graci, S.; Santagati, M.G.; Spampinato, D.; di Paola, R.; Cisternino, C.; Tassi, V.; et al. A cluster of three single nucleotide polymorphisms in the 3′-untranslated region of human glycoprotein PC-1 gene stabilizes PC-1 mRNA and is associated with increased PC-1 protein content and insulin resistance-related abnormalities. Diabetes 2001, 50, 1952–1955. [Google Scholar]
  55. Perloff, M.D.; von Moltke, L.L.; Stormer, E.; Shader, R.I.; Greenblatt, D.J. Saint John’s wort: An in vitro analysis of P-glycoprotein induction due to extended exposure. Br. J. Pharmacol 2001, 134, 1601–1608. [Google Scholar]
  56. Stephens, M.; Smith, N.J.; Donnelly, P. A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet 2001, 68, 978–989. [Google Scholar]
Table
Table 1. Primer sequences and genotyping methods.
Table 1. Primer sequences and genotyping methods.
Gene and rs No.GenotypePrimers and probeMethodReference
DNA repair pathway
ERCC1 rs3212961A/C, IVS5 +33F: TTGTCCAGGTGGATGTGGTA
R: CCTCGCTGAGGTTTTAGCTG		HRM
ERCC2/XPD rs13181G/T, Lys751GlnF: TCAAACATCCTGTCCCTACT
R: CTGCGATTAAAGGCTGTGGA		RFLP: PstI
XPC rs2228001A/C, Lys939GlnF: CCTCAAAACCGAGAAGATGAAG
R: CAGGTGTGGGGCCTGTAGT		HRM
XRCC3 rs861539C/T, Thr241MetF: CCATTCCGCTGTGAATTTG
R: GAAGGCACTGCTCAGCTCAC		HRM
RAD51 rs1801321G/T, 172 in 5′-UTRF: GTAGAGAAGTGGAGCGTAAGCC
R: Biotin-CTGCGCCTCACACACTCA
S: GGGGGCCGTGCGGGT		PSQ
XRCC4 rs1056503G/T, Ser307SerF: AGGCCTGATTCTTCACTACCTG
R: GGCTGCTGTTTCTCAGAGTTTC		HRM
XRCC1 rs1799782C/T, Arg194TrpF: ATAATACTGACCTTGCGGGACC
R: Biotin-ACCCACGAGTCTAGGTCTCAA
S: CTGAGGCCGGGGGCT		PSQ
XRCC1 rs25487G/A, Arg399GlnF: TCTCCCTTGGTCTCCAACCT
R: AGTAGTCTGCTGGCTCTGG		RFLP: HpaII[31]
OGG1 rs1052133C/G, Ser326CysF: CCCTCCTACAGGTGCTGTTC
R: TGGGGAATTTCTTTGTCCAG		HRM
MGMT rs12917C/T, Leu115PheF: Biotin-CCCCTGTTCTCACTTTTGCA
R: ACTGTGATGTCAGCGATCGTTAAT
S: AAACGGGATGGTGAA		PSQ
BRCA1 rs799917C/T, Pro871LeuF: CCACAGTCGGGAAACAAGCATAGA
R: CTTCTGCATTTCCTGGATTTGAAACC		RFLP: HpaII[32]
WRN rs1800392G/T, Leu787LeuF: TGGGAATTTGAAGGTCCAAC
R: GCATGGTATGTTCCACAGGA		HRM
Multidrug resistance
ABCB1 rs11285031236, T/C, Gly412GlyF: TCTTTGTCAC TTTATCCAGC
R: TCTCACCATC CCCTCTGT		RFLP: EcoO191I[33]
ABCB1 rs20325822677, G/T/A, Ser893Thr/AlaF: TGCAGGCTATAGGTTCCAGG
R: TTTAGTTTGACTCACCTTCCCG		RFLP: Ban1, Rsa1[34]
ABCB1 rs10456823435, C/T, Ile1145 IleF: GAGCCCATCCTGTTTGACTG
R: AGAGAGGCTGCCACATGCT		RFLP: Mbo1[34]
PSQ: Pyrosequencing; HRM: High-resolution melter; RFLP: Restriction fragment length polymorphism.
Table
Table 2. Association between polymorphisms in DNA repair pathway and risk of non-Hodgkin lymphoma (NHL).
Table 2. Association between polymorphisms in DNA repair pathway and risk of non-Hodgkin lymphoma (NHL).
SNP §Genotype/ HaplotypeControl n (%)NHLDLBCLT-cell lymphoma
n (%)OR * (95% CI)pn (%)OR * (95% CI)pn (%)OR * (95% CI)p
ERCC1AA440 (26)153 (23)179 (22)134 (25)1
IVS5 +33C>AAC863 (51)356 (54)1.20 (0.96–1.50)0.12193 (53)1.26 (0.95–1.69)0.1172 (54)1.08 (0.71–1.66)0.71
rs3212961CC395 (23)156 (23)1.14 (0.88–1.48)0.3389 (25)1.28 (0.91–1.79)0.1628 (21)0.91 (0.54–1.54)0.73
AC/CC1258 (74)512 (77)1.18 (0.95–1.46)0.13282 (78)1.27 (0.96–1.67)0.09100 (75)1.03 (0.69–1.540.89
ERCC2/XPDGG1516 (89)622 (90)1342 (91)1127 (90)1
Lys751GlnGT179 (11)65 (9)0.91 (0.68–1.24)0.5631 (8)0.81 (0.54–1.21)0.3112 (8)0.79 (0.43–1.45)0.44
rs13181TT5 (0)6 (1)3.22 (0.98–10.62)0.064 (1)3.67 (0.96–14.03)0.061 (1)2.30 (0.26–20.29)0.45
GT/TT184 (11)71 (10)0.97 (0.73–1.31)0.8635 (9)0.89 (0.61–1.31)0.5613 (9)0.83 (0.46–1.50)0.53
XPCAA650 (38)271 (39)1143 (38)161 (44)1
Lys939GlnAC812 (48)341 (49)1.02 (0.84–1.23)0.87186 (49)1.05 (0.82–1.34)0.7061 (44)0.80 (0.55–1.16)0.24
rs2228001CC238 (14)81 (12)0.83 (0.62–1.11)0.2048 (13)0.96 (0.67–1.39)0.8418 (12)0.79 (0.46–1.37)0.40
AC/CC1050 (62)422 (62)0.97 (0.81–1.17)0.77234 (62)1.03 (0.82–1.30)0.8079 (56)0.97 (0.81–1.17)0.77
XRCC3CC1573 (93)635 (92)1343 (92)1129 (93)1
Thr241MetCT122 (7)53 (8)1.14 (0.81–1.60)0.4631 (8)1.27 (0.84–1.94)0.2610 (1)1.04 (0.53–2.03)0.91
rs861539TT2 (0)1 (0.1)1.23 (0.11–13.69)0.870 (0)0.00 (0.00–0.00)0.990 (0)0.00 (0.00–0.00)0.99
CT/TT124 (7)54 (8)1.14 (0.81–1.59)0.4531 (8)1.25 (0.82–1.90)0.3010 (1)1.02 (0.52–2.00)0.95
RAD51GG1569 (92)651 (94)1351 (93)1132 (94)1
172 in 5′-UTRGT129 (8)43 (6)0.82 (0.57–1.17)0.2727 (7)0.97 (0.63–1.51)0.908 (6)0.44 (0.36–1.56)0.44
rs1801321TT2 (0)0 (0)NA0 (0)NA0 (0)NA
GT/TT131 (8)43 (6)0.81 (0.56–1.16)0.2427 (7)0.96 (0.62–1.49)0.868 (6)0.74 (0.35–1.54)0.42
XRCC4GG916 (54)391 (56)1214 (57)177 (55)1
Ser307SerGT658 (39)242 (35)0.87 (0.72–1.05)0.15129 (34)0.85 (0.67–1.08)0.1951 (36)0.93 (0.64–1.35)0.71
rs1056503TT124 (7)61 (9)1.11 (0.80–1.55)0.5335 (9)1.17 (0.78–1.77)0.4512 (9)1.09 (0.57–2.06)0.80
GT/TT782 (46)303 (44)0.91 (0.76–1.09)0.30164 (43)0.90 (0.72–1.13)0.3763 (45)0.96 (0.68–1.36)0.81
XRCC1CC776 (46)294 (43)1156 (42)163 (45)1
Arg194TrpCT741 (44)318 (46)1.13 (0.93–1.36)0.21176 (47)1.17 (0.92–1.50)0.1963 (45)1.05 (0.73–1.51)0.81
rs1799782TT164 (10)77 (11)1.22 (0.90–1.66)0.2043 (11)1.28 (0.87–1.87)0.2114 (10)1.05 (0.57–1.92)0.87
CT/TT905 (54)395 (57)1.15 (0.96–1.38)0.13219 (58)1.19 (0.95–1.50)0.1377 (55)1.05 (0.74–1.48)0.80
XRCC1GG914 (54)410 (59)1223 (59)180 (57)1
Arg399GlnGA693 (41)247 (36)0.80 (0.66–0.96)0.02136 (36)0. 82 (0.65–1.04)0.1051 (37)0. 83 (0.57–1.20)0.31
rs25487AA91 (5)36 (5)0.92 (0.61–1.38)0.6718 (5)0.83 (0.49–1.42)0.509 (6)1.15 (0.56–2.38)0.70
GA/AA784 (46)383 (41)0.81 (0.68–0.97)0.02154 (41)0.82 (0.65–1.03)0.0960 (43)0.87 (0.61–1.23)0.42
OGG1CC472 (28)226 (33)1126 (33)149 (35)1
Ser326CySCG863 (51)339 (49)0.81 (0.66–1.00)0.048184 (49)0.79 (0.61–1.02)0.0768 (49)0.76 (0.52–1.12)0.16
rs1052133GG365 (21)123 (18)0.70 (0.54–0.91)0.00867 (18)0.68 (0.49–0.95)0.0222 (16)0.59 (0.35–0.99)0.04
CG/GG1228 (72)462 (67)0.78 (0.64–0.95)0.01251 (67)0.75 (0.59–0.96)0.0290 (65)0.71 (0.49–1.02)0.06
MGMTCC1327 (78)517 (75)1276 (73)1103 (74)1
Leu115PheCT350 (21)167 (24)1.25 (1.01–1.54)0.0498 (26)1.37 (1.05–1.79)0.0232 (23)1.22 (0.80–1.85)0.35
rs12917TT23 (1)9 (1)1.02 (0.46–2.24)0.974 (1)0.87 (0.29–2.58)0.804 (3)2.53 (0.85–7.51)0.10
CT/TT373 (22)176 (25)1.23 (1.00–1.52)0.05176 (25)1.34 (1.04–1.74)0.0336 (26)1.29 (0.87–1.93)0.21
BRCA1CC828 (49)364 (53)1207 (55)175 (54)1
Pro871LeuCT715 (42)273 (40)0.87 (0.72–1.05)0.13145 (38)0.81 (0.64–1.03)0.0857 (41)0.90 (0.63–1.29)0.56
rs799917TT157 (9)50 (7)0.71 (0.50–0.997)0.04825 (7)0.62 (0.39–0.97)0.046 (4)0.42 (0.18–0.97)0.04
CT/TT872 (51)323 (47)0.84 (0.70–1.00)0.05170 (45)0.77 (0.62–0.97)0.0363 (45)0.81 (0.57–1.15)0.24
WRNGG558 (33)245 (36)1133 (35)148 (34)1
Leu787LeuGT846 (50)359 (52)0.98 (0.80–1.19)0.81196 (52)1.00 (0.78–1.29)0.9976 (55)1.03 (0.71–1.51)0.86
rs1800392TT296 (17)85 (12)0.68 (0.51–0.91)0.0148 (13)0.73 (0.50–1.05)0.0915 (11)0.60 (0.33–1.09)0.09
GT/TT1142 (67)444 (64)0.90 (0.75–1.09)0.28244 (65)0.93 (0.73–1.18)0.5691 (66)0.80 (0.56–1.13)0.21
§SNP; single nucleotide polymorphism;
*ORs and 95% CIs were estimated using multiple logistic regression and adjusted for sex and age.
Table
Table 3. Associations between polymorphisms in MDR1 and the risk for NHL.
Table 3. Associations between polymorphisms in MDR1 and the risk for NHL.
SNPGenotype/HaplotypeControl n (%)NHLDLBCLT-cell lymphoma
n (%)OR * (95% CI)pn (%)OR * (95% CI)pn (%)OR * (95% CI)p
ABCB1 1236TT580 (34)234 (34)1139 (37)144 (32)1
Gly412GlyTC825 (49)367 (53)1.11 (0.91–1.36)0.29193 (51)1.00 (0.78–1.28)0.9874 (53)1.18 (0.80–1.74)0.41
rs1128503CC295 (17)87 (13)0.74 (0.56–0.98)0.0444 (12)0.64 (0.44–0.93)0.0221 (15)0.93 (0.54–1.60)0.80
TT/CC1120 (66)454 (66)1.01 (0.84–1.22)0.89237 (63)0.90 (0.71–1.14)0.3995 (68)1.11 (0.77–1.62)0.57
ABCB1 2677GG323 (19)131 (19)164 (17)129 (21)1
Ser893 Thr/AlaGW †886 (52)340 (50)0.96 (0.75–1.22)0.74189 (51)1.10 (0.81–1.51)0.5469 (50)0.86 (0.55–1.35)0.51
rs2032582WW488 (29)210 (31)1.07 (0.82–1.39)0.61115 (31)1.21 (0.86–1.71)0.2741 (29)0.92 (0.56–1.51)0.74
GW/WW1374 (81)550 (81)1.00 (0.80–1.26)0.99304 (82)1.14 (0.85–1.54)0.39110 (79)0.88 (0.57–1.35)0.56
ABCB1 3435CC708 (42)234 (34)1128 (34)146 (33)1
Ile1145 IleCT800 (47)377 (54)1.50 (1.23–1.82)<0.0001210 (56)1.52 (1.19–1.94)0.0176 (54)1.51 (1.04–2.22)0.03
rs1045642TT192 (11)83 (12)1.43 (1.06–1.93)0.0240 (10)1.25 (0.84–1.86)0.2718 (13)1.54 (0.87–2.72)0.14
CT/TT992 (58)460 (66)1.48 (1.23–1.79)<0.0001250 (66)1.47 (1.16–1.86)0.0294 (67)1.52 (1.05–2.19)0.03
ABCB1TTT1037 (31)444 (34)1242 (34)188 (34)1
HAPCGC734 (22)261 (20)0.83 (0.69–0.995)0.04132 (19)0.77 (0.61–0.98)0.0353 (20)0.85 (0.60–1.21)0.38
TGC713 (21)270 (21)0.88 (0.73–1.05)0.15152 (22)0.90 (0.71–1.13)0.3554 (21)0.91 (0.64–1.29)0.59
CAC583 (18)211 (16)0.84 (0.69–1.02)0.08117 (17)0.87 (0.68–1.11)0.2544 (17)0.89 (0.61–1.29)0.53
TTC186 (6)70 (6)0.90 (0.67–1.21)0.4845 (6)1.07 (0.75–1.53)0.7211 (4)0.73 (0.38–1.39)0.34
CGT62 (2)41 (3)1.67 (1.10–2.54)0.0216 (2)1.22 (0.68–2.18)0.5112 (4)2.48 (1.28–4.79)0.007
*ORs and 95% CIs were estimated using multiple logistic regression and adjusted for sex and age;
†W indicated all alleles except G allele.
GW: GT + GA, WW: TT + TA + AA.

Share and Cite

MDPI and ACS Style

Kim, H.N.; Kim, N.Y.; Yu, L.; Kim, Y.-K.; Lee, I.-K.; Yang, D.-H.; Lee, J.-J.; Shin, M.-H.; Park, K.-S.; Choi, J.-S.; et al. Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma. Int. J. Mol. Sci. 2014, 15, 6703-6716. https://doi.org/10.3390/ijms15046703

AMA Style

Kim HN, Kim NY, Yu L, Kim Y-K, Lee I-K, Yang D-H, Lee J-J, Shin M-H, Park K-S, Choi J-S, et al. Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma. International Journal of Molecular Sciences. 2014; 15(4):6703-6716. https://doi.org/10.3390/ijms15046703

Chicago/Turabian Style

Kim, Hee Nam, Nan Young Kim, Li Yu, Yeo-Kyeoung Kim, Il-Kwon Lee, Deok-Hwan Yang, Je-Jung Lee, Min-Ho Shin, Kyeong-Soo Park, Jin-Su Choi, and et al. 2014. "Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma" International Journal of Molecular Sciences 15, no. 4: 6703-6716. https://doi.org/10.3390/ijms15046703

APA Style

Kim, H. N., Kim, N. Y., Yu, L., Kim, Y. -K., Lee, I. -K., Yang, D. -H., Lee, J. -J., Shin, M. -H., Park, K. -S., Choi, J. -S., & Kim, H. -J. (2014). Polymorphisms in DNA Repair Genes and MDR1 and the Risk for Non-Hodgkin Lymphoma. International Journal of Molecular Sciences, 15(4), 6703-6716. https://doi.org/10.3390/ijms15046703

Article Metrics

Back to TopTop