Next Article in Journal
PlGF Immunological Impact during Pregnancy
Previous Article in Journal
Therapeutic Effect of Calcimimetics on Osteoclast–Osteoblast Crosslink in Chronic Kidney Disease and Mineral Bone Disease
Previous Article in Special Issue
Multifunctional Periphytic Biofilms: Polyethylene Degradation and Cd2+ and Pb2+ Bioremediation under High Methane Scenario
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 21
Issue 22
10.3390/ijms21228713
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Carriers and Genomic Distribution of cadA6—A Novel Variant of a Cadmium Resistance Determinant Identified in Listeria spp.

by
Cora Chmielowska
1,†,
Dorota Korsak
2,*,†,
Barbara Szmulkowska
1,
Alicja Krop
2,
Kinga Lipka
1,
Martyna Krupińska
1 and
Dariusz Bartosik
1,*
1
Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland
2
Department of Molecular Microbiology, Institute of Microbiology, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland
*
Authors to whom correspondence should be addressed.
†
Equal contribution.
Int. J. Mol. Sci. 2020, 21(22), 8713; https://doi.org/10.3390/ijms21228713
Submission received: 29 October 2020 / Revised: 13 November 2020 / Accepted: 16 November 2020 / Published: 18 November 2020
(This article belongs to the Special Issue Molecular and Ecological Genetics of Microbial Metal Resistance)
Browse Figures
Versions Notes

Abstract

:
Listeria monocytogenes is a pathogen responsible for severe cases of food poisoning. Listeria spp. strains occurring in soil and water environments may serve as a reservoir of resistance determinants for pathogenic L. monocytogenes strains. A large collection of Listeria spp. strains (155) isolated from natural, agricultural, and urban areas was screened for resistance to heavy metals and metalloids, and the presence of resistance determinants and extrachromosomal replicons. Of the tested strains, 35% were resistant to cadmium and 17% to arsenic. Sequence analysis of resistance plasmids isolated from strains of Listeria seeligeri and Listeria ivanovii, and the chromosome of L. seeligeri strain Sr73, identified a novel variant of the cadAC cadmium resistance efflux system, cadA6, that was functional in L. monocytogenes cells. The cadA6 cassette was detected in four Listeria species, including strains of L. monocytogenes, isolated from various countries and sources—environmental, food-associated, and clinical samples. This resistance cassette is harbored by four novel composite or non-composite transposons, which increases its potential for horizontal transmission. Since some cadAC cassettes may influence virulence and biofilm formation, it is important to monitor their presence in Listeria spp. strains inhabiting different environments.

1. Introduction

The genus Listeria currently comprises 20 species [1]. Listeria spp. are distributed ubiquitously in diverse environments including soil, surface waters, and vegetation. The presence of Listeria spp. in agricultural environments represents a potential source of contamination for food products [2]. L. monocytogenes and L. innocua are the species identified most frequently in foodstuffs and sites of food processing [3,4,5,6,7,8,9,10]. L. monocytogenes is a human and animal pathogen, so its incidence in food industries is closely monitored. The frequency with which different Listeria species are identified in soil and water samples varies depending on the source of isolation and geographical factors, although L. seeligeri was the most common isolate in a number of studies [11,12,13].
Most studies on resistance to heavy metals and metalloids in Listeria spp. have focused on L. monocytogenes strains [14,15,16,17], although a few have examined the resistance to cadmium and arsenic in other Listeria species [18,19,20,21]. These studies demonstrated that determinants conferring resistance to cadmium and arsenic are widely distributed among Listeria spp. In addition, an association between resistance to cadmium and resistance to benzalkonium chloride (BC), a sanitizer commonly used in food industries, was identified [17,19,20,22]. Notably, co-selection of cadmium and BC resistance has been observed during the conjugative transfer of plasmids between non-pathogenic Listeria spp. and L. monocytogenes [18,20].
To date, five different cadmium resistance determinants (cadAC efflux systems) have been identified within Listeria spp.: (i) the cadA1 gene—located within transposon Tn5422 (Tn3 family) and commonly inserted within plasmids [23,24,25]; (ii) cadA2—another plasmid-associated gene [18,23,26,27]; (iii) cadA3—located within the integrative and conjugative element ICELm1 [28]; (iv) cadA4—harbored by the genomic island LGI2; and (v) cadA5—located within a similar island called LGI2-1 [15,29,30]. The encoded proteins CadA1–CadA3 show approximately 70% amino acid (aa) sequence identity to each other, while sharing around 35% identity with CadA4 and CadA5. The CadA4 and CadA5 proteins are more similar to one another, exhibiting around 90% identity. It is not known why cadmium resistance cassettes are so widely spread among Listeria spp. in the absence of strong cadmium selection pressure. The estimated worldwide mean cadmium concentration in soils is 0.36 µg/g [31], but local concentrations vary depending on the regions, soil acidity, and local pollution levels [32,33,34]. Even low concentrations of metals can induce transcription of resistance genes and potentially exert selective pressure if they result in impaired bacterial growth [30]. However, Parsons et al. [35] suggests that food processing environments may be the main source of selection pressure that leads to the acquisition of cadmium resistance determinants by Listeria spp. strains. Interestingly, Parsons et al. [30] and Pombinho et al. [36] observed that the presence of some cadAC resistance cassettes in Listeria can influence other phenotypic traits, such as virulence and biofilm formation, which suggests that these heavy-metal resistance determinants may have additional functions.
Arsenic resistance in Listeria spp. is usually chromosomally determined, either by a Tn554-like transposon (arsCBADR) or genomic islands LGI2 and LGI2-1 (arsR1D2R2A2B1B2 and upstream arsA1D1 cassette) [15,28]. However, the occurrence of arsenic resistance genes within Listeria spp. plasmids has also been observed [23,37].
The mechanisms regulating intracellular levels of copper in L. monocytogenes remain poorly understood. The first copper transporter identified in this species was the plasmid-encoded efflux pump CtpA from L. monocytogenes strain DRDC8, which, however, appears to be present in very few strains [38,39]. CtpA plays a role not only in copper uptake but also in virulence [40]. Other putative copper-translocating P-type ATPases and multi-copper oxidases have been identified via sequence analysis of L. monocytogenes plasmids [23], but their function has not been tested experimentally. A conserved chromosomal copper resistance operon, csoR-copA-copZ, was described in L. monocytogenes EGD [38]. This encodes the copper-sensing transcriptional regulator CsoR, a copper-exporting P1B-type ATPase CopA and the copper metallochaperone CopZ. It was also shown that the penicillin-binding protein PBP4, encoded by chromosomal gene lmo2229, is involved in copper tolerance in L. monocytogenes [41].
So far, little is known about the extrachromosomal replicons of Listeria spp. other than L. monocytogenes. The National Centre of Biotechnology Information (NCBI) database (GenBank) contains 57 complete Listeria spp. plasmid sequences: 52 from L. monocytogenes, 3 from L. innocua, 1 from L. grayi, and 1 from L. welshimeri (as of 30 August 2020). Listeria spp. plasmids can harbor genes influencing bacterial tolerance to various environmental stresses, including (i) heavy metals [23,25,27,37], (ii) sanitizers [18,20,27,42], (iii) antibiotics [43,44,45], (iv) high temperatures [46], and (v) osmotic and oxidative stress [47]. In addition, many of the plasmid-borne genes encode proteins of unknown function that may potentially contribute to bacterial survival under stressful conditions.
Listeria spp. strains from soil environments can potentially serve as a reservoir of resistance determinants, which, if encoded by mobile elements, may be transferred to pathogenic L. monocytogenes strains. The aim of this study is to characterize a collection of 155 Listeria spp. strains isolated from soil and water samples collected from Poland and the United States in terms of (i) their susceptibility to heavy metals and metalloids, (ii) the presence of resistance determinants, and (iii) the occurrence and distribution of plasmids commonly harboring resistance genes.

2. Results and Discussion

2.1. Isolation and Taxonomic Position of Listeria spp. Isolates

In this study, 143 Listeria spp. strains were obtained from 555 soil and 15 water samples were collected from diverse locations representing natural, urban, and agricultural environments. PCR analysis showed that L. seeligeri was the predominant species (67 strains), followed by L. innocua (29 strains), L. monocytogenes (24 strains), L. ivanovii (16 strains), and L. welshimeri (7 strains). In soil and water samples, L. seeligeri strains are usually identified more often than other Listeria species, e.g., [12,13]. A further 12 strains provided by the Food Safety Laboratory at Cornell University in the USA (3 L. seeligeri, 1 L. innocua, 4 L. welshimeri, 4 L. marthii), also originating from soil and water samples, were added to the collection. In total, 155 Listeria strains representing six species were examined in this study (listed in Supplementary Table S1).

2.2. Susceptibility of Listeria spp. Strains to Heavy Metals and Metalloids

All strains were tested for their susceptibility to heavy metals and metalloids (cadmium, arsenic, and copper) using an agar dilution assay. The presence of resistance determinants to cadmium (cadA1–cadA5 genes), arsenic (arsA1 and arsA2 genes associated with LGI2; arsA gene associated with the Tn554-like transposon), and copper (ctpA gene) was determined by PCR amplification (Figure 1) using primers listed in Table 1.
The frequency of resistant strains varied depending on the species (Figure 1). Overall, 35% of the strains were determined to be resistant to cadmium and 17% to arsenic (minimum inhibitory concentrations (MICs), or lower bounds of MIC values if growth was still observed at highest tested concentrations, are presented in Supplementary Table S1). There are several reports on the prevalence of cadmium and arsenic resistance among L. monocytogenes strains [17,22,48] and a few studies that include other Listeria species [19,20,21], which indicate that resistance to cadmium is widespread, especially among food-associated isolates, while arsenic resistance is usually found at lower frequencies.
However, in contrast to Listeria spp. isolated from food products [16,17,18,20,21], few of the resistant strains identified in this study harbored previously known cadmium resistance determinants (Figure 1, Supplementary Table S1). We identified cadA1 in only 16 strains (4 L. monocytogenes, 5 L. seeligeri, 4 L. ivanovii and 3 L. innocua strains) and cadA4 in 1 strain (L. monocytogenes). None of the strains carried cadA2, cadA3, or cadA5 resistance determinants. In total, only 31% of the cadmium-resistant strains harbored one of the known gene variants cadA1–cadA5, compared to 95% [16], 78% [18], and 61% [21] reported among food industry isolates in previous studies.
The Tn554-associated arsenic resistance cassette was present in most of the arsenic-resistant strains (62%). Interestingly, the Tn554-associated arsenic resistance cassette was also detected in 14 strains (4 of L. seeligeri, 10 of L. ivanovii) that were capable of growth at 250 µg/mL of sodium(meta) arsenite, but not at 500 ug/mL. According to the applied criteria, these strains were not considered resistant. It has yet to be determined why the presence of the resistance cassette confers tolerance only to lower concentrations of arsenic in these strains.
Cadmium- and arsenic-resistant strains that were PCR negative for the tested genes may either harbor yet to be identified resistance determinants or sequence divergence may have occurred in the DNA regions where the primers anneal.
In the case of copper compounds, there are no determined breakpoint concentrations for Listeria spp. Among the tested strains, only 1 L. monocytogenes strain (Sr118) yielded confluent growth at 2400 µg/mL copper(II) sulfate pentahydrate, while 78 strains were capable of growth at up to 1200 µg/mL. Some Listeria spp. plasmids harbor genes potentially involved in copper detoxification [23,39]; however, only one of them, ctpA, has had its role in copper tolerance experimentally confirmed [39]. The ctpA gene was not detected in any of the strains tested in this study.
Available data from locations close to some of the sampling areas (Warsaw city parks and Kampinoski National Park) showed relatively low median concentrations of cadmium (<1 µg/g), arsenic (<5 µg/g), and copper (<20 µg/g) in soil samples [49,50,51]. However, even low concentrations of toxic metals and metalloids can potentially exert selective pressure on bacteria.

2.3. Plasmid Occurrence and Distribution in Listeria spp. Strains

Among the Listeria spp. strains tested in this study, 31 (20%) harbored large plasmids. The reported incidence of plasmids in other studies usually lies in the range 15–50% and is higher among food and environmental isolates than in clinical isolates [19,25,48]. The identified plasmids were classified into 19 groups (named p1–p19) based on their RFLP patterns (Supplementary Table S1). None of the tested L. welshimeri and L. marthii strains harbored plasmids. No plasmids sharing the same restriction pattern were identified in strains of different species. Interestingly, plasmids of the p1 group showed an identical RFLP pattern to those identified in 92 L. monocytogenes strains (isolated from food products in Poland) analyzed in our previous study [52].

2.4. Nucleotide Sequences of L. seeligeri and L. ivanovii Replicons Containing Resistance Determinants

Listeria spp. plasmids often carry cadmium resistance determinants and can contribute to the horizontal transfer of this resistance phenotype [18,20,25]. All strains harboring plasmids of the p6 (L. seeligeri, 4 strains) and p8 (L. seeligeri, 2 strains) RFLP profiles were resistant to cadmium, while not containing any of the known cadA1–cadA5 cadmium-resistance determinants. Only one of the two cadmium-resistant L. ivanovii strains harboring a p16 profile plasmid encoded a known resistance determinant (cadA1). Therefore, the complete nucleotide sequences of the plasmids from the following strains were determined: L. seeliegri Sr12 (named pLIS4; plasmid profile p6), L. seeligeri Sr73 (pLIS5; p8), and L. ivanovii Sr11 (pLIS6; p16). Two of these plasmids, pLIS4 and pLIS6, contained a new variant of the cadAC efflux system, named cadA6 (Figure 2). Plasmid pLIS5 did not encode any cadmium resistance determinant, however the cadA6 resistance cassette was identified in the complete genome sequence of its host strain (L. seeligeri Sr73), determined in this study. Comparative analysis of the chromosomes of Sr73 (2,867,282 bp) and L. seeligeri SLCC3954 (the only available complete genomic sequence of this species; NC_013891.1) is presented in Supplementary Figure S2.
These are the first published complete sequences of plasmids from L. seeligeri and L. ivanovii species. The largest of these plasmids, pLIS4, is 101,192 bp in length and contains 102 predicted protein-coding sequences (CDSs), including 14 pseudogenes. pLIS5 is 60,659-bp long and encodes 77 CDSs (15 pseudogenes), while pLIS6 is 59,142-bp long with 68 CDSs (3 pseudogenes) (Figure 2). The plasmids share few regions of nucleotide sequence similarity with other complete plasmid sequences available in the NCBI GenBank database. The shared regions are mostly limited to transposable elements (TEs). In contrast, many L. monocytogenes plasmids from food-associated isolates share similar genetic backbones and show a high level of sequence conservation [23,37,53,54]. The CDSs identified in these plasmids are described in Supplementary Table S2.
The positions of the predicted genetic modules responsible for replication (REP), stabilization (PAR) and conjugative transfer (TRA) are shown in Figure 2. Large Listeria spp. plasmids are usually categorized into two major groups based on replication initiation protein (RepA) phylogeny [23]. However, the RepA proteins of plasmids pLIS4–6 are placed in two additional and distinct phylogenetic groups (Supplementary Figure S3). The replication proteins of plasmids pLIS5 and pLIS6 cluster together with the RepA of plasmid pLMIV from L. monocytogenes strain FSL J1-208 (GenBank acc. no. NZ_CM001470.1) [55], while the pLIS4 RepA is located on a separate branch. The putative PAR modules encode two proteins probably involved in active partitioning of plasmid molecules during cell division and are present adjacent to the repA gene in all three analyzed plasmids (Figure 2).
In addition, we identified a 15-kb-long sequence representing a possible conjugative transfer module (TRA) that is shared by pLIS4 and pLIS6 (85% nucleotide sequence identity), but absent from pLIS5 (Figure 2). This module is also present in 2 L. seeligeri sequence contigs (probable plasmid sequences) present in the NCBI database (NZ_JAASVW010000014.1; NZ_JAASVC010000008.1). This TRA module includes genes encoding two putative type IV secretion system proteins, a relaxase of the MobL family (protein required for initiation of plasmid conjugal transfer), a lysozyme family protein, and nine hypothetical proteins of unknown function. However, no transconjugants containing pLIS4 or pLIS6 were obtained in a bi-parental mating with a streptomycin-resistant L. monocytogenes strain 10403S. The strain L. welshimeri 40/70 [18] harboring a conjugative plasmid pLIS1 was used in a control mating, and this plasmid was transferred with high frequency. Therefore, plasmids pLIS4 and pLIS6 are either non-self-transmissible or require specific conditions for efficient transfer.
The three sequenced plasmids also contain numerous predicted TEs and genes encoding recombinases and integrases, both complete and partial, which represent traces of previous insertion events. All of the identified insertion sequences (ISs), including three novel ones, ISLse1, ISLse2, ISLse3 (the first defined ISs of L. seeligeri; ISFinder database), were classified as members of the IS3 family. In addition, plasmids pLIS4 and pLIS5 harbor a Tn554-like arsenic resistance transposon. This transposon is also present in some L. monocytogenes plasmids [37], although it is usually chromosomally encoded [15,28]. Furthermore, two novel putative transposons carrying the cadA6 cadmium-resistance cassette were identified in plasmids pLIS4 and pLIS6 (Figure 2).

2.5. Identification of cadA6—A Novel Cadmium Resistance Cassette Variant

Pairwise comparisons revealed that the novel CadA6 protein shares approximately 65% aa sequence identity with CadA1–CadA3, and 36% with CadA4–CadA5 (Figure 3 and Supplementary Figure S4). The cadA6 sequences identified in plasmid pLIS4 and the L. seeligeri Sr73 chromosome are identical (named cadA6a), but the determinant present in pLIS6 is slightly divergent (91% aa and 86% nucleotide sequence identity), so was named cadA6b. A primer pair, cadA6-F/cadA6-R, was designed to enable detection of both cadA6a and cadA6b in Listeria spp. strains (Table 1, Supplementary Figure S5). These primers yielded strong PCR products for positive control strains (L. seeligeri Sr12, L. ivanovii Sr11), while no products of the expected size were produced with control strains containing cadA1, cadA2, cadA3, or cadA4 genes. PCR analyses revealed that 65% of the cadmium-resistant strains tested in this study harbored a cadA6 efflux system (Supplementary Table S1). Therefore, cadA6 was the most prevalent cadmium resistance determinant identified in this study, being present in four species: L. monocytogenes, L. seeligeri, L. innocua, and L. ivanovii. The PCR products from one representative strain of each species (L. monocytogenes Sr119, L. seeligeri Sr12, L. innocua Sr103, L. ivanovii Sr11) were sequenced to confirm the specificity of the amplification reaction. Comparative analysis with the GenBank database showed that CDSs homologous to CadA6 (91–100% aa sequence identity, 100% query coverage) are present in species of various Gram-positive genera, including Listeria, Bacillus, Solibacillus, and Enterococcus.

2.6. Transposons Harboring the cadA6 Efflux System

The cadA6 cadmium resistance determinants in plasmids pLIS4, pLIS6 and the chromosome of L. seeligeri Sr73 are localized within three novel putative TEs (Figure 4). The cadA6a cassette present in pLIS4 is located within a 27-kb-long composite transposon, named Tn6869, formed by two flanking copies of ISLse2 (IS3 family). This putative mobile element disrupts a hypothetical gene and is flanked by 3-bp-long direct repeats (DRs), which are probably the result of target site duplication upon transposition. Other copies of ISLse2 found in Listeria sequences present in GenBank also feature 3-bp-long DRs.
In pLIS6, the cadA6b cassette was probably introduced on a 6-kb-long non-composite transposon. Apart from the cadA6b efflux system, this novel transposon Tn6870 encodes a transposase, a serine recombinase, and an ATPase, which shows aa sequence similarity to the CDSs of transposon Tn552 (6.5 kb) from Staphylococcus aureus (GenBank acc. no. X52734.1). No DRs flanking Tn6870 were identified in pLIS6. However, we discovered the same putative transposon in the genome sequences of several L. monocytogenes strains in the GenBank database (e.g., NZ_NYDG01000002), where it is flanked by 6-bp-long DRs. These L. monocytogenes strains originated from Italy and are food-associated or clinical isolates.
Another non-composite cadA6a-harboring transposon, Tn6871 (7 kb), was identified in the L. seeligeri Sr73 chromosome sequence (nucleotide positions of TEs identified in the chromosome are presented in Supplementary Table S2). This putative transposon has a similar structure to Tn6870, but harbors an additional methyltransferase domain-containing protein. Identification of an empty insertion site in the chromosome of a related L. seeligeri strain RR4 (CP034772) enabled definition of the transposon borders with flanking 6-bp-long DRs. Tn6871 is present in the genomic sequences (99–100% nucleotide sequence identity) of several strains of L. monocytogenes (e.g., NZ_FFER01000001), L. ivanovii (e.g., KR780025), L. seeligeri (e.g., NZ_JAATNZ010000010.1), and L. innocua (e.g., NZ_JRYX01000002). In many of these cases the transposon is flanked by 7- or 8-bp-long DRs of the target site. This transposon was found in both food-associated and clinical isolates originating from various locations, including (i) China (NZ_VOXH01000052; source—delicatessen), (ii) Switzerland (NZ_QYIR01000006; raw sausage), (iii) Ireland (NZ_LABG01000002; milk), (iv) Italy (NZ_NXUN01000005; smoked salmon), (v) Netherlands (NZ_FFGL01000001, NZ_FFER01000001; blood, cerebrospinal fluid), and (vi) Canada (NZ_QADA01000002; food).
In addition, a Tn3 family transposon, Tn6947 (7 kb), harboring a cadA6 cassette was identified in a few L. monocytogenes strains originating from the United States (e.g., strain CDPHFDLB-FM17-00092, NZ_PQHI01000019), for which draft sequences are available in the GenBank database. The putative transposon disrupts a DNA polymerase gene and is flanked by 5-bp-long DRs. It encodes a Tn3-family transposase, a resolvase and a slightly divergent cadA6 cassette (named cadA6c). CadA6c shows around 91% aa sequence identity to CadA6a (86% nucleotide sequence identity). The transposase shows around 43% aa sequence identity to that of Tn5422.
In all the analyzed cases, cadA6 is harbored by putative transposons, which increases the potential for its dissemination. Two other cadmium resistance determinants frequently encountered in Listeria spp., cadA1 and cadA2, are also carried by TEs–Tn5422 a Tn3-family transposon [24] and a putative composite transposon formed by flanking IS3-family ISs [27], respectively.

2.7. Functional Analysis of the cadA6 Resistance Cassette

To test whether cadA6 encodes a functional efflux system conferring cadmium tolerance, plasmid pLIS4 was removed from L. seeligeri Sr12 cells by repeated subculturing in BHI broth supplemented with subinhibitory concentrations of novobiocin. Plasmid-cured strains (Sr12-C1, Sr12-C2) were indeed incapable of growth on BHI agar plates supplemented with cadmium chloride (35 µg/mL). Despite repeated attempts, we did not succeed in obtaining a derivative of L. ivanovii Sr11 that had been cured of plasmid pLIS6. Interestingly, plasmid pLIS4 encodes a putative toxin-antitoxin (TA) stabilization system, while pLIS6 from L. ivanovii Sr11 does not contain such addiction modules.
Next, the putative cadmium resistance cassettes cadA6a (pLIS4, L. seeligeri Sr12) and cadA6b (pLIS6, L. ivanovii Sr11) were amplified by PCR and cloned into the mobilizable E. coli-Listeria spp. shuttle vector pDKEL. The constructed plasmids (pDKEL_cadA6a and pDKEL_cadA6b) were transferred from E. coli into a cadmium-susceptible L. monocytogenes strain 10403S. The obtained transconjugants acquired cadmium tolerance and were able to grow at a cadmium chloride concentration of 75 µg/mL. In contrast, both the recipient strain L. monocytogenes 10403S and a 10403S derivative carrying “empty” vector pDKEL were incapable of growth at cadmium chloride concentrations of ≥20 µg/mL. The cloned cadA6a and cadA6b efflux systems did not seem to influence the susceptibility of L. monocytogenes 10403S to copper(II) sulfate pentahydrate or zinc chloride, which is consistent with previous reports [24,30], that the cadA1–cadA4 cassettes did not confer resistance to zinc. Our results strongly support the predicted cadmium detoxification function of the cadA6 efflux system.

3. Materials and Methods

3.1. Bacterial Strains and Growth Conditions

A total of 143 Listeria spp. strains (listed in Supplementary Table S1) were isolated from soil and water samples collected in this study (see Section 3.2), while another 12 were obtained from the Food Safety Laboratory collection at Cornell University (USA) (L. seeligeri: FSL S4-0003, FSL S4-0057, FSL S4-0073; L. innocua: FSL H4-0088; L. welshimeri: FSL H4-0277, FSL S4-0070, FSL S4-0101, FSL S4-0105; L. marthii: FSL S4-0120, FSL S4-0696, FSL S4-0710, and FSL S4-0965). Escherichia coli DH5α pir [56] and streptomycin-resistant L. monocytogenes strain 10403S (serotype 1/2a) [57] were used to clone and analyze the cadA6 cadmium-resistance determinant. Unless otherwise specified, bacteria were grown in brain–heart infusion (BHI) broth (BioMaxima, Lublin, Poland) or on BHI agar plates (1.5% w/v agar) at 37 °C. When necessary, the media were supplemented with kanamycin (Km; BioShop, Burlington, Canada)—50 μg/mL, streptomycin (Str; BioShop)—100 μg/mL for L. monocytogenes 10403S, erythromycin (Erm; Sigma-Aldrich, Saint-Louis, MO, USA)—2 μg/mL for Listeria spp., and 250 μg/mL for E. coli. For long-term storage, the isolates were suspended in BHI containing 20% glycerol and frozen at −80 °C.

3.2. Soil and Water Sample Collection and Isolation of Listeria spp.

For this study, 555 soil and 15 water samples were collected from 53 different locations in Poland in the years 2016 and 2017. Samples were collected from natural environments (328 samples), and urban (171) and agricultural (71) areas. Listeria spp. were isolated from these samples using a modified PN-EN ISO 11290-1 procedure. Briefly, 10 g of a soil sample or 10 mL of a water sample was added to 90 mL of selective enrichment half-Fraser broth (BioMaxima) and incubated at 30 °C for 24 h. A sample of 100 µL of the enriched culture solution was then added to 10 mL of Fraser Broth (BioMaxima) and incubated at 37 °C for 48 h. After incubation, 10 µL of the culture solution was streaked onto Chromogenic Listeria Lab-Agar plates (BioMaxima) and incubated at 37 °C for 48 h. Blue-green colonies were re-streaked onto Chromogenic Listeria Lab-Agar and BHI plates. If a single sample gave colonies displaying a distinctly different morphology on Chromogenic Listeria Lab-Agar (e.g., a different shade of color, with or without an opaque halo), representatives of each colony type were picked for further analysis.

3.3. Identification of Listeria Species

Listeria species were differentiated based on the multiplex PCR analysis, as described previously [58]. The following control strains were used: L. monocytogenes ATCC 13932, L. grayi ATCC 25401, L. welshimeri ATCC 35987, L. seeligeri ATCC 35967, L. innocua PZH 5/04, and L. ivanovii PZH 7/04 from the collection of the Department of Molecular Microbiology, University of Warsaw (Poland). In the case of presumptive Listeria spp. strains for which the species could not be determined by multiplex PCR, 16S rDNA amplicons (primers 27f/1492R; [59]) were sequenced.

3.4. Bacterial Mating between Listeria spp. Strains

Bi-parental matings between Listeria spp. strains were performed on solid BHI medium using L. seeligeri Sr12, L. ivanovii Sr 11, and L. welshimeri 40/07 [18] as donor strains, and streptomycin-resistant L. monocytogenes 10403S as the recipient. The mating experiments were performed in four independent repetitions at two different temperatures. Overnight cultures of the donor and recipient strains were mixed at a ratio of 1:2 and 100 μL samples of these mixtures were spread on solidified BHI medium and incubated at 30 or 37 °C for 24 h. Bacteria were then washed off the plates with BHI medium and suitable dilutions were plated on selective media containing streptomycin (100 μg/mL; selective marker of the recipient strain) and cadmium chloride (25 μg/mL), and incubated at 30 or 37 °C for up to 96 h. Transconjugants were verified by PCR using L. monocytogenes-specific primers and by plasmid DNA isolation.

3.5. Heavy-Metal and Metalloid Susceptibility

The susceptibility of Listeria spp. to heavy metals was determined using an agar dilution method as described previously [19], with some modifications. Briefly, several colonies picked from BHI plates were suspended in saline solution to a turbidity of 0.5 McFarland units. Spots of 3 µL of each bacterial suspension were applied to cation-adjusted Mueller Hinton 1.2% agar plates (Becton, Dickinson and Company, Frankling Lakes, NJ, USA), supplemented with 2.5% defibrinated horse blood and 0, 35, 75, 150 μg/mL (which corresponds to: 0, 0.19, 0.41, 0.82 mM) cadmium chloride (Sigma-Aldrich) or 0, 250, 500, 1000 μg/mL (0, 1.92, 3.85, 7.70 mM) sodium (meta)arsenite (Sigma-Aldrich), or to BHI plates supplemented with 0, 600, 1200, 2400 μg/mL (0, 2.40, 4.81, 9.61 mM) copper(II) sulfate pentahydrate. The plates were then incubated at 37 °C for 48 h (cadmium chloride, sodium (meta) arsenite) or 72 h (copper(II) sulfate pentahydrate). Strains were classified as resistant to heavy metals if they produced confluent growth on plates containing ≥75 μg/mL (0.41 mM) cadmium chloride or ≥500 μg/mL (3.85 mM) sodium arsenite. In the case of copper compounds, there are no determined breakpoint values for Listeria spp.

3.6. Isolation of Genomic DNA

Genomic DNA was extracted from bacterial cells using a Chelex-100 resin-based technique. Colonies were suspended in 50 μL of 5% Chelex-100 (Bio-Rad, Hercules, CA, USA), incubated at 95 °C for 20 min, then cooled on ice for 5 min and centrifuged at 2400× g for 3 min. The DNA-containing supernatants were then used as the templates for PCR amplifications.

3.7. Plasmid DNA Isolation and Restriction Fragment Length Polymorphism (RFLP) Profile Analysis

Each strain was cultured overnight in BHI broth at 37 °C. Samples of 3 mL were centrifuged and the cell pellets resuspended in 500 μL of diluted SSC buffer (15 mM sodium chloride, 1.5 mM trisodium citrate, pH 7.0). The cells were collected by centrifugation and resuspended in 500 μL of SET buffer (25% sucrose (w/v), 50 mM EDTA, 50 mM Tris, pH 8.0, 5 mg/mL lysozyme). After incubation at 37 °C for 30 min, plasmid DNA was isolated according to the alkaline lysis procedure [60]. Purified plasmid DNA was digested with EcoRI according to the manufacturer’s protocol (Thermo Scientific in the case of all restriction enzymes used in this study). The resulting DNA fragments were separated by electrophoresis in 0.8% agarose gels. Plasmid DNA for sequencing was isolated using a larger scale preparation method [61]. Sequence assembly was verified by RFLP analysis (enzymes: EcoRI, BamHI and NcoI).

3.8. Plasmid Curing

Plasmid pLIS4 was removed from cells of L. seeligeri Sr12 as described previously [62], with some modifications. The strain was grown overnight at 37 °C in 2 mL of BHI broth supplemented with a subinhibitory concentration (0.15 µg/mL) of novobiocin (Sigma). The resulting culture was subcultured (1:100) in the same medium and again grown overnight at 37 °C. This procedure was repeated each day for 15 days. Dilutions of the final culture were then plated on Chromogenic Listeria Lab-Agar plates, and incubated at 37 °C overnight. Single colonies were screened for the presence of plasmids by PCR using primers targeting the cadA6 gene. Negative and positive controls were used in all PCR experiments. Plasmid loss was confirmed by plasmid DNA extraction and by testing the ability of strains to grow on BHI plates supplemented with 35 and 75 μg/mL cadmium chloride.

3.9. Detection of Resistance Determinants by PCR

The presence of resistance determinants was detected by PCR performed with DreamTaq polymerase (Thermo Scientific, Waltham, MA, USA) using primers listed in Table 1. A primer pair for the novel cadA6 gene was designed based on the sequences of plasmids pLIS4 (L. seeligeri Sr12) and pLIS6 (L. ivanovii Sr11). The following thermocycle conditions were applied: initial denaturation for 5 min at 95 °C; 35 cycles of denaturation at 95 °C for 30 s, annealing for 30 s at the temperatures listed in Table 1, and elongation at 72 °C for 45–150 s, depending on the expected product size; final elongation at 72 °C for 5 min. Positive control strains were included for all tested genes, apart from cadA5 and ctpA for which no such controls were available. The following control strains were used: (i) L. innocua 62/06 [18]—cadA1 gene, (ii) L. welshimeri 49/06 [18]—cadA2 gene, (iii) L. monocytogenes EGDe [63]—cadA3 gene, (iv) L. monocytogenes Lmo28 [52]—cadA4, arsA1, and arsA2 genes associated with LGI2, and (v) L. monocytogenes 2270/03 [52]—arsA gene associated with the Tn554-like transposon. The PCR products amplified from positive control strains were sequenced.

3.10. Functional Analysis of the cadA6 Resistance Cassette

3.10.1. Construction of a Mobilizable Shuttle Vector pDKEL

Plasmid pDKEL was constructed based on mobilizable E. coli vector pDS132 [64]. The construction of pDKEL and its derivatives is described in detail in Supplementary Figure S1. Briefly, a kanamycin resistance cassette, obtained from pDIY-Km [65] was cloned in plasmid pDS132. Then, a 3707-bp restriction fragment from this construct was ligated with an erythromycin resistance cassette obtained from plasmid pHP13 [66]. Next, the lacZ multiple cloning site (MCS) from plasmid pBBR1MCS was added to the construct [67]. Finally, a replication system, functional in Gram-positive bacteria, obtained from plasmid pHP13, was cloned into the MCS. The resulting plasmid pDKEL is a mobilizable E. coli—Listeria spp. shuttle vector containing kanamycin (selection marker for E.coli strains) and erythromycin (selection marker for L. monocytogenes strains) resistance cassettes.

3.10.2. Cloning of the Cadmium Resistance Cassette into pDKEL

Novel cadmium resistance cassettes (genes cadA6 and cadC6) were amplified from plasmids pLIS4 (cadA6a; L. seeligeri strain Sr12; nucleotide position: 18,685–21,508) and pLIS6 (cadA6b; L. ivanovii strain Sr11 nucleotide position: 12,664–15,715) using Phusion High-Fidelity DNA Polymerase (Thermo Scientific) and the primer pairs cadA6aF/cadA6aR and cadA6bF/cadA6bR (Table 1). The amplified DNA fragments (2843- and 3072-bp-long, respectively) and pDKEL were digested using enzymes SpeI and NotI, ligated using T4 DNA ligase, and the mixtures used to transform chemically competent E. coli DH5α pir with selection on LA plates containing kanamycin. Plasmid DNA was isolated from transformants and restriction analysis was used to confirm their identity as recombinants.

3.10.3. Introduction of Constructed Plasmids into L. monocytogenes 10403S

The plasmids pDKEL_cadA6a, pDKEL_cadA6b, and empty pDKEL were introduced into the cadmium-sensitive and streptomycin-resistant L. monocytogenes strain 10403S by conjugation. Overnight cultures of the donor (E. coli DH5α pir strains harboring pDKEL_cadA6a, pDKEL_cadA6b or pDKEL), recipient (L. monocytogenes 10403S), and helper (E.coli DH5α harboring helper plasmid pKR2013; [68]) strains were harvested by centrifugation and the cells were washed to remove the antibiotics. The cell suspensions were mixed in a 1:1:1 ratio and 100 μL of the mixtures were spread on BHI agar plates. After incubation at 37 °C for 24 h, bacterial cells were washed off the plates with BHI medium and dilutions were plated on BHI agar plates supplemented with streptomycin, and depending on the introduced vector, erythromycin (in the case of pDKEL) or 20 μg/mL of cadmium chloride (pDKEL_cadA6a and pDKEL_cadA6b). These plates were then incubated at 37 °C for up to 48 h to allow transconjugant colonies to form. The presence of transferred plasmids in these strains was confirmed by restriction analysis of isolated plasmid DNA.

3.10.4. Heavy-Metal Susceptibility of L. monocytogenes 10403S Strains Harboring the Constructed Plasmids

The susceptibility of the following strains to cadmium was tested using the agar dilution method: (i) L. monocytogenes 10403S carrying pDKEL_cadA6a, (ii) L. monocytogenes 10403S carrying pDKEL_cadA6b, (iii) L. monocytogenes 10403S carrying empty pDKEL, (iv) L. monocytogenes 10403S without any plasmids (negative control), (v) L. seeligeri Sr12 harboring the cadA6a cassette, and (vi) L. ivanovii Sr11 harboring the cadA6b cassette (positive controls). Assay plates were supplemented with cadmium chloride at 0, 35, 75, 150, and 300 μg/mL. The experiment was performed in two independent repetitions. The same strains were used in agar dilution assays to test their susceptibility to copper(II) sulfate pentahydrate (0, 600, 1200, 2400 μg/mL) and zinc chloride (0, 500, 1000, 2000, 3000 μg/mL), in order to determine whether the cadA6 efflux system influences the susceptibility to these metals.

3.11. DNA Sequencing

Sequencing of plasmids pLIS4 (L. seeligeri Sr12), pLIS5 (L. seeligeri Sr73), and pLIS6 (L. ivanovii Sr11), as well as the L. seeligeri Sr73 chromosome was performed in the DNA Sequencing and Oligonucleotide Synthesis Laboratory (oligo.pl) at the Institute of Biochemistry and Biophysics, Polish Academy of Sciences. The sequences were obtained using a combination of MiSeq (Illumina, San Diego, CA, USA) and GridION (Oxford Nanopore Technologies, Oxford, UK) sequencing and assembled with Unicycler [69]. The nucleotide sequences of the plasmids have been deposited in GenBank (NCBI, Bethesda, MD, USA) under the accession numbers MW124301 (pLIS4), CP063072 (pLIS5), MW124302 (pLIS6), and CP063071 (chromosome of L. seeligeri Sr73).

3.12. Bioinformatic Analysis

Automatic annotation of the nucleotide sequences was performed using RAST on the PATRIC platform [70], followed by manual refinement in Artemis [71], based on the homology searches (BLAST) of the NCBI database (http://www.ncbi.nlm.nih.gov). Sequences were aligned and visualized using EasyFig [72]. Insertion sequences were identified using the ISfinder website and the nucleotide sequences of novel elements were deposited in the ISfinder database [73]. Transposon numbers were registered at the Transposon Registry [74]. The phylogenetic tree of the RepA proteins of complete Listeria spp. plasmid sequences available in the GenBank database and plasmid pOX2 of Bacillus anthracis was constructed in MEGAX [75] using the maximum-likelihood algorithm (Le and Gascuel model). Statistical support for the internal nodes was determined by 1000 bootstrap replicates. Multiple sequence alignments were performed using MUSCLE [76] and visualized using Jalview [77].

4. Conclusions

Analysis of the first complete sequences of plasmids from L. seeligeri and L. ivanovii as well as the chromosome of L. seeligeri Sr73 identified a novel variant of the cadAC efflux system. The presence of cadA6 in four different novel transposons increases the potential for its dissemination. The cadA6 resistance determinant has been detected in strains representing four Listeria species, including L. monocytogenes, isolated from various countries and sources—environmental, food-associated, and clinical samples. We have experimentally confirmed the involvement of the cadA6 determinant in the increased cadmium tolerance of Listeria spp. strains and designed molecular probes to verify the presence of this novel variant in other strains. Previous studies have suggested that some cadAC cassettes may additionally influence the phenotypic traits not related to heavy-metal resistance [30,36]. Therefore, the prevalence of various cadAC efflux systems and the means of their dissemination should be monitored in Listeria spp. strains isolated from different environments.

Supplementary Materials

The following are available online at https://www.mdpi.com/1422-0067/21/22/8713/s1.

Author Contributions

Conceptualization, C.C., D.K., and D.B.; methodology, C.C., D.K., and D.B.; investigation, C.C., D.K., B.S., A.K., K.L., and M.K.; data curation, C.C.; writing—original draft preparation, C.C. and D.K.; writing—review and editing, C.C., D.K., and D.B.; visualization, C.C.; supervision, D.B. and D.K.; project administration, C.C.; funding acquisition, C.C. and D.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Science Centre (NCN), Poland (grant no. UMO-2016/21/B/NZ8/00383) and the Ministry of Science and Higher Education through the Faculty of Biology, University of Warsaw intramural grant DSM (grant no. 501-D114-01-1140400).

Acknowledgments

We acknowledge the Kampinoski National Park (Poland) for the soil and water sampling permit (DE 0604/32/16).

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Leclercq, A.; Moura, A.; Vales, G.; Tessaud-Rita, N.; Aguilhon, C.; Lecuit, M. Listeria thailandensis sp. nov. Int. J. Syst. Evol. Microbiol. 2019, 69, 74–81. [Google Scholar] [CrossRef]
  2. Girardin, H.; Morris, C.E.; Albagnac, C.; Dreux, N.; Glaux, C.; Nguyen-The, C. Behaviour of the pathogen surrogates Listeria innocua and Clostridium sporogenes during production of parsley in fields fertilized with contaminated amendments. FEMS Microbiol. Ecol. 2005, 54, 287–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Gaya, P.; Saralegui, C.; Medina, M.; Nuñez, M. Occurrence of Listeria monocytogenes and other Listeria spp. in raw caprine milk. J. Dairy Sci. 1996, 79, 1936–1941. [Google Scholar] [CrossRef]
  4. Hofer, E.; Ribeiro, R.; Feitosa, D.P. Species and serovars of the genus Listeria isolated from different sources in Brazil from 1971 to 1997. Mem. Inst. Oswaldo Cruz 2000, 95, 615–620. [Google Scholar] [CrossRef]
  5. Kalorey, D.R.; Warke, S.R.; Kurkure, N.V.; Rawool, D.B.; Barbuddhe, S.B. Listeria species in bovine raw milk: A large survey of Central India. Food Control 2008, 19, 109–112. [Google Scholar] [CrossRef]
  6. MacGowan, A.P.; Bowker, K.; McLauchlin, J.; Bennett, P.M.; Reeves, D.S. The occurrence and seasonal changes in the isolation of Listeria spp. in shop bought food stuffs, human faeces, sewage and soil from urban sources. Int. J. Food Microbiol. 1994, 21, 325–334. [Google Scholar] [CrossRef]
  7. Meloni, D.; Galluzzo, P.; Mureddu, A.; Piras, F.; Griffiths, M.; Mazzette, R. Listeria monocytogenes in RTE foods marketed in Italy: Prevalence and automated EcoRI ribotyping of the isolates. Int. J. Food Microbiol. 2009, 129, 166–173. [Google Scholar] [CrossRef] [PubMed]
  8. Wilson, I.G. Occurrence of Listeria species in ready to eat foods. Epidemiol. Infect. 1995, 115, 519–526. [Google Scholar] [CrossRef] [Green Version]
  9. Pesavento, G.; Ducci, B.; Nieri, D.; Comodo, N.; Lo Nostro, A. Prevalence and antibiotic susceptibility of Listeria spp. isolated from raw meat and retail foods. Food Control 2010, 21, 708–713. [Google Scholar] [CrossRef]
  10. Sheridan, J.J.; Duffy, G.; McDowell, D.A.; Blair, I.S. The occurence and initial numbers of Listeria in Irish meat and fish products and the recovery of injured cells from frozen products. Int. J. Food Microbiol. 1994, 22, 105–113. [Google Scholar] [CrossRef]
  11. Bauwensm, L.; Vercammen, F.; De Meurichy, W. Occurrence of Listeria Spp. in captive antelope herds and their environment. J. Zoo Wildl. Med. 2001, 32, 514–518. [Google Scholar]
  12. Linke, K.; Rückerl, I.; Brugger, K.; Karpiskova, R.; Walland, J.; Muri-Klinger, S.; Tichy, A.; Wagner, M.; Stessl, B. Reservoirs of Listeria species in three environmental ecosystems. Appl. Environ. Microbiol. 2014, 80, 5583–5592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Sauders, B.D.; Overdevest, J.; Fortes, E.; Windham, K.; Schukken, Y.; Lembo, A.; Wiedmann, M. Diversity of Listeria species in urban and natural environments. Appl. Environ. Microbiol. 2012, 78, 4420–4433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Lee, S.; Rakic-Martinez, M.; Graves, L.M.; Ward, T.J.; Siletzky, R.M.; Kathariou, S. Genetic determinants for cadmium and arsenic resistance among Listeria monocytogenes serotype 4B isolates from sporadic human listeriosis patients. Appl. Environ. Microbiol. 2013, 79, 2471–2476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Lee, S.; Ward, T.J.; Jima, D.D.; Parsons, C.; Kathariou, S. The arsenic resistance-associated Listeria genomic island LGI2 exhibits sequence and integration site diversity and a propensity for three Listeria monocytogenes clones with enhanced virulence. Appl. Environ. Microbiol. 2017, 83, e01189-17. [Google Scholar] [CrossRef] [Green Version]
  16. Mullapudi, S.; Siletzky, R.M.; Kathariou, S. Diverse cadmium resistance determinants in Listeria monocytogenes isolates from the turkey processing plant environment. Appl. Environ. Microbiol. 2010, 76, 627–630. [Google Scholar] [CrossRef] [Green Version]
  17. Ratani, S.S.; Siletzky, R.M.; Dutta, V.; Yildirim, S.; Osborne, J.A.; Lin, W.; Hitchins, A.D.; Ward, T.J.; Kathariou, S. Heavy metal and disinfectant resistance of Listeria monocytogenes from foods and food processing plants. Appl. Environ. Microbiol. 2012, 78, 6938–6945. [Google Scholar] [CrossRef] [Green Version]
  18. Korsak, D.; Chmielowska, C.; Szuplewska, M.; Bartosik, D. Prevalence of plasmid-borne benzalkonium chloride resistance cassette bcrABC and cadmium resistance cadA genes in nonpathogenic Listeria spp. isolated from food and food-processing environments. Int. J. Food Microbiol. 2019, 290, 247–253. [Google Scholar] [CrossRef]
  19. Korsak, D.; Szuplewska, M. Characterization of nonpathogenic Listeria species isolated from food and food processing environment. Int. J. Food Microbiol. 2016, 238, 274–280. [Google Scholar] [CrossRef]
  20. Katharios-Lanwermeyer, S.; Rakic-Martinez, M.; Elhanafi, D.; Ratani, S.; Tiedje, J.M.; Kathariou, S. Coselection of cadmium and benzalkonium chloride resistance in conjugative transfers from nonpathogenic Listeria spp. to other Listeriae. Appl. Environ. Microbiol. 2012, 78, 7549–7556. [Google Scholar] [CrossRef] [Green Version]
  21. Xu, D.; Deng, Y.; Fan, R.; Shi, L.; Bai, J.; Yan, H. Coresistance to benzalkonium chloride disinfectant and heavy metal ions in Listeria monocytogenes and Listeria innocua swine isolates from China. Foodborne Pathog. Dis. 2019, 16, 696–703. [Google Scholar] [CrossRef] [PubMed]
  22. Mullapudi, S.; Siletzky, R.M.; Kathariou, S. Heavy-metal and benzalkonium chloride resistance of Listeria monocytogenes isolates from the environment of Turkey-processing plants. Appl. Environ. Microbiol. 2008, 74, 1464–1468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Kuenne, C.; Voget, S.; Pischimarov, J.; Oehm, S.; Goesmann, A.; Daniel, R.; Hain, T.; Chakraborty, T. Comparative analysis of plasmids in the genus Listeria. PLoS ONE 2010, 5, e12511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Lebrun, M.; Audurier, A.; Cossart, P. Plasmid-borne cadmium resistance genes in Listeria monocytogenes are similar to cadA and cadC of Staphylococcus aureus and are induced by cadmium. J. Bacteriol. 1994, 176, 3040–3048. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Lebrun, M.; Loulergue, J.; Chaslus-Dancla, E.; Audurier, A. Plasmids in Listeria monocytogenes in relation to cadmium resistance. Appl. Environ. Microbiol. 1992, 58, 3183–3186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Dutta, V.; Elhanafi, D.; Kathariou, S. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes. Appl. Environ. Microbiol. 2013, 79, 6067–6074. [Google Scholar] [CrossRef] [Green Version]
  27. Elhanafi, D.; Dutta, V.; Kathariou, S. Genetic characterization of plasmid-associated benzalkonium chloride resistance determinants in a Listeria monocytogenes strain from the 1998–1999 outbreak. Appl. Environ. Microbiol. 2010, 76, 8231–8238. [Google Scholar] [CrossRef] [Green Version]
  28. Kuenne, C.; Billion, A.; Mraheil, M.A.; Strittmatter, A.; Daniel, R.; Goesmann, A.; Barbuddhe, S.; Hain, T.; Chakraborty, T. Reassessment of the Listeria monocytogenes pan-genome reveals dynamic integration hotspots and mobile genetic elements as major components of the accessory genome. BMC Genom. 2013, 14, 47. [Google Scholar] [CrossRef] [Green Version]
  29. Parsons, C.; Lee, S.; Kathariou, S. Heavy metal resistance determinants of the foodborne pathogen Listeria monocytogenes. Genes 2018, 10, 11. [Google Scholar] [CrossRef] [Green Version]
  30. Parsons, C.; Lee, S.; Jayeola, V.; Kathariou, S. Novel cadmium resistance determinant in Listeria monocytogenes. Appl. Environ. Microbiol. 2017, 83, e02580-16. [Google Scholar] [CrossRef] [Green Version]
  31. Kubier, A.; Wilkin, R.T.; Pichler, T. Cadmium in soils and groundwater: A review. Appl. Geochem. 2019, 108, 104388. [Google Scholar] [CrossRef] [PubMed]
  32. Tóth, G.; Hermann, T.; Da Silva, M.R.; Montanarella, L. Heavy metals in agricultural soils of the European Union with implications for food safety. Environ. Int. 2016, 88, 299–309. [Google Scholar] [CrossRef] [PubMed]
  33. Cai, K.; Yu, Y.; Zhang, M.; Kim, K. Concentration, source, and total health risks of cadmium in multiple media in densely populated areas, China. Int. J. Environ. Res. Public Health 2019, 16, 2269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Wang, H.; Wu, Q.; Hu, W.; Huang, B.; Dong, L.; Liu, G. Using multi-medium factors analysis to assess heavy metal health risks along the Yangtze River in Nanjing, Southeast China. Environ. Pollut. 2018, 243, 1047–1056. [Google Scholar] [CrossRef] [PubMed]
  35. Parsons, C.; Lee, S.; Kathariou, S. Dissemination and conservation of cadmium and arsenic resistance determinants in Listeria and other Gram-positive bacteria. Mol. Microbiol. 2020, 113, 560–569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Pombinho, R.; Camejo, A.; Vieira, A.; Reis, O.; Carvalho, F.; Almeida, M.T.; Pinheiro, J.C.; Sousa, S.; Cabanes, D. Listeria monocytogenes CadC regulates cadmium efflux and fine-tunes lipoprotein localization to escape the host immune response and promote infection. J. Infect. Dis. 2017, 215, 1468–1479. [Google Scholar] [CrossRef]
  37. Hingston, P.; Brenner, T.; Truelstrup Hansen, L.; Wang, S. Comparative analysis of Listeria monocytogenes plasmids and expression levels of plasmid-encoded genes during growth under salt and acid stress conditions. Toxins 2019, 11, 426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Corbett, D.; Schuler, S.; Glenn, S.; Andrew, P.W.; Cavet, J.S.; Roberts, I.S. The combined actions of the copper-responsive repressor CsoR and copper-metallochaperone CopZ modulate CopA-mediated copper efflux in the intracellular pathogen Listeria monocytogenes. Mol. Microbiol. 2011, 81, 457–472. [Google Scholar] [CrossRef]
  39. Bell, F.Y. Copper Tolerance of Listeria Monocytogenes Strain DRDC8. Ph.D. Thesis, University of Adelaide, Adelaide, Australia, 2010. [Google Scholar]
  40. Francis, M.S.; Thomas, C.J. Mutants in the CtpA copper transporting P-type ATPase reduce virulence of Listeria monocytogenes. Microb. Pathog. 1997, 22, 67–78. [Google Scholar] [CrossRef]
  41. Parsons, C.; Costolo, B.; Brown, P.; Kathariou, S. Penicillin-binding protein encoded by pbp4 is involved in mediating copper stress in Listeria monocytogenes. FEMS Microbiol. Lett. 2017, 364. [Google Scholar] [CrossRef]
  42. Kremer, P.H.C.; Lees, J.A.; Koopmans, M.M.; Ferwerda, B.; Arends, A.W.M.; Feller, M.M.; Schipper, K.; Valls Seron, M.; van der Ende, A.; Brouwer, M.C.; et al. Benzalkonium tolerance genes and outcome in Listeria monocytogenes meningitis. Clin. Microbiol. Infect. 2017, 23, 265.e1–265.e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Charpentier, E.; Courvalin, P. Emergence of the trimethoprim resistance gene dfrD in Listeria monocytogenes BM4293. Antimicrob. Agents Chemother. 1997, 41, 1134–1136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Poyart-Salmeron, C.; Carlier, C.; Trieu-Cuot, P.; Courvalin, P.; Courtieu, A.L. Transferable plasmid-mediated antibiotic resistance in Listeria monocytogenes. Lancet 1990, 335, 1422–1426. [Google Scholar] [CrossRef]
  45. Bertsch, D.; Anderegg, J.; Lacroix, C.; Meile, L.; Stevens, M.J.A. PDB2011, a 7.6kb multidrug resistance plasmid from Listeria innocua replicating in Gram-positive and Gram-negative hosts. Plasmid 2013, 70, 284–287. [Google Scholar] [CrossRef] [PubMed]
  46. Pöntinen, A.; Aalto-Araneda, M.; Lindström, M.; Korkeala, H. Heat resistance mediated by pLM58 plasmid-borne ClpL in Listeria monocytogenes. mSphere 2017, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Naditz, A.L.; Dzieciol, M.; Wagner, M.; Schmitz-Esser, S. Plasmids contribute to food processing environment–associated stress survival in three Listeria monocytogenes ST121, ST8, and ST5 strains. Int. J. Food Microbiol. 2019, 299, 39–46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. McLauchlin, J.; Hampton, M.D.; Shah, S.; Threlfall, E.J.; Wieneke, A.A.; Curtis, G.D.W. Subtyping of Listeria monocytogenes on the basis of plasmid profiles and arsenic and cadmium susceptibility. J. Appl. Microbiol. 1997, 83, 381–388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Dusza-Dobek, A. Geochemical studies of soils in some city parks of Warsaw. Biul. Państw. Inst. Geol. 2012, 450, 35–46, (In Polish with an English summary). [Google Scholar]
  50. Krogulec, E.; Wierchowiec, J.; Bojakowska, I.; Kwecko, P.; Tomassi-Morawiec, H.; Hrybowicz, G. Objaśnienia do Mapy geośrodowiskowej Polski 1:50 000 Arkusz Kampinos (521). Additional Information to a Geo-Environmental Map of Poland 1:50 000. Sheet Kampinos (521). Available online: http://bazadata.pgi.gov.pl/data/mgsp/txt/mgsp0521.pdf (accessed on 10 October 2020).
  51. Rutkowski, P.; Diatta, J.; Konatowska, M.; Andrzejewska, A.; Tyburski, Ł.; Przybylski, P. Geochemical referencing of natural forest contamination in Poland. Forests 2020, 11, 157. [Google Scholar] [CrossRef] [Green Version]
  52. Chmielowska, C.; Korsak, D.; Szuplewska, M.; Grzelecka, M.; Maćkiw, E.; Stasiak, M.; Macion, A.; Skowron, K.; Bartosik, D. Benzalkonium chloride and heavy metal resistance profiles of Listeria monocytogenes strains isolated from fish, fish products and food-producing factories in Poland. Food Microbiol. 2020. in review. [Google Scholar]
  53. Fox, E.M.; Allnutt, T.; Bradbury, M.I.; Fanning, S.; Chandry, P.S. Comparative genomics of the Listeria monocytogenes ST204 subgroup. Front. Microbiol. 2016, 7, 2057. [Google Scholar] [CrossRef] [Green Version]
  54. Schmitz-Esser, S.; Müller, A.; Stessl, B.; Wagner, M. Genomes of sequence type 121 Listeria monocytogenes strains harbor highly conserved plasmids and prophages. Front. Microbiol. 2015, 6, 380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. den Bakker, H.C.; Bowen, B.M.; Rodriguez-Rivera, L.D.; Wiedmann, M. FSL J1-208, a virulent uncommon phylogenetic lineage IV Listeria monocytogenes strain with a small chromosome size and a putative virulence plasmid carrying internalin-like genes. Appl. Environ. Microbiol. 2012, 78, 1876–1889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Platt, R.; Drescher, C.; Park, S.-K.; Phillips, G.J. Genetic system for reversible integration of DNA constructs and lacZ gene fusions into the Escherichia coli chromosome. Plasmid 2000, 43, 12–23. [Google Scholar] [CrossRef] [PubMed]
  57. Bishop, D.K.; Hinrichs, D.J. Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J. Immunol. 1987, 139, 2005–2009. [Google Scholar]
  58. Huang, B.; Eglezos, S.; Heron, B.A.; Smith, H.; Graham, T.; Bates, J.; Savill, J. Comparison of multiplex PCR with conventional biochemical methods for the identification of Listeria spp. isolates from food and clinical samples in Queensland, Australia. J. Food Prot. 2007, 70, 1874–1880. [Google Scholar] [CrossRef]
  59. Lane, D. 16S/23S rRNA Sequencing. In Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E., Goodfellow, M., Eds.; John Wiley and Sons: New York, NY, USA, 1991; pp. 115–176. [Google Scholar]
  60. Sambrook, J.; Green, M. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2012. [Google Scholar]
  61. Anderson, D.G.; McKay, L.L. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl. Environ. Microbiol. 1983, 46, 549–552. [Google Scholar] [CrossRef] [Green Version]
  62. Margolles, A.; De Los Reyes-Gavilán, C.G. Characterization of plasmids from Listeria monocytogenes and Listeria innocua strains isolated from short-ripened cheeses. Int. J. Food Microbiol. 1998, 39, 231–236. [Google Scholar] [CrossRef]
  63. Glaser, P.; Frangeul, L.; Buchrieser, C.; Rusniok, C.; Amend, A.; Baquero, F.; Berche, P.; Bloecker, H.; Brandt, P.; Chakraborty, T.; et al. Comparative genomics of Listeria species. Science 2001, 294, 849–852. [Google Scholar]
  64. Philippe, N.; Alcaraz, J.P.; Coursange, E.; Geiselmann, J.; Schneider, D. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 2004, 51, 246–255. [Google Scholar] [CrossRef]
  65. Dziewit, L.; Adamczuk, M.; Szuplewska, M.; Bartosik, D. DIY series of genetic cassettes useful in construction of versatile vectors specific for Alphaproteobacteria. J. Microbiol. Methods 2011, 86, 166–174. [Google Scholar] [CrossRef] [PubMed]
  66. Haima, P.; Bron, S.; Venema, G. The effect of restriction on shotgun cloning and plasmid stability in Bacillus subtilis Marburg. Mol. Gen. Genet. MGG 1987, 209, 335–342. [Google Scholar] [CrossRef] [PubMed]
  67. Kovach, M.E.; Elzer, P.H.; Hill, D.S.; Robertson, G.T.; Farris, M.A.; Roop, R.M.; Peterson, K.M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 1995, 166, 175–176. [Google Scholar] [CrossRef]
  68. Ditta, G.; Stanfield, S.; Corbin, D.; Helinski, D.R. Broad host range DNA cloning system for Gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 1980, 77, 7347–7351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  70. Wattam, A.R.; Davis, J.J.; Assaf, R.; Boisvert, S.; Brettin, T.; Bun, C.; Conrad, N.; Dietrich, E.M.; Disz, T.; Gabbard, J.L.; et al. Improvements to PATRIC, the all-bacterial Bioinformatics Database and Analysis Resource Center. Nucleic Acids Res. 2017, 45, D535–D542. [Google Scholar] [CrossRef] [PubMed]
  71. Rutherford, K.; Parkhill, J.; Crook, J.; Horsnell, T.; Rice, P.; Rajandream, M.-A.; Barrell, B. Artemis: Sequence visualization and annotation. Bioinformatics 2000, 16, 944–945. [Google Scholar] [CrossRef] [Green Version]
  72. Sullivan, M.J.; Petty, N.K.; Beatson, S.A. Easyfig: A genome comparison visualizer. Bioinformatics 2011, 27, 1009–1010. [Google Scholar] [CrossRef]
  73. Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef] [Green Version]
  74. Tansirichaiya, S.; Rahman, M.A.; Roberts, A.P. The Transposon Registry. Mob. DNA 2019, 10, 40. [Google Scholar] [CrossRef]
  75. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  76. Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  78. Bal, N.; Wu, C.C.; Catty, P.; Guillain, F.; Mintz, E. Cd2+ and the N-terminal metal-binding domain protect the putative membranous CPC motif of the Cd2+-ATPase of Listeria monocytogenes. Biochem. J. 2003, 369, 681–685. [Google Scholar] [CrossRef]
Ijms 21 08713 g001 550
Figure 1. Resistance profiles, resistance determinants, and plasmids identified in Listeria spp. strains isolated from soil samples. Identified determinants conferring resistance to cadmium (cadA1, cadA4, cadA6) and arsenic (Tn554-associated arsA, LGI2-associated arsA); ND—undetermined resistance gene. The number of strains carrying identified resistance determinants and plasmids (representing 19 RFLP groups: p1–p19) is given in parentheses. The total number of strains within a species is indicated by the extent of the gray bar (n). Strains harboring Tn554-associated arsA genes, but not classified as resistant to arsenic, are indicated in gray.
Figure 1. Resistance profiles, resistance determinants, and plasmids identified in Listeria spp. strains isolated from soil samples. Identified determinants conferring resistance to cadmium (cadA1, cadA4, cadA6) and arsenic (Tn554-associated arsA, LGI2-associated arsA); ND—undetermined resistance gene. The number of strains carrying identified resistance determinants and plasmids (representing 19 RFLP groups: p1–p19) is given in parentheses. The total number of strains within a species is indicated by the extent of the gray bar (n). Strains harboring Tn554-associated arsA genes, but not classified as resistant to arsenic, are indicated in gray.
Ijms 21 08713 g001
Ijms 21 08713 g002 550
Figure 2. Comparative analysis of plasmids pLIS4 (L. seeligeri Sr12), pLIS5 (L. seeligeri Sr73) and pLIS6 (L. ivanovii Sr11). Plasmid sequences were aligned and visualized using EasyFig. Gray shading indicates conserved DNA regions with at least 75% nucleotide sequence identity of at least 1 kb in length. A simplified structure of the plasmids is presented, showing only the putative REP, PAR, TA, TRA modules, partial or complete transposase/recombinase genes and heavy-metal resistance determinants.
Figure 2. Comparative analysis of plasmids pLIS4 (L. seeligeri Sr12), pLIS5 (L. seeligeri Sr73) and pLIS6 (L. ivanovii Sr11). Plasmid sequences were aligned and visualized using EasyFig. Gray shading indicates conserved DNA regions with at least 75% nucleotide sequence identity of at least 1 kb in length. A simplified structure of the plasmids is presented, showing only the putative REP, PAR, TA, TRA modules, partial or complete transposase/recombinase genes and heavy-metal resistance determinants.
Ijms 21 08713 g002
Ijms 21 08713 g003 550
Figure 3. Percentage amino acid sequence identity (pairwise) of different CadA cadmium resistance determinant variants: CadA1 (GenBank acc. no. WP_003728466.1), CadA2 (WP_003726381), CadA3 (WP_010989665.1), CadA4 (WP_003744464.1), CadA5 (WP_047584121.1), CadA6a (plasmid pLIS4) and CadA6b (plasmid pLIS6).
Figure 3. Percentage amino acid sequence identity (pairwise) of different CadA cadmium resistance determinant variants: CadA1 (GenBank acc. no. WP_003728466.1), CadA2 (WP_003726381), CadA3 (WP_010989665.1), CadA4 (WP_003744464.1), CadA5 (WP_047584121.1), CadA6a (plasmid pLIS4) and CadA6b (plasmid pLIS6).
Ijms 21 08713 g003
Ijms 21 08713 g004 550
Figure 4. Comparative analysis of transposons Tn6869 (L. seeligeri Sr12), Tn6870 (L. ivanovii Sr11), Tn6871 (L. seeligeri Sr73), and Tn6947 (L. monocytogenes CDPHFDLB-FM17-00092), harboring the cadA6 cadmium resistance cassette. Sequences were aligned and visualized using EasyFig. Tn6870 present in L. monocytogenes CFSAN044793 (GenBank acc. no. NZ_NYDG01000002) and Tn6871 from L. monocytogenes 2842STDY5753863 (NZ_FFER01000001.1) were included in the analysis. Gray shading indicates DNA regions with at least 75% nucleotide sequence identity of at least 100 bp in length. The sequences of direct repeats flanking the transposons are shown beneath each diagram. The inverted repeat sequences are not identical (no. of identical base pairs/total length of IR): Tn6869 (22/30), Tn6870 (39/48), Tn6871 (41/47), Tn6947 (35/38).
Figure 4. Comparative analysis of transposons Tn6869 (L. seeligeri Sr12), Tn6870 (L. ivanovii Sr11), Tn6871 (L. seeligeri Sr73), and Tn6947 (L. monocytogenes CDPHFDLB-FM17-00092), harboring the cadA6 cadmium resistance cassette. Sequences were aligned and visualized using EasyFig. Tn6870 present in L. monocytogenes CFSAN044793 (GenBank acc. no. NZ_NYDG01000002) and Tn6871 from L. monocytogenes 2842STDY5753863 (NZ_FFER01000001.1) were included in the analysis. Gray shading indicates DNA regions with at least 75% nucleotide sequence identity of at least 100 bp in length. The sequences of direct repeats flanking the transposons are shown beneath each diagram. The inverted repeat sequences are not identical (no. of identical base pairs/total length of IR): Tn6869 (22/30), Tn6870 (39/48), Tn6871 (41/47), Tn6947 (35/38).
Ijms 21 08713 g004
Table
Table 1. Primers used in PCRs to amplify resistance determinants.
Table 1. Primers used in PCRs to amplify resistance determinants.
PrimerSequence (5′→3′)Annealing [Tm, °C ]Amplified DNA FragmentReference
Targeted Gene (Original Source)Size [bp]
Identification of Resistance Determinants by PCR
cadA1-F
cadA1-R		CAGAGCACTTTACTGACCATCAATCGTT
CTTCTTCATTTAACGTTCCAGCAAAAA		53cadA1 (Tn5422)594[16]
cadA2-F
cadA2-R		ACAAGTTAGATCAAAAGAGTCTTTTATT
ATCTTCTTCATTTAGTGTTCCTGCAAAT		53cadA2 (plM80)590[16]
cadA3-F
cadA3-R		GCGATGATTGATAATGTCGATTACAAAT
TGGTAATTTCTTTAAGTCATCTCCCATT		52cadA3 (ICELm1 of EGD-e strain)468[16]
cadA4-F
cadA4-R		GCATACGTACGAACCAGAAG
CAGTGTTTCTGCTTTTGCTCC		51cadA4 (genomic island LGI2)1135[14]
cadA5-F
cadA5-R		GTGATTGTTAATAGGCAGGAAG
GTGGTATACCCAACATTG		47cadA5 (genomic island LGI2-1)1178[52]
cadA6-F
cadA6-R		ACTTGTACAAACTGTGCATC
AGTAATGTTGCTCCCATATCG		51cadA6 (pLIS4, pLIS6)2027This study
arsA1-F
arsA1-R		CAACTTTGACCCTGTGGAG
CTTTCCATTCAATCACTGCG		50arsA1 (genomic island LGI2)1466[14]
arsA2-F
arsA2-R		CAACCAGATCAGTTACCATTAAC
TGCTTCTCCAGAGATTTCTTCTG		50arsA2 (genomic island LGI2)1710[14]
arsATn554F
arsATn554R		TAACCAATAAGCCAACACCG
CTTCTTTCCACTTCCCGAGC		64arsA (Tn554–like transposon)1219[15]
FB001
LM2004		CACACTGTAATGTTAACTGG
TCCAAGTGCTGAGAATATAC		47ctpA (plasmid-associated)396[39]
Cloning of cadA6 Genes
cadA6aF
cadA6aR		GCGACTAGTGCGCCCTCTAATGGAATAAC
ATGCGGCCGCTGCTTCTCGCTTCTTTGC		49cadA6a and cadC6a cassette
(pLIS4, strain Sr12)		2843This study
cadA6bF
cadA6bR		CGCGACTAGTTCTCCAGGTCTCAATTTGTC
AAGCGGCCGCCCACAAAAGGTGCTTAGTTC		49cadA6b and cadC6b cassette
(pLIS6 strain Sr11)		3072This study
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chmielowska, C.; Korsak, D.; Szmulkowska, B.; Krop, A.; Lipka, K.; Krupińska, M.; Bartosik, D. Genetic Carriers and Genomic Distribution of cadA6—A Novel Variant of a Cadmium Resistance Determinant Identified in Listeria spp. Int. J. Mol. Sci. 2020, 21, 8713. https://doi.org/10.3390/ijms21228713

AMA Style

Chmielowska C, Korsak D, Szmulkowska B, Krop A, Lipka K, Krupińska M, Bartosik D. Genetic Carriers and Genomic Distribution of cadA6—A Novel Variant of a Cadmium Resistance Determinant Identified in Listeria spp. International Journal of Molecular Sciences. 2020; 21(22):8713. https://doi.org/10.3390/ijms21228713

Chicago/Turabian Style

Chmielowska, Cora, Dorota Korsak, Barbara Szmulkowska, Alicja Krop, Kinga Lipka, Martyna Krupińska, and Dariusz Bartosik. 2020. "Genetic Carriers and Genomic Distribution of cadA6—A Novel Variant of a Cadmium Resistance Determinant Identified in Listeria spp." International Journal of Molecular Sciences 21, no. 22: 8713. https://doi.org/10.3390/ijms21228713

APA Style

Chmielowska, C., Korsak, D., Szmulkowska, B., Krop, A., Lipka, K., Krupińska, M., & Bartosik, D. (2020). Genetic Carriers and Genomic Distribution of cadA6—A Novel Variant of a Cadmium Resistance Determinant Identified in Listeria spp. International Journal of Molecular Sciences, 21(22), 8713. https://doi.org/10.3390/ijms21228713

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop