Next Article in Journal
Review of Harmful Algal Blooms in the Coastal Mediterranean Sea, with a Focus on Greek Waters
Next Article in Special Issue
Historical Zooplankton Composition Indicates Eutrophication Stages in a Neotropical Aquatic System: The Case of Lake Amatitlán, Central America
Previous Article in Journal
Evolution, Homology, and Development of Tetrapod Limb Muscles
Previous Article in Special Issue
Mammal Species Richness at a Catena and Nearby Waterholes during a Drought, Kruger National Park, South Africa
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 13
Issue 8
10.3390/d13080394
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integrative Descriptions of Two New Tardigrade Species along with the New Record of Mesobiotus skorackii Kaczmarek et al., 2018 from Canada

by
Pushpalata Kayastha
1,
Milena Roszkowska
1,2,
Monika Mioduchowska
3,4,
Magdalena Gawlak
5 and
Łukasz Kaczmarek
1,*
1
Department of Animal Taxonomy and Ecology, Faculty of Biology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland
2
Department of Bioenergetics, Faculty of Biology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland
3
Department of Genetics and Biosystematics, Faculty of Biology, University of Gdańsk, Wita Stwosza 59, 80-308 Gdańsk, Poland
4
Department of Marine Plankton Research, Institute of Oceanography, University of Gdańsk, Marszałka Piłsudskiego 46, 81-378 Gdynia, Poland
5
Institute of Plant Protection—National Research Institute, Władysława Węgorka 20, 60-318 Poznań, Poland
*
Author to whom correspondence should be addressed.
ZooBank: http://zoobank.org/urn:lsid:zoobank.org:act:F4ACE4EB-4872-43C8-8997-BD40CCBE17EE.
ZooBank: http://zoobank.org/urn:lsid:zoobank.org:act:5617E45B-865A-42DA-A70A-DB6FE1A52163.
Diversity 2021, 13(8), 394; https://doi.org/10.3390/d13080394
Submission received: 20 July 2021 / Revised: 18 August 2021 / Accepted: 19 August 2021 / Published: 22 August 2021
(This article belongs to the Special Issue Selected Papers from 1st International Electronic Conference on Biological Diversity, Ecology, and Evolution (BDEE 2021))
Browse Figures
Versions Notes

Abstract

:
Two new tardigrade species from a moss sample collected in Canada, one representing Macrobiotus hufelandi complex and the second one belonging to the genus Bryodelphax, are described. Integrative analysis was undertaken based on morphological and morphometric data (using both light and scanning electron microscopy (SEM)) combined with multilocus molecular analysis (nuclear sequences, i.e., 18S rRNA, 28S rRNA and ITS-2 as well as mitochondrial COI barcode sequences). Based on COI sequences, Macrobiotus birendrai sp. nov. is most similar to Mac. canaricus (p-distance 17%), whereas Bryodelphax mareki sp. nov. is most similar to Bry. parvulus (p-distance 16%). Both species differ also from their congeners in some morphological and morphometric characters of adults and/or details of egg chorion. Additionally, a large population of Mesobiotus skorackii was found in the sample and this is the first report of this species outside its terra typica in Kirghizia. The original description of this species was prepared based solely on the morphology and morphometry, therefore, here we provide updated data for this species enclosing morphometric and molecular data for the Canadian population.

1. Introduction

Canada is the second largest country in the world which extends its longitude from approximately 52° to 141° W to latitude approximately 42° to 83° N. It has such a distance that spans in six time zones and has a wide variety of climates. The highest peak in Canada which is Mount Logan reaches 5959 m asl and the country’s landform structure can be considered a vast basin. Additionally, people living in two-thirds of the area experience very cold winters and short, cool summers. However, the interior plains of central southern area come with very cold winters, hot summers, and relatively sparse precipitation. Nonetheless, climate with hot, humid summers and cold, snowy winters also prevails in Southern Ontario and Quebec. Except for the west coast, all of Canada has a winter season with average temperatures below freezing and with continuous snow cover (https://www.britannica.com/place/Canada (accessed on 18 June 2021).
Tardigrada, also commonly known as water bears, inhabit in terrestrial and aquatic (freshwater and marine) environments. They can be found on aquatic plants and/or in lichens, leaf litter, mosses, soil, sediments [1,2,3]. To date, more than ca. 1300 species of tardigrades have been described throughout the world [4,5,6,7]. The genus Bryodelphax [8] is unique amongst Echiniscidae with some peculiar apomorphies like presence of 10 peribuccal papulae and plesiomorphies like ancestral type of the buccal apparatus, which makes Bryodelphax a good example of mosaic evolution in tardigrades [9,10]. Moreover, it is characterized by the presence of median plates 1 and 2 divided, median plate 3 not divided, and absence of notches on terminal plate. Up to now, 26 species were attributed to this genus [7]. The genus Macrobiotus [11] is one of the most species-rich and widespread genus in the phylum being also, the first formally described tardigrade genus. It is characterized by the presence of a rigid buccal tube with a straight ventral lamina lacking a ventral hook, 10 peribuccal lamellae, pharynx with two macroplacoids and microplacoid, symmetrical diploclaws and freely laid ornamented eggs [12]. Up to now, 118 species were attributed to this genus [7].
Tardigrade fauna of Canada is rather poorly known and up to now only 121 species have been reported from this region [13,14]. In this study, we applied integrative taxonomy for description of two new species from Canada belonging to the genus Bryodelphax and the Macrobiotus hufelandi complex. Moreover, we enriched this paper in additional molecular and morphometric data of the Canadian record of Mesobiotus skorackii Kaczmarek, Zawierucha, Buda, Stec, Gawlak, Michalczyk and Roszkowska [15], as the original description of this species was prepared based solely on the morphology and morphometry.

2. Materials and Methods

2.1. Sampling

A moss sample was collected in Banff National Park (AB, Canada) in March 2019. It was then packed in a paper envelope, dried at a temperature of ca. 20 °C and delivered to the Department of Animal Taxonomy and Ecology at the Faculty of Biology, Adam Mickiewicz University in Poznań (Poland). The tardigrade collection, extraction and mounting techniques followed the protocol of Stec et al. [16].

2.2. Microscopy and Imaging

In total, 163 animals (74 Bryodelphax mareki sp. nov. + 45 Macrobiotus birendrai sp. nov. + 44 Mesobiotus skorackii) and 31 eggs (12 Macrobiotus birendrai sp. nov + 19 Mesobiotus skorackii) were mounted on microscope slides in the Hoyer’s medium, and then examined under Olympus BX41 Phase Contrast light Microscope (PCM) associated with Olympus SC50 digital camera (Olympus Corporation, Shinjuku-ku, Japan). The 44 animals and 8 eggs were prepared for scanning electron microscopy (SEM) analysis according to the protocol in Roszkowska et al. [17] and examined under high vacuum in Hitachi S3000N SEM. Thirty-one specimens were prepared for genotyping.
All figures were assembled in Corel Photo-Paint 2017. For deep structures that could not be fully focused in a single photograph, a series of 2–10 images were taken every ca. 0.5 μm and then manually assembled into a single deep-focus image in Corel Photo-Paint 2017.

2.3. Morphometrics and Morphological Nomenclature

All measurements are given in micrometers (μm]). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding hind legs. The sp index in Bryodelphax is the ratio of the length of a given structure to the length of the scapular plate expressed as a percentage (length of structure × 100⁄length scapular plate) [18] and later independently proposed as the psc index by Fontoura and Morais [19]. Ventral plates configuration in Bryodelphax is given according to Kaczmarek et al. [20]. The types of bucco-pharyngeal apparatuses and claws of Macrobiotidae were classified according to Pilato and Binda [21]. All measurements and terminology of adults and eggs of Macrobiotidae were prepared according to Kaczmarek and Michalczyk [22] and Kaczmarek et al. [23]. Terminology describing the oral cavity armature (OCA) in Macrobiotus and Mesobiotus follows Michalczyk and Kaczmarek [24] and OCA morphotypes are given according to Kaczmarek and Michalczyk [22]. The macroplacoid length sequence in Macrobiotus and Mesobiotus was indicated according to Kaczmarek et al. [25]. The pt ratio is the ratio of the length of a given structure to the length of the buccal tube expressed as a percentage [26]. The terminology of cuticular bars in macrobiotid legs follows Kiosya et al. [27]. The classification of type of egg process, sculpture on egg processes, egg processes bases and egg shell surface between processes are given according to Kaczmarek et al. [23]. Genus abbreviations follow Perry et al. [28].
Morphometric data were handled using the “Parachela” ver. 1.8 and “Echiniscoidea” ver. 1.4 template available from the Tardigrada Register [29].

2.4. Comparative Material

For identification and differentiation of the new species, the key by Gąsiorek et al. [30] for the genus Bryodelphax and the key by Kaczmarek and Michalczyk [22] for the genus Macrobiotus were used. We also compared our new species with the type material of Bry. aaseae Kristensen, Michalczyk and Kaczmarek [9], Bry. asiaticus Kaczmarek and Michalczyk [31], Bry. brevidentatus Kaczmarek, Michalczyk and Degma [32], Bry. olszanowskii Kaczmarek, Parnikoza, Gawlak, Esefeld, Peter, Kozeretska and Roszkowska [33], Bry. parvuspolaris Kaczmarek, Zawierucha, Smykla and Michalczyk [20], Mac. dulciporus Roszkowska, Gawlak, Draga and Kaczmarek [34], Mac. kazmierskii Kaczmarek and Michalczyk, [35], Mac. marlenae Kaczmarek and Michalczyk [36], Mac. paulinae Stec, Smolak, Kaczmarek and Michalczyk [16], Mac. pisacensis Kaczmarek, Cytan, Zawierucha, Diduszko and Michalczyk [25], Mac. polonicus Pilato, Kaczmarek, Michalczyk and Lisi [37], Mac. polypiformis Roszkowska, Ostrowska, Stec, Janko and Kaczmarek [38], Mac. porifini Kuzdrowska, Mioduchowska, Gawlak, Bartylak, Kepel, Kepel and Kaczmarek [39], Mac. sottilei Pilato, Kiosya, Lisi and Sabella [40] and Mac. wandae Kayastha, Berdi, Miaduchowska, Gawlak, Łukasiewicz, Gołdyn and Kaczmarek [41].

2.5. Genotyping

Prior to DNA extraction, individual tardigrades from the three species were preliminarily identified in vivo using light microscopy (LM). Genomic DNA was extracted using a Chelex®® 100 resin (Bio-Rad, Hercules, CA, USA) extraction method [42] with modification in order to obtain voucher specimens, i.e., tardigrade exoskeletons [43]. After DNA extraction we performed morphological analysis following the protocol of Kaczmarek et al. [43]. Then, all exoskeletons were deposited in the collection of the Department of Animal Taxonomy and Ecology, Faculty of Biology, Adam Mickiewicz University in Poznań.
In total, four molecular markers were amplified: one mitochondrial gene, i.e., COI—the cytochrome oxidase subunit I; three nuclear markers, i.e., 18S rRNA—the small ribosome subunit and 28S rRNA—the large ribosome subunit as well as ITS-2—the internal transcribed spacer-2. The polymerase chain reaction (PCR) amplification was performed according to Kaczmarek et al. [44]. The sequences of primers applied to amplify molecular markers are listed in Table 1. All PCR reactions were conducted in a Biometra TProfessional thermocycler. Prior to the sequencing, the PCR products were treated with the FastAP Alkaline Phosphatase and thermosensitive Exonuclease I (Fermentas, Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s guidelines. Sanger DNA sequencing in both directions was performed by Macrogen (Amsterdam, The Netherlands).

2.6. Comparative Genetic Analysis

Obtained mtDNA and nrDNA sequences were quality checked and consensus sequences were created for individual tardigrades in BioEdit v. 7.2.5 [49]. All COI sequences were translated into amino acid sequences to check against pseudogenes using the EMBOSS-TRANSEQ application [50,51]. The translation was performed with the invertebrate mitochondrial codon table. To verify the homology of the amplified DNA region, Basic Local Alignment Search Tool [52] searches at the National Centre for Biotechnology Information NCBI were applied.
All obtained sequences were deposited in GenBank and the accession numbers are listed in Table 2.
For molecular comparisons, all sequences of the mtDNA and nrDNA fragments of the genera Bryodelphax, Macrobiotus and Mesobiotus were downloaded from the GenBank and trimmed to the same length in BioEdit v. 7.2.5. The COI sequences could be unambiguously aligned without inserting gaps. In turn, the sequences of nrDNA were aligned using ClustalW Multiple Alignment tool [53] implemented in BioEdit v. 7.2.5. with default settings. Uncorrected pairwise distances were calculated using MEGA X [54].

3. Results

Taxonomic Account

Phylum: Tardigrada Doyère, 1840 [55]
Class: Heterotardigrada Marcus, 1927 [56]
Order: Echiniscoidea Richters, 1926 [57]
Family: Echiniscidae Thulin, 1928 [8]
Genus: Bryodelphax Thulin, 1928 [8]
Bryodelphax mareki sp. nov.
(Table 3, Figure 1, Figure 2, Figure 3 and Figure 4)
LSID http://zoobank.org/urn:lsid:zoobank.org:act:F4ACE4EB-4872-43C8-8997-BD40CCBE17EE
Type Locality: 51°24′21″ N, 116°14′27″ W, 1900 m asl, Canada, Alberta, Banff National Park, near east end of the Louise Lake, moss on stone, May 2019, leg. Milena Roszkowska and Łukasz Kaczmarek.
Material examined: The 74 animals, i.e., holotype + 73 paratypes (females: 37; undefined sex: 34 and 2 exuviae) mounted on microscope slides in Hoyer’s medium, 40 animals prepared for SEM and 20 animals prepared for molecular analyses (not included in the type series). However, DNA sequences were obtained from only five specimens (exoskeletons) which was later mounted on microscope slide in Hoyer’s medium and included into type series.
Type depositories: Holotype (CN8.62) and 76 paratypes (slides: CN8.*, where the asterisk can be substituted by any of the following numbers: 46–55, 65–66, 17/S, 21/S, 22/S, 25/S, 28/S) are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland. Two paratypes (two females; slides CN8.63 and CN8.64) are deposited in the Natural History Museum of Denmark, University of Copenhagen.
Etymology: The authors would like to dedicate this species to famous biochemist and last author’s friend—Professor Marek Michalak, Faculty of Medicine and Dentistry, Biochemistry Department, University of Alberta, Edmonton, AB, Canada.
Description of the new species
Adult females (measurements and statistics in Table 3). Body light yellow in live specimens (transparent after mounting in Hoyer’s medium) (Figure 1A–C), eyes absent or not visible after mounting on microscope slides. Small and conical primary and secondary clavae present. Cirri internus and externus with poorly developed cirrophores. Cirri internus always shorter than cirri externus. Cirri A of a typical length for Bryodelphax, i.e., up to 25% of the total body length. Only lateral appendages cirri A present apart from head appendages.
Dorsal sculpture, visible in PCM, composed of intra-cuticular pillars (visible as dark dots/granules) and pores (visible as white dots) (Figure 2A–C). The cuticular pillars (granules) on scapular plate 0.6–1.8 μm in diameter, on caudal plate 0.6–1.6 μm in diameter and on other plates 0.6–1.4 μm in diameter. Pores large and easily detectable (Figure 2A–D), distributed unevenly on scapular plate (0.3–0.6 μm in diameter; 0–14 pores/100 μm2, x ¯ = 7.5, N = 10); on caudal plate (0.6–1.0 μm in diameter; 0–19 pores/100 μm2, x ¯ = 4.44, N = 10) and on other plates (0.3–0.8 μm in diameter; 1–16 pores/100 μm2, x ¯ = 6.3, N = 10). Median plates 1 and 2 divided by smooth transverse stripe, median plate 3 undivided. Median plate 2 largest among all median plates. Paired plates 1 and 2 also divided transversely into two parts by smooth stripes.
Ventral side with three rows of greyish plates (formula: III:2-2-1). First row with two plates just below the head (Figure 3A,D, filled arrowheads). Three genital plates surrounding the gonopore (two lateral, in line with the gonopore) and the third one situated posteriorly to the gonopore (Figure 3B–D, empty arrowheads)).
Papilla-like structure on leg I hardly visible under PCM but visible in SEM (Figure 1C and Figure 4A,B, arrow). Papillae on leg IV present (Figure 1C and Figure 4D, arrowhead). Dentate collar absent on leg IV (Figure 1A–C). All claws slender, claws IV always slightly longer than claws I–III. External claws smooth, internal ones with a small spur pointing downward and placed very close to the claw bases (Figure 4A–D). The female gonopore with the typical six-petal rosette.
Males and Juveniles. Not found.
DNA sequences
COI: three sequences; 584–672 bp;
18S rRNA: two sequences; 528 bp long;
28S rRNA: two sequences; 671 bp long.
Differential diagnosis. Presence of ventral plates attributes Bryodelphax mareki sp. nov. to the weglarskae group. Within this group, only Bry. amphoterus (Durante Pasa and Maucci [58]), Bry. maculatus Gąsiorek, Stec, Morek, Marnissi and Michalczyk [58] and Bry. nigripunctatus Degma, Gąsiorek, Vončina and Michalczyk [30] have a reduced number of ventral plate rows to two or three, as in the new species [30]. Adult females of Bry. mareki sp. nov. differ from:
Bry. amphoterus, known only from Croatia and Greece (McInnes [59]), by different formula of ventral plates (III:2-2-1 in the new species vs. II:2-2 in Bry. amphoterus), presence of papilla-like structure on leg I and papillae on leg IV and absence of dentate collar on leg IV.
Bry. maculatus, known only from Tunisia and Greece (Gąsiorek et al. [60]), by higher sc of clava (20.4–33.0 in the new species vs. 11.5–19.1 in Bry. maculaus), longer cirrus A (35.2–46.7 μm in the new species vs. 27.3–34.9 μm in Bry. maculatus), higher sc of cirrus A (174.1–212.9 in the new species vs. 114.8–152.5 in Bry. maculatus) and absence of dentate collar on leg IV.
Bry. nigripunctatus known only from Spain (Gąsiorek et al. [30]), by absence of epicuticular granules, longer clava (4.3–6.2 μm in the new species vs. 2.7–3.1 μm in Bry. nigripunctatus), higher sc of clava (20.4–33.0 in the new species vs. 12.3–16.9 in Bry. nigripunctatus) and presence of papilla-like structure on leg I.
Genetic variability
Aligned sequences (obtained in present study and downloaded from GenBank) were trimmed to 591, 498 and 700 bp for COI (four sequences; two species), 18S rRNA (eight sequences; four species and two sequences of Bryodelphax sp.) and 28S rRNA (14 sequences; seven species and two sequences of Bryodelphax sp.) molecular markers, respectively. Only sequences of Bryodelphax downloaded from GenBank that coincided with our four aforementioned molecular markers were selected.
In the case of the COI molecular marker, only three sequences of Bry. parvulus [8] were available in GenBank. Analysis of the p-distances between our sequences (GenBank accession numbers: MW655785-87) and three sequences of Bry. parvulus was from 16% (GenBank accession numbers: JX683827, JX683826, unpublished) to 18% (GenBank accession number: HM193405 [61]). In the case of the 18S rRNA molecular marker (GenBank accession numbers of our sequences: MW680639-40), no genetic differences were observed when compared with Bry. parvulus (GenBank accession numbers: HM193371 [61]; JX676189, [62]) and p-distance between other sequences, i.e., Bryodelphax sp. (GenBank accession numbers: EU266963 and EF632433 [63]) and Bry. tatrensis [64] (GenBank accession numbers: JX676188 and JX676190 [62]) was 0.01%. The ranges of uncorrected genetic p-distances between our 28S rRNA sequences (GenBank accession numbers: MW680637-38) and the most similar Bry. cf. parvulus (GenBank accession number: MT333466 [30]) was 0.01% and the least similar Bryodelphax sp. (GenBank accession numbers: MH414964 [65]) was 0.16% (see Supplementary Materials—SM1).
Class: Eutardigrada Richters, 1926 [57]
Order: Parachela Schuster, Nelson, Grigarick and Christenberry, 1980 [66]
Superfamily: Macrobiotoidea Thulin, 1928 [8]
Family: Macrobiotidae Thulin, 1928 [8]
Genus: Macrobiotus C.A.S. Schultze, 1834 [11]
Macrobiotus birendrai sp. nov.
(Table 4 and Table 5, Figure 5, Figure 6, Figure 7 and Figure 8)
LSID http://zoobank.org/urn:lsid:zoobank.org:act:5617E45B-865A-42DA-A70A-DB6FE1A52163
Type Locality: 51°24′21″ N, 116°14′27″ W, 1900 m asl, Canada, Alberta, Banff National Park, near east end of the Louise Lake, moss on stone, May 2019, leg. Milena Roszkowska and Łukasz Kaczmarek.
Material examined: The 57 specimens, i.e., holotype (slide: CN8.43) + 56 paratypes (adults: 44 and eggs: 12) were mounted on microscope slides in Hoyer’s medium, four eggs prepared for SEM and five animals prepared for molecular analyses (not included in type series). However, DNA sequences were obtained from one female specimen (exoskeleton) which was later mounted on microscope slide in Hoyer’s medium and included into type series.
Type depositories: Holotype (CN8.43) and 57 paratypes (slides: CN8.*, where the asterisk can be substituted by any of the following numbers: 3, 5–7, 15–17, 21, 29–33, 39, 40, 42–45, 101/S) are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland. Six paratypes (five adults and one egg; slides CN8.41 and CN8.28) are deposited in the Natural History Museum of Denmark, University of Copenhagen.
Etymology: The first author would like to dedicate this species to her father—Birendra Prasad Lal Karna.
Description of the new species.
Adults (measurements and statistics in Table 4). Body transparent after fixation in Hoyer’s medium, eyes present in all fixed specimens (Figure 5A). Entire cuticle covered with conspicuous round and lenticular pores (0.6–1.8 µm in diameter) distributed randomly (Figure 5B). However, larger pores present, on dorsal side, at the anterior and posterior part of the body. Bucco–pharyngeal apparatus of the Macrobiotus type, with ventral lamina and 10 peribuccal lamellae (Figure 6A). Mouth antero-ventral. Oral cavity armature of the hufelandi type, with first and the second band composed of numerous minute teeth (visible as granules in PCM) and third composed of three dorsal and three ventral transverse ridges (Figure 6B–D). Pharyngeal bulb spherical with triangular apophyses, two rod–shaped macroplacoids and a triangular microplacoid. Macroplacoid length sequence 2 < 1 (Figure 6A,E). The first macroplacoid with central constriction (Figure 6E, arrowhead), second with sub-terminal constriction. Claws of the hufelandi type (Figure 7A,B). Primary branches with distinct accessory points. Lunules under claws I–III with hardly visible teeth (visible only in bigger specimens) (Figure 7C, arrowhead) and dentate under claws IV (Figure 7B, arrowhead). Thin single continuous cuticular bars under claws I–III present (Figure 7C, indented arrowhead). Easily visible granulation present on legs I–IV (Figure 7B,D, arrows).
Eggs (measurements and statistics in Table 5). Eggs spherical, ornamented and laid freely with egg chorion of the hufelandi type (Figure 8A,B). Pores of egg surface mesh circular, similar in size and rather small, i.e., 0.2–0.8 μm in diameter (Figure 8C,E,F). Processes in the shape of inverted concave cups with terminal discs (Figure 8D–H). Terminal discs concave with serrated margins or with small irregular teeth (Figure 8D–H).
DNA sequences
We obtained good quality sequences for the applied molecular markers:
COI: single sequence; 609 bp long;
18S rRNA: single sequence; 553 bp long;
28S rRNA: single sequence; 721 bp long;
ITS-2: single sequence; 350 bp long.
Differential diagnosis. Based on egg processes morphology, the new species is most similar to Mac. canaricus Stec et al. [67], Mac. hannae Nowak and Stec [68], Mac. crustulus Stec et al. [12], Mac. joannae Pilato and Binda [69], Mac. kamilae Coughlan and Stec [70], Mac. madegassus Maucci [71], Mac. noemiae Roszkowska and Kaczmarek [72], Mac. noongaris Coughlan and Stec [70], Mac. papei Stec et al. [73], Mac. paulinae Stec et al. [16], Mac. polypiformis Roszkowska et al. [38] and Mac. porifini Kuzdrowska et al. [39], but differs specifically from:
Mac. canaricus Stec, Krzywański and Michalczyk, 2018, known only from the type locality on Canary Islands [67], by a different oral cavity armature (hufelandi type in the new species vs. maculatus type in Mac. canaricus), lunules I-III with hardly visible teeth, larger buccal tube internal width (3.4–5.6 µm in the new species vs. 2.1–3.3 µm in Mac. canaricus), higher pt of placoid row (57.9–67.9 in the new species vs. 42.6–55.3 in Mac. canaricus), larger cuticular pores (0.7–1.8 µm in the new species vs. 0.4–0.7 µm in Mac. canaricus), different egg shell surface (porous shell in the new species vs. mesh shell in Mac. canaricus) and absence of granulation on terminal discs of the egg process.
Mac. crustulus Stec, Dudziak and Michalczyk, 2020, known only from the type locality in French Guiana [12], by a different oral cavity armature (hufelandi type in the new species vs. lissostomus type in Mac. crustulus), lunules I-III with hardly visible teeth, higher pt of stylet support insertion points (78.0–82.8 in the new species vs. 69.3–72.7 in Mac. crustulus), larger buccal tube internal width (3.4–5.6 µm in the new species vs. 1.6–2.7 µm in Mac. crustulus), higher pt of buccal tube external and internal width (13.5–17.0 and 8.7–11.9, respectively, in the new species vs. 9.3–12.2 and 5.1–6.5, respectively, in Mac. crustulus), higher pt of ventral lamina (56.0–66.2 in the new species vs. 46.9–55.8 in Mac. crustulus), different egg shell surface (porous shell in the new species vs. mesh shell in Mac. crustulus), absence of granulation on convex central area of terminal discs and lower number of processes on the egg circumference (22–26 in the new species vs. 26–34 in Mac. crustulus).
Mac. hannae Nowak and Stec, 2018, known only from the type locality in Poland [68], by lunules I-III with hardly visible teeth, larger cuticular pores (0.6–1.8 µm in the new species vs. up to 0.55 µm in Mac. hannae), smaller distance between egg processes (1.0–3.3 µm in the new species vs. 4.0–8.1 µm in Mac. hannae), smaller egg bare diameter (74.9–86.9 µm in the new species vs. 88.6–109.2 µm in Mac. hannae) and absence of granules inside pores around egg processes.
Mac. joannae Pilato and Binda, 1983, known only from the type locality in Australia (Pilato and Binda [69]; see also comments in Nowak and Stec [68]), by lower average pt of stylet support insertion points (80.2 in the new species vs. 81.9 in Mac. joannae), smaller size of macroplacoid 1 and microplacoid (8.2–16.0 and 2.4–4.9 µm, respectively, in the new species vs. 19.3 and 6.4 µm, respectively, in Mac. joannae in specimen of body length 400 µm), smaller size of claws I and II external and internal primary branch (I. 8.5–13.2 and 8.2–12.7 µm, respectively; II. 8.1–14.0 and 8.6–13.6 µm, respectively, in the new species vs. I. 25.0 and 23.5 µm, respectively; II. 27.0 and 24.5 µm, respectively in Mac. joannae in specimen of body length 400 µm) and smaller size of claw IV anterior and posterior primary branch (9.5–15.8 and 8.4–14.2 µm, respectively, in the new species vs. 28.0 and 27.0 µm, respectively, in Mac. joannae in specimen of body length 400 µm).
Mac. kamilae Coughlan and Stec, 2019, known only from the type locality in India [70], by a different oral cavity armature (hufelandi type in the new species vs. patagonicus type in Mac. kamilae), lunules I-III with hardly visible teeth, higher pt of stylet support insertion points (78.0–82.8 in the new species vs. 71.6–75.9 in Mac. kamilae), shorter claws (for details see Table 4 in this paper and Table 4 in Coughlan and Stec [65]), absence of body granulation and absence of scattered granules on the terminal discs of egg process.
Mac. madegassus Maucci, 1993, known only from the type locality in Madagascar [71], by presence of eyes, different oral cavity armature (hufelandi type in the new species vs. maculatus type in Mac. madegassus), presence of cuticular pores, lunules I-III with hardly visible teeth, longer buccal tube (33.2–52.6 µm in the new species vs. up to 30.0 µm in Mac. madegassus), larger buccal tube external width (5.2–8.4 µm in the new species vs. up to 2.1 µm in Mac. madegassus), higher pt of buccal tube external width (13.5–17.0 in the new species vs. 7.0 in Mac. madegassus in specimen of body length 316 µm), longer macroplacoids (I: 8.2–16.0 µm and II: 6.0–11.2 µm in the new species vs. I: up to 6.4 µm and II: up to 3.6 µm in Mac. madegassus in specimen of body length 316 µm), stylet supports inserted in more caudal position (26.2–43.0 µm in the new species vs. up to 20.4 µm in Mac. madegassus in specimen of body length 316 µm), higher pt of stylet support insertion points (78.0–82.8 in the new species vs. up to 68.0 in Mac. madegassus in specimen of body length 316 µm) and lower number of processes on the egg circumference (20–26 in the new species vs. 30–34 in Mac. madegassus).
Mac. noemiae Roszkowska and Kaczmarek, 2019, known only from the type locality in Spain [72], by a different oral cavity armature (hufelandi type in the new species vs. patagonicus type in Mac. noemiae), lunules I-III with hardly visible teeth, higher pt of ventral lamina (56.0–66.2 in the new species vs. 48.4–55.7 in Mac. noemiae), higher pt of macroplacoid row and placoid row (49.1–57.9 and 57.9–67.9, respectively, in the new species vs. 39.2–47.1 and 47.1–57.9, respectively, in Mac. noemiae), smaller egg full and bare diameter (87.8–103.9 and 74.9–86.9 µm, respectively, in the new species vs. 118.5–123.5 100.6–105.7 µm, respectively, in Mac. noemiae), lower number of processes on the egg circumference (20–26 in the new species vs. 30–34 in Mac. noemiae), presence of discs on egg processes and absence of filaments on apisal part of egg processes.
Mac. noongaris Coughlan and Stec, 2019, known only from the type locality in Australia [70], by a different oral cavity armature (hufelandi type in the new species vs. patagonicus type in Mac. noongaris), lunules I-III with hardly visible teeth, larger maximum size of the cuticular pores (up to 1.8 μm in the new species vs. up to 0.8 μm in Mac. noongaris), absence of scattered granulation on the terminal discs of the egg processes, higher mean of egg bare diameter and egg full diameter (82.9 and 96.3 µm, respectively, in the new species vs. 70.7 and 82.1 µm, respectively, in Mac. noongaris), larger mean process height, process base width and terminal disc width (7.9, 6.6 and 4.1 µm, respectively, in the new species vs. 6.2, 5.0 and 3.3 µm, respectively, in Mac. noongaris), and smaller mean inter processes distance (2.1 µm in the new species vs. 3.4 µm in Mac. noongaris).
Mac. papei Stec, Kristensen and Michalczyk, 2018 known only from type locality in Tanzania [73], by a different oral cavity armature (hufelandi type in the new species vs. patagonicus type in Mac. papei), lunules I-III with hardly visible teeth, absence of patches of cuticular granulation on the internal surface of legs I–III, higher pt of macroplacoid II (17.2–22.0 in the new species vs. 10.3–16.2 in Mac. papei), absence of flexible filaments on the terminal disc of the egg processes, lower mean of egg bare diameter and egg full diameter (82.9 and 96.3 µm, respectively, in the new species vs. 95.0 and 109.7 µm, respectively, in Mac. papei), smaller mean terminal disc width (4.1 µm in the new species vs. 4.3 µm in Mac. papei), and smaller mean inter processes distance (2.1 µm in the new species vs. 4.3 µm in Mac. papei).
Mac. paulinae Stec, Smolak, Kaczmarek and Michalczyk, 2015 known only from type locality in Kenya [16], by lack of dorso-lateral patches of granulation, smaller maximum size of cuticular pores (up to 1.8 μm in the new species vs. up to 0.5 μm in Mac. paulinae), different oral cavity armature (hufelandi type in the new species vs. maculatus type in Mac. paulinae), different third band of teeth (three dorsal and three ventral teeth in the new species vs. single dorsal and single ventral tooth in Mac. paulinae), lunules I-III with hardly visible teeth, larger buccal tube external and internal width with higher pt (5.2–8.4 [13.5–17.0] and 3.4–5.6 µm [8.7–11.9], respectively, in the new species vs. 2.2–4.6 µm [8.8–12.6] and vs. 1.0–2.9 µm [3.5–8.1], respectively, in Mac. paulinae), longer ventral lamina (19.9–32.9 µm in the new species vs. 15.0–19.6 µm in Mac. paulinae), longer macroplacoid row with higher pt (16.3–30.2 µm [49.1–57.9] in the new species vs. 9.2–14.4 µm [32.5–40.4] in Mac. paulinae), longer placoid row with higher pt (19.2–35.2 µm [57.9–67.9] in new species vs. 10.8–17.4 µm [37.8–48.9] in Mac. paulinae), larger egg bare and full diameter (74.9–86.9 and 87.8–103.9 µm, respectively, in the new species vs. 57.0–70.5 and 66.3–85.6 µm, respectively, in Mac. paulinae) and absence of filaments on egg processes discs.
Mac. polypiformis Roszkowska, Ostrowska, Stec, Janko and Kaczmarek, 2017 known only from type locality in Ecuador [38], by different oral cavity armature (hufelandi type in the new species vs. maculatus type in Mac. polypiformis), lunules I-III with hardly visible teeth, longer buccal tube (33.2–52.6 µm in the new species vs. 24.4–32.5 µm in Mac. polypiformis), stylet supports inserted in more caudal position with higher pt (26.2–43.0 µm [78.0–82.8] in the new species vs. 17.1–23.5 µm [70.1–72.9] in Mac. polypiformis), larger buccal tube external and internal width and with higher pt (5.2–8.4 [13.5–17.0] and 3.4–5.6 µm [8.7–11.9], respectively, in the new species vs. 2.8–4.0 [11.0–13.0] and 1.6–2.4 µm [6.1–8.6], respectively, in Mac. polypiformis), longer ventral lamina with larger pt (19.9–32.9 µm [56.0–66.2] in the new species vs. 13.5–17.3 µm [52.1–55.1] in Mac. polypiformis), longer macroplacoid 1 (8.2–16.0 µm in the new species vs. 5.2–6.8 µm in Mac. polypiformis), longer macroplacoid 2 with higher pt (6.0–11.2 µm [17.2–22.0] in the new species vs. 2.8–4.1 µm [11.4–14.5] in Mac. polypiformis), longer microplacoid (2.4–4.9 µm in the new species vs. 1.5–2.3 µm in Mac. polypiformis), longer macroplacoid row with higher pt (16.3–30.2 µm [49.1–57.9] in the new species vs. 9.0–11.8 µm [34.3–39.9] in Mac. polypiformis) and longer placoid row with higher pt (19.2–35.2 µm [57.9–67.9] in the new species vs. 11.1–14.5 µm [41.4–49.0] in Mac. polypiformis), larger egg bare and full diameter (74.9–86.9 and 87.8–103.9 µm, respectively, in the new species vs. 61.9–70.5 and 70.4–81.2 µm, respectively, in Mac. polypiformis) and absence of filaments on egg processes discs.
Mac. porifini Kuzdrowska, Mioduchowska, Gawalak, Bartylak, Kepel, Kepel and Kaczmarek 2021 known only from the type locality in Madagascar [39] by presence of eyes, different oral cavity armature (hufelandi type in the new species vs. patagonicus type in Mac. porifini), lunules I-III with hardly visible teeth, presence of dentate lunules on legs IV, higher pt of macroplacoid row (49.1–57.9 in the new species vs. 36.2–47.7 in Mac. porifini), higher pt of placoid row (57.9–67.9 in the new species vs. 43.5–57.7 in Mac. porifini), larger egg bare diameter (74.9–86.9 µm in the new species vs. 72.2–74.0 µm in Mac. porifini), absence of very small irregular granules on the surface of the discs and absence of micro granulation on the teeth of the terminal discs of egg process.
Genetic variability
Aligned sequences (obtained in our study and downloaded from GenBank) were trimmed to 609, 554, 682 and 200 bp for COI (21 sequences selected from GenBank—one sequence per species; (see Supplementary Materials—SM2)), 18S rRNA (20 sequences selected from GenBank—one sequence per species; see Supplementary Materials—SM3), 28S rRNA (16 sequences selected from GenBank—one sequence per species; see Supplementary Materials—SM4) and ITS2 (12 sequences selected from GenBank one sequence per species; see Supplementary Materials—SM5) molecular markers, respectively.
The analysis of the p-distances between our COI sequence (GenBank accession number: MW656266) and sequences of species from the genus Macrobiotus ranged from the most similar 17% for Mac. canaricus (GenBank accession number: MH063925 [67]), to least similar 25% for Mac. kristenseni Guidetti, Peluffo, Rocha, Cesari and Moly de Peluffo [74] (GenBank accession number: KC193575 [74]). In the conservative 18S rRNA gene fragment we observed no differences between our sequence (GenBank accession number: MW680641) and sequences of Mac. hannae (GenBank accession number: HQ604975 [75]). In turn, the uncorrected genetic p-distances between the least similar Mac. polonicus Pilato, Kaczmarek, Michalczyk and Lisi [37] (GenBank accession number: HM187580 [76]) was 4%. The analysis of the p-distances between our sequence of 28S rRNA (GenBank accession number: MW680644) and similar sequences of the genus Macrobiotus are as follows: the most similar was Mac. hannae (GenBank accession number: MH063924, Nowak and Stec [68]) with p-distance of 1% and the least similar was Mac. polypiformis (GenBank accession number: KX810009 [38]) and Mac. scoticus Stec, Morek, Gasiorek, Blagden and Michalczyk [77] (GenBank accession number: KY797266 [68]) with p-distance of 10%. In turn, the ranges of p-distances between our ITS-2 sequence (GenBank accession number: MW680418) and the most similar Mac. hannae (GenBank accession number: MH063923 [68]) was 11% and the least similar was Mac. polypiformis (GenBank accession number: KX810010 [38])—33%.
Genus: Mesobiotus Vecchi, Cesari, Bertolani, Jönsson, Rebecchi and Guidetti, 2016 [78]
Mesobiotus skorackii Kaczmarek, Zawierucha, Buda, Stec, Gawlak, Michalczyk and Roszkowska, 2018 [15]
(Table 6 and Table 7)
Locality: 51°24′21″ N, 116°14′27″ W, 1900 m asl, Canada, Alberta, Banff National Park, near east end of the Louise Lake, moss on stone, May 2019, leg. Milena Roszkowska and Łukasz Kaczmarek.
Material examined: The 63 specimens; 44 animals and 19 eggs were mounted on microscope slides in Hoyer’s medium, four eggs and four animals prepared for SEM and six animals prepared for molecular analyses. However, DNA sequences were obtained from one female specimen (exoskeleton) which was later mounted on microscope slide in Hoyer’s medium and included into type series.
Depositories: All specimens (slides: CN8.*, where the asterisk can be substituted by any of the following numbers: 5–7, 31–40, 42–43, 45, 115/S) are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland.
Short diagnosis:
Adults (measurements and statistics in Table 6). Body white in living animals and transparent after fixation in Hoyer’s medium, eyes present, cuticle smooth. Bucco–pharyngeal apparatus of the Macrobiotus type, with ventral lamina and ten peribuccal lamellae. Mouth antero-ventral. Oral cavity armature of the harmsworthi type. Pharyngeal bulb spherical with triangular apophyses, three rod-shaped macroplacoids and a triangular microplacoid. Macroplacoid length sequence 2 < 3 < 1. The first macroplacoid narrower anteriorly, the second without constrictions and the third with a small, subterminal constriction. Claws of the Mesobiotus type. Lunules under claws I–III smooth and slightly dentated under claws IV. Thin cuticular bars under claws I–III present. Granulation hardly visible on legs I–III, whereas on legs IV always clearly marked.
Eggs (measurements and statistics in Table 7). Eggs laid freely, white and spherical. Egg processes in the shape of short and wide sharpened cones. Egg processes reticulated and surrounded by six areolae delimited by thin brims which are often discontinuous, thus areolae are not always fully formed (semi-areolation). Surface inside the areolae with clearly visible wrinkles.
DNA sequences
We obtained good quality sequences for the applied molecular markers:
COI: single sequence; 631 bp long;
18S rRNA: two sequences; 667–715 bp long;
28S rRNA: single sequence; 735 bp long.
Genetic variability
Aligned sequences (obtained in our study and downloaded from GenBank) were trimmed to 565, 474 and 713 bp for COI (14 sequences, selected from GenBank—one sequence per species; (see Supplementary Materials—SM6)), 18S rRNA (two sequences selected from GenBank—one sequence per species; see below) and 28S rRNA (13 sequences selected from GenBank—one sequence per species) molecular markers, respectively.
The ranges of uncorrected genetic p-distances between obtained COI sequence of Meb. skorackii (GenBank accession number: MW656257) and species of the genus Mesobiotus, for which sequences are available from GenBank, are as follows: 20–26%, with the most similar being Meb. cf. barabanovi (GenBank accession number: MN313170 [23]) and Meb. occultatus Kaczmarek, Zawierucha, Buda, Stec, Gawlak, Michalczyk and Roszkowska, [15] (GenBank accession number: MH195152 [15]) and the least similar being Meb. dilimanensis Itang, Stec, Mapalo, Mirano-Bascos and Michalczyk [79] (GenBank accession number: MN257047 [79]). In case 18S rRNA only two sequences were compared (because other 24 sequences deposited in GenBank were amplified using different sets of primers) and genetic p-distances between Meb. harmsworthi (at present undefined Mesobiotus species; GenBank accession number: MH079462 [66]) and Meb. philippinicus Mapalo, Stec, Mirano-Bascos and Michalczyk [80] (GenBank accession number: KX129793 [80]) was 0.01%. In turn, the ranges of p-distances between obtained 28S rRNA sequence (GenBank accession number: MW680636) and sequences downloaded from GenBank was: 5–13%, with the most similar being Meb. cf. barabanovi (GenBank accession number: MN310388 [23]) as well as Meb. harmsworthi (at present undefined Mesobiotus species; GenBank accession number: MH197264 [66]) and the least similar being Meb. dilimanensis (GenBank accession number: MN257049 [79]) (see Supplementary Materials—SM7).

4. Discussion

Out of 10 provinces and three territories of Canada, limno-terrestrial tardigrades have been reported in eight provinces and two territories. Up to now, no tardigrades have been reported from Northwest Territories, Nova Scotia nor Prince Edward Island. The highest number of tardigrade species were recorded from Nunavut (70) and the lowest Manitoba (only one). Moreover, 18 species were recorded from Alberta, 55 from British Columbia, 33 from New Brunswick, 29 from Newfoundland and Labrador, 12 from Ontario, 13 from Quebec, 3 from Saskatchewan and 5 from Yukon [13,14]. Only one species of the genus Bryodelphax, i.e., Bry. parvulus has been recorded from British Columbia and Nunavut. In case of the genus Macrobiotus, four species i.e., Mac. echinogenitus Richters [81], Mac. hufelandi, Mac. occidentalis Murray [82] and Mac. virgatus Murray [82] were recorded from Alberta, British Columbia, New Brunswick, Newfoundland and Labrador, Nunavut, Ontario and Quebec. Among these, only Mac. hufelandi belongs to the hufelandi group. Three species of the genus Mesobiotus, i.e., Meb. harmsworthi (Murray [83]), Meb. montanus (Murray [82]) and Meb. pilatoi (Binda and Rebecchi [84]) were recorded from Alberta, British Columbia, New Brunswick, Newfoundland and Labrador, Nunavut, Ontario and Quebec [14]. What is more intriguing, some species reported from Canada in the past are now considered as group of species or species with problematic taxonomical status [14].
Summarizing, from Canada only 121 tardigrade species and subspecies are known. Taking into consideration the area of the country (ca. 10 million km2) and its diversity such as habitats and ecosystem, it is obvious that this number is highly underestimated. For comparison, USA, with the similar country area, has more than 220 species reported [14]. This contrast is even more spectacular while comparing Canadian tardigrade fauna with the number of tardigrade species from much smaller areas like e.g., Costa Rica (ca. 51,000 km2 and 63 species known), Finland (ca. 340,000 km2 and 68 species known), Italy (ca. 300,000 km2 and 234 species known) or Poland (ca. 312,000 km2 and 111 species known) [68,85,86,87,88,89]. The number of tardigrade species from Canada is expected to be much higher than reported up to date, especially that in the present study, in one analyzed sample, we found two species new for science and one new record for the country.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/d13080394/s1, SM1—Estimates of evolutionary divergence between 28S rRNA sequences of Bryodelphax mareki sp. nov based on p-distances, SM2—Estimates of evolutionary divergence between COI sequences of Macrobiotus birendrai sp. nov based on p-distances, SM3—Estimates of evolutionary divergence between 18S rRNA sequences of Macrobiotus birendrai sp. nov based on p-distances, SM4—Estimates of evolutionary divergence between 28S rRNA sequences of Macrobiotus birendrai sp. nov based on p-distances, SM5—Estimates of evolutionary divergence between ITS-2 sequences of Macrobiotus birendrai sp. nov based on p-distances, SM6—Estimates of evolutionary divergence between COI sequences of Mesobiotus skorackii based on p-distances, SM7—Estimates of evolutionary divergence between 28S rRNA sequences of Mesobiotus skorackii based on p-distances [13,15,16,17,23,30,38,39,41,60,67,70,73,74,75,76,77,78,79,80,90,91,92,93,94,95,96,97,98,99,100,101,102,103].

Author Contributions

Conceptualization, M.R. and Ł.K.; data curation, P.K.; formal analysis, P.K., M.R., M.M., M.G. and Ł.K.; investigation, P.K. and Ł.K.; methodology, M.R., M.M. and Ł.K.; supervision, Ł.K.; validation, P.K., M.R., M.M. and Ł.K.; visualization, M.R. and M.G.; writing—original draft, P.K., M.M. and Ł.K.; writing—review and editing, P.K., M.R., M.M., M.G. and Ł.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are presented in the article and in SM which are part of article.

Acknowledgments

Milena Roszkowska and Pushpalata Kayastha are scholarship holders of Passport to the future—Interdisciplinary doctoral studies at the Faculty of Biology, Adam Mickiewicz University, Poznań POWR.03.02.00-00-I006/17. The work of Monika Mioduchowska was supported by grant no. 2017/27/B/NZ8/01056 from the National Science Centre, Poland. Studies have been partially conducted in the framework of activities of BARg (Biodiversity and Astrobiology Research group).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ramazzotti, G.; Maucci, W. Il Phylum Tardigrada. III edizione riveduta e aggiornata. Mem. Ist. Ital. Idrobiol. Pallanza 1983, 41, 1–1012. [Google Scholar]
  2. Beasley, C.W. The Phylum Tardigrada, 3rd ed.; English Translation; Ramazzotti, G., Maucci, W., Eds.; Clark Beasley: Abilene, TX, USA, 1995; pp. 1–1014. [Google Scholar]
  3. Nelson, D.R.; Guidetti, R.; Rebecchi, L.; Kaczmarek, Ł.; McInnes, S. Phylum Tardigrada. In Thorp and Covich’s Freshwater Invertebrates; Elsevier: Amsterdam, The Netherlands, 2020; pp. 505–522. [Google Scholar]
  4. Guidetti, R.; Bertolani, R.B. Tardigrade Taxonomy: An updated check list of the taxa and a list of characters for their identification. Zootaxa 2005, 845, 1–46. [Google Scholar] [CrossRef]
  5. Degma, P.; Guidetti, R. Notes to the current checklist of Tardigrada. Zootaxa 2007, 1579, 41–53. [Google Scholar] [CrossRef]
  6. Vicente, F.; Bertolani, R. Considerations on the taxonomy of the Phylum Tardigrada. Zootaxa 2013, 3626, 245–248. [Google Scholar] [CrossRef] [PubMed]
  7. Degma, P.; Bertolani, R.; Guidetti, R. Actual Checklist of Tardigrada Species. Available online: https://iris.unimore.it/retrieve/handle/11380/1178608/357802/Actual%20checklist%20of%20Tardigrada%2040th%20Edition%2015-07-21.pdf (accessed on 15 July 2021).
  8. Thulin, G. Über die phylogenie und das system der tardigraden. Hereditas 1928, 11, 207–266. [Google Scholar] [CrossRef]
  9. Kristensen, R.M.; Michalczyk, Ł.; Kaczmarek, Ł. The first record of the genus Bryodelphax (Tardigrada: Heterotardigrada: Echiniscidae) from Easter Island, Rapa Nui (Pacific Ocean, Chile) with the description of a new species, Bryodelphax aaseae. Zootaxa 2010, 2343, 45–56. [Google Scholar] [CrossRef] [Green Version]
  10. Gąsiorek, P.; Suzuki, A.C.; Kristensen, R.M.; Lachowska-Cierlik, D.; Michalczyk, Ł. Untangling the Echiniscus Gordian knot: Stellariscus gen. nov. (Heterotardigrada: Echiniscidae) from Far East Asia. Invert. Syst. 2018, 32, 1234–1247. [Google Scholar] [CrossRef]
  11. Schultze, C.A.S. Macrobiotus Hufelandii, animal e crustaceorum classe novum, reviviscendi post diuturnam asphyxiam et ariditatem potens; Berolini Apud Carolum Curths: Berlin, Germany, 1834; pp. 1–8. [Google Scholar]
  12. Stec, D.; Dudziak, M.; Michalczyk, Ł. Integrative descriptions of two new Macrobiotidae species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zool. Stud. 2020, 59, e23. [Google Scholar] [CrossRef] [PubMed]
  13. Collins, M.; Goudie, I. The tardigrade and associated micrometazoa of the textured lungwort lichen, Lobaria scrobiculata, in Eastern Newfoundland, Canada. J. Agric. Life Sci. 2020, 7. [Google Scholar] [CrossRef]
  14. Kaczmarek, Ł.; Michalczyk, Ł.; Mcinnes, S.J. Annotated zoogeography of non-marine Tardigrada. Part III: North America and Greenland. Zootaxa 2016, 4203, 1–249. [Google Scholar] [CrossRef]
  15. Kaczmarek, Ł.; Zawierucha, K.; Buda, J.; Stec, D.; Gawlak, M.; Michalczyk, Ł.; Roszkowska, M. An integrative redescription of the nominal taxon for the Mesobiotus harmsworthi group (Tardigrada: Macrobiotidae) leads to descriptions of two new Mesobiotus species from Arctic. PLoS ONE 2018, 13, e0204756. [Google Scholar] [CrossRef] [PubMed]
  16. Stec, D.; Smolak, R.; Kaczmarek, Ł.; Michalczyk, Ł. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: Hufelandi Group) from Kenya. Zootaxa 2015, 4052, 501–526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Roszkowska, M.; Stec, D.; Gawlak, M.; Kaczmarek, Ł. An integrative description of a new tardigrade species Mesobiotus romani sp. nov. (Macrobiotidae: Harmsworthi group) from the Ecuadorian Pacific coast. Zootaxa 2018, 4450, 550–564. [Google Scholar] [CrossRef] [PubMed]
  18. Dastych, H. A new species of the genus Mopsechiniscus Du Bois-Reymond Marcus, 1944 (Tardigrada) from the Venezuelan Andes. Acta Biol. Ben. 1999, 10, 91–101. [Google Scholar]
  19. Fontoura, P.; Morais, P. Assessment of traditional and geometric morphometrics for discriminating cryptic species of the Pseudechiniscus suillus complex (Tardigrada, Echiniscidae). J. Zool. Syst. Evol. Res. 2011, 49, 26–33. [Google Scholar] [CrossRef]
  20. Kaczmarek, Ł.; Zawierucha, K.; Smykla, J.; Michalczyk, Ł. Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biol. 2012, 35, 1013–1026. [Google Scholar] [CrossRef] [Green Version]
  21. Pilato, G.; Binda, M.G. Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa 2010, 2404, 1–54. [Google Scholar] [CrossRef] [Green Version]
  22. Kaczmarek, Ł.; Michalczyk, Ł. The Macrobiotus hufelandi group (Tardigrada) revisited. Zootaxa 2017, 4363, 101–123. [Google Scholar] [CrossRef]
  23. Kaczmarek, Ł.; Bartylak, T.; Stec, D.; Kulpa, A.; Kepel, M.; Kepel, A.; Roszkowska, M. Revisiting the genus Mesobiotus Vecchi et al., 2016 (Eutardigrada, Macrobiotidae)—Remarks, updated dichotomous key and an integrative description of new species from Madagascar. Zool. Anz. 2020, 287, 121–146. [Google Scholar] [CrossRef]
  24. Michalczyk, Ł.; Kaczmarek, Ł. A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada: Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa 2003, 331, 1–24. [Google Scholar] [CrossRef] [Green Version]
  25. Kaczmarek, Ł.; Cytan, J.; Zawierucha, K.; Diduszko, D.; Michalczyk, Ł. Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 2014, 3790, 357–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Pilato, G. Analisi di nuovi caratteri nello studio degli eutardigradi. Animalia 1981, 8, 51–57. [Google Scholar]
  27. Kiosya, Y.; Pogwizd, J.; Matsko, Y.; Vecchi, M.; Stec, D. Phylogenetic position of two Macrobiotus species with a revisional note on Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 (Tardigrada: Eutardigrada: Macrobiotidae). Zootaxa 2021, 4933, 113–135. [Google Scholar] [CrossRef]
  28. Perry, E.; Miller, W.R.; Kaczmarek, Ł. Recommended abbreviations for the names of genera of the phylum Tardigrada. Zootaxa 2019, 4608, 145–154. [Google Scholar] [CrossRef] [PubMed]
  29. Michalczyk, Ł.; Kaczmarek, Ł. The Tardigrada Register: A comprehensive online data repository for tardigrade taxonomy. J. Limnol. 2013, 72, 175–181. [Google Scholar] [CrossRef]
  30. Gąsiorek, P.; Vončina, K.; Degma, P.; Michalczyk, Ł. Small is beautiful: The first phylogenetic analysis of Bryodelphax Thulin, 1928 (Heterotardigrada, Echiniscidae). Zoosystematics Evol. 2020, 96, 217–236. [Google Scholar] [CrossRef]
  31. Kaczmarek, Ł.; Michalczyk, Ł. A new species Bryodelphax asiaticus (Tardigrada: Heterotardigrada: Echiniscidae) from Mongolia (Central Asia). Raffles Bull. Zool. 2004, 599–602. [Google Scholar]
  32. Kaczmarek, Ł.; Michalczyk, Ł.; Degma, P. A new species of Tardigrada Bryodelphax brevidentatus sp. nov. (Heterotardigrada: Echiniscidae) from China (Asia). Zootaxa 2005, 1080, 33–38. [Google Scholar] [CrossRef]
  33. Kaczmarek, Ł.; Parnikoza, I.; Gawlak, M.; Esefeld, J.; Peter, H.-U.; Kozeretska, I.; Roszkowska, M. Tardigrades from Larus dominicanus Lichtenstein, 1823 nests on the Argentine Islands (Maritime Antarctic). Polar Biol. 2018, 41, 283–301. [Google Scholar] [CrossRef] [Green Version]
  34. Roszkowska, M.; Gawlak, M.; Draga, M.; Kaczmarek, Ł. Two new species of Tardigrada from Ecuador (South America). Zootaxa 2019, 4545, 511–530. [Google Scholar] [CrossRef]
  35. Kaczmarek, Ł.; Michalczyk, Ł. Two new species of Macrobiotidae, Macrobiotus szeptyckii (harmsworthi group) and Macrobiotus kazmierskii (hufelandi group) from Argentina. Acta Zool. Cracov.Ser. B Invert. 2009, 52, 87–99. [Google Scholar] [CrossRef] [Green Version]
  36. Kaczmarek, Ł.; Michalczyk, Ł. New records of Tardigrada from Cyprus with a description of the new species Macrobiotus marlenae (Eutardigrada: Macrobiotidae, hufelandi group). Genus 2004, 15, 141–152. [Google Scholar]
  37. Pilato, G.; Kaczmarek, Ł.; Michalczyk, Ł.; Lisi, O. Macrobiotus polonicus, a new species of Tardigrada from Poland (Eutardigrada: Macrobiotidae, ‘hufelandi group’). Zootaxa 2003, 258, 1–8. [Google Scholar] [CrossRef]
  38. Roszkowska, M.; Ostrowska, M.; Stec, D.; Janko, K.; Kaczmarek, Ł. Macrobiotus polypiformis sp. nov., a new tardigrade (Macrobiotidae; hufelandi group) from the Ecuadorian Pacific coast, with remarks on the claw abnormalities in eutardigrades. Eur. J. Taxon. 2017, 327. [Google Scholar] [CrossRef] [Green Version]
  39. Kuzdrowska, K.A.; Mioduchowska, M.; Gawlak, M.; Bartylak, T.; Kepel, A.; Kepel, M.; Kaczmarek, Ł. Integrative description of Macrobiotus porifini sp. nov. (Macrobiotidae) from Madagascar and its phylogenetic position within the hufelandi group. Eur. Zool. J 2021, 88, 375–389. [Google Scholar] [CrossRef]
  40. Pilato, G.; Kiosya, Y.; Lisi, O.; Sabella, G. New records of Eutardigrada from Belarus with the description of three new species. Zootaxa 2012, 3179, 39–60. [Google Scholar] [CrossRef]
  41. Kayastha, P.; Berdi, D.; Mioduchowska, M.; Gawlak, M.; Łukasiewicz, A.; Gołdyn, B.; Kaczmarek, Ł. Some tardigrades from Nepal (Asia) with integrative description of Macrobiotus wandae sp. nov. (Macrobiotidae: Hufelandi Group). Ann. Zool. 2020, 70, 121–142. [Google Scholar] [CrossRef]
  42. Casquet, J.; Thebaud, C.; Gillespie, R.G. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol. Ecol. Resour. 2012, 12, 136–141. [Google Scholar] [CrossRef]
  43. Kaczmarek, Ł.; Grobys, D.; Kulpa, A.; Bartylak, T.; Kmita, H.; Kepel, M.; Kepel, A.; Roszkowska, M. Two new species of the genus Milnesium Doyère, 1840 (Tardigrada, Apochela, Milnesiidae) from Madagascar. ZooKeys 2019, 884, 1–22. [Google Scholar] [CrossRef]
  44. Kaczmarek, Ł.; Roszkowska, M.; Poprawa, I.; Janelt, K.; Kmita, H.; Gawlak, M.; Fiałkowska, E.; Mioduchowska, M. Integrative description of bisexual Paramacrobiotus experimentalis sp. nov. (Macrobiotidae) from Republic of Madagascar (Africa) with microbiome analysis. Mol. Phyl. Evol. 2020, 145, 106730. [Google Scholar] [CrossRef]
  45. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 4, 294–299. [Google Scholar]
  46. Sands, C.J.; McInnes, S.J.; Marley, N.J.; Goodall-Copestake, W.P.; Convey, P.; Linse, K. Phylum Tardigrada: An “individual” approach. Cladistics 2008, 24, 861–871. [Google Scholar] [CrossRef]
  47. Mironov, S.V.; Dabert, J.; Dabert, M. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae)—Morphological description with DNA barcode data. Zootaxa 2012, 3253, 54–61. [Google Scholar] [CrossRef] [Green Version]
  48. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. ISBN 9780123721808. [Google Scholar]
  49. Hall, T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999, 41, 95–98. [Google Scholar]
  50. Rice, P.; Longden, I.; Bleasby, A. EMBOSS: The European molecular biology open software suite. Trends Genet. 2000, 16, 276–277. [Google Scholar] [CrossRef]
  51. Goujon, M.; McWilliam, H.; Li, W.; Valentin, F.; Squizzato, S.; Paern, J.; Lopez, R. A new bioinformatics analysis tools framework at EMBL–EBI. Nucleic Acids Res. 2010, 38, 695–699. [Google Scholar] [CrossRef] [PubMed]
  52. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  53. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Green Version]
  54. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  55. Doyère, M. Mémoire sur les tardigrades. Ann. Sci. Nat. Zool. 1840, 2, 269–362. [Google Scholar]
  56. Marcus, E. Zur Ökologie und Physiologie der Tardigraden. Zool. Jahrb. Abt. Syst. 1927, 44, 323–370. [Google Scholar]
  57. Richters, F. Tardigrada. In Handbuch der Zoologie, 3rd ed.; Kükenthal, W., Krumbach, T., Eds.; Walter de Gruyter & Co.: Berlin, Germany; Leipzig, Germany, 1926; Volume 3, pp. 58–61. [Google Scholar]
  58. Durante Pasa, M.V.; Maucci, W. Tardigradi muscicoli dell’Istria con descrizione di due specie nuove. Mem. Ist. Ital. Idrobiol. Pallanza 1975, 32, 69–91. [Google Scholar]
  59. McInnes, S.J. Zoogeographic distribution of terrestrial/freshwater tardigrades from current literature. J. Nat. Hist. 1994, 28, 257–352. [Google Scholar] [CrossRef]
  60. Gąsiorek, P.; Stec, D.; Morek, W.; Marnissi, J.; Michalczyk, Ł. The tardigrade fauna of Tunisia, with an integrative description of Bryodelphax maculatus sp. nov. (Heterotardigrada: Echiniscidae). Afr. Zool. 2017, 52, 77–89. [Google Scholar] [CrossRef]
  61. Jørgensen, A.; Møbjerg, N.; Kristensen, R.M. Phylogeny and evolution of the Echiniscidae (Echiniscoidea, Tardigrada)–an investigation of the congruence between molecules and morphology. J. Zool. Syst. Evol. Res. 2011, 49, 6–16. [Google Scholar] [CrossRef]
  62. Vicente, F.; Fontoura, P.; Cesari, M.; Rebecchi, L.; Guidetti, R.; Serrano, A.; Bertolani, R. Integrative taxonomy allows the identification of synonymous species and the erection of a new genus of Echiniscidae (Tardigrada, Heterotardigrada). Zootaxa 2013, 3613, 557–572. [Google Scholar] [CrossRef] [Green Version]
  63. Węglarska, B. Die Tardigraden (Tardigrada) Spitzbergens. Acta Zool. Cracov. 1965, 11, 43–52. [Google Scholar]
  64. Gąsiorek, P.; Stec, D.; Zawierucha, K.; Kristensen, R.M.; Michalczyk, Ł. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 2018, 4472, 261–297. [Google Scholar] [CrossRef]
  65. Schuster, R.O.; Nelson, D.R.; Grigarick, A.A.; Christenberry, D. Systematic criteria of the Eutardigrada. Trans. Am. Microsc. Soc. 1980, 99, 284–303. [Google Scholar] [CrossRef]
  66. Stec, D.; Krzywański, Ł.; Michalczyk, Ł. Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae). Eur. J. Taxon. 2018, 1–36. [Google Scholar] [CrossRef]
  67. Nowak, B.; Stec, D. An integrative description of Macrobiotus hannae sp. nov.(Tardigrada: Eutardigrada: Macrobiotidae: Hufelandi group) from Poland. Turk. J. Zool. 2018, 42, 269–286. [Google Scholar] [CrossRef]
  68. Pilato, G.; Binda, M. Descrizione du una nuova specie di eutardigrado d’Australia Macrobiotus joannae n. sp. Animalia 1983, 10, 262–272. [Google Scholar]
  69. Coughlan, K.; Stec, D. Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position. Eur. J. Taxon.. 2019, 573. [Google Scholar] [CrossRef]
  70. Maucci, W. Prime notizie su Tardigradi “terrestri” del Madagascar con descrizione di tre specie nuove. Boll. Mus. Civ. Stor. Nat. Verona 1993, 17, 381–392. [Google Scholar]
  71. Roszkowska, M.; Kaczmarek, Ł. Macrobiotus noemiae sp. nov., a new tardigrade species (Macrobiotidae: Hufelandi group) from Spain. Turk. J. Zool. 2019, 43, 331–348. [Google Scholar] [CrossRef]
  72. Stec, D.; Kristensen, R.M.; Michalczyk, Ł. Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania). Zootaxa 2018, 4446, 273–291. [Google Scholar] [CrossRef]
  73. Guidetti, R.; Peluffo, J.R.; Rocha, A.M.; Cesari, M.; de Peluffo, M.C.M. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). J. Nat. Hist. 2013, 47, 2409–2426. [Google Scholar] [CrossRef]
  74. Bertolani, R.; Guidetti, R.; Marchioro, T.; Altiero, T.; Rebecchi, L.; Cesari, M. Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol. Phy. Evol. 2014, 76, 110–126. [Google Scholar] [CrossRef]
  75. Wełnicz, W.; Grohme, M.A.; Kaczmarek, Ł.; Schill, R.O.; Frohme, M. ITS-2 and 18S rRNA Data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). J. Zool. Syst. Evol. Res. 2011, 49, 34–39. [Google Scholar] [CrossRef]
  76. Stec, D.; Morek, W.; Gąsiorek, P.; Blagden, B.; Michalczyk, Ł. Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: Hufelandi Group) from Scotland by means of integrative taxonomy. Ann. Zool. 2017, 67, 181–197. [Google Scholar] [CrossRef]
  77. Vecchi, M.; Cesari, M.; Bertolani, R.; Jönsson, K.I.; Rebecchi, L.; Guidetti, R. Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invert. Syst. 2016, 30, 303–322. [Google Scholar] [CrossRef]
  78. Itang, L.A.M.; Stec, D.; Mapalo, M.A.; Mirano-Bascos, D.; Michalczyk, L. An integrative description of Mesobiotus dilimanensis, a new tardigrade species from the Philippines (Eutardigrada: Macrobiotidae: Furciger group). Raffles Bull. Zool. 2020, 68, 19–31. [Google Scholar]
  79. Mapalo, M.A.; Stec, D.; Mirano-Bascos, D.; Michalczyk, Ł. Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines. Zootaxa 2016, 4126, 411–426. [Google Scholar] [CrossRef]
  80. Richters, F. Nordische tardigraden. Zool. Anz. 1903, 168–172. [Google Scholar]
  81. Murray, J. Tardigrada. The British Antarctic Expedition 1907–1909. Rep. Sci. Inv. 1 Biol. 1910, Part V, 83–187. [Google Scholar]
  82. Murray, J. XXV.—Arctic Tardigrada, collected by Wm. S. Bruce. Earth Environ. Sci. Trans. R. Soc. Edinb 1907, 45, 669–681. [Google Scholar] [CrossRef] [Green Version]
  83. Binda, M.G.; Rebecchi, L. Precisazioni su Macrobiotus furciger Murray, 1907, e descrizione di Macrobiotus pilatoi n. sp. (Eutardigrada, Macrobiotidae). Animalia 1992, 19, 101–109. [Google Scholar]
  84. Kaczmarek, Ł.; Roszkowska, M. A new eutardigrade from Costa Rica with taxonomical and zoogeographical remarks on Costa Rican tardigrades. N. Z. J. Zool. 2016, 43, 234–245. [Google Scholar] [CrossRef]
  85. Kaczmarek, Ł.; Kosicki, J.; Roszkowska, M. Tardigrada of Bory Tucholskie National Park, Zaborski Landscape Park, and their surroundings (Pomerania Province, Poland). Turk. J. Zool. 2018, 42, 6–17. [Google Scholar] [CrossRef]
  86. Roszkowska, M.; Ostrowska, M.; Grobys, D.; Kmita, H.; Kaczmarek, Ł. Some tardigrades from Italy, with an updated checklist of limno-terrestrial species from the country. Acta Zool. Bulg. 2019, 71, 167–174. [Google Scholar]
  87. Guidetti, R.; Gneuß, E.; Cesari, M.; Altiero, T.; Schill, R.O. Life-history traits and description of the new gonochoric amphimictic Mesobiotus joenssoni (Eutardigrada: Macrobiotidae) from the island of Elba, Italy. Zool. J. Linnean Soc. 2019, 188, 848–859. [Google Scholar] [CrossRef] [Green Version]
  88. Vuori, T.; Massa, E.; Calhim, S.; Vecchi, M. Tardigrades of Finland: New records and an annotated checklist. Zootaxa 2020, 4851, 477–521. [Google Scholar] [CrossRef] [PubMed]
  89. Bertolani, R.; Rebecchi, L.; Giovannini, I.; Cesari, M. DNA barcoding and integrative taxonomy of Macrobiotus hufelandi CAS Schultze 1834, the first tardigrade species to be described, and some related species. Zootaxa 2011, 2997, 19–36. [Google Scholar] [CrossRef]
  90. Cesari, M.; Bertolani, R.; Rebecchi, L.; Guidetti, R. DNA barcoding in tardigrada: The first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Mol. Ecol. Res. 2009, 9, 699–706. [Google Scholar] [CrossRef]
  91. Cesari, M.; Giovannini, I.; Bertolani, R.; Rebecchi, L. An example of problems associated with DNA barcoding in tardigrades: A novel method for obtaining voucher specimens. Zootaxa 2011, 3104, 42–51. [Google Scholar] [CrossRef] [Green Version]
  92. Coughlan, K.; Michalczyk, Ł.; Stec, D. Macrobiotus caelestis sp. nov., a new tardigrade species (Macrobiotidae: Hufelandi group) from the Tien Shan Mountains (Kyrgyzstan). Ann. Zool. 2019, 69, 499–513. [Google Scholar] [CrossRef]
  93. Stec, D.; Arakawa, K.; Michalczyk, Ł. An Integrative Description of Macrobiotus shonaicus sp. nov.(Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS ONE 2018, 13, e0192210. [Google Scholar] [CrossRef] [Green Version]
  94. Stec, D.; Tumanov, D.T.; Kristensen, R.M. Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland. Eur. J. Taxon. 2020, 614. [Google Scholar] [CrossRef]
  95. Stec, D.; Roszkowska, M.; Kaczmarek, Ł.; Michalczyk, Ł. An integrative description of a population of Mesobiotus radiatus (Pilato, Binda & Catanzaro, 1991) from Kenya. Turk. Zool. Derg. 2018, 42, 523–540. [Google Scholar] [CrossRef] [Green Version]
  96. Mapalo, M.; Stec, D.; Mirano-Bascos, D.; Michalczyk, Ł. An integrative description of a limnoterrestrial tardigrade from the Philippines, Mesobiotus insanis, new species (Eutardigrada: Macrobiotidae: Harmsworthi group). Raffles Bull. Zool. 2017, 65, 440–454. [Google Scholar]
  97. Stec, D.; Kristensen, R.M. An integrative description of Mesobiotus ethiopicus sp. nov. (Tardigrada: Eutardigrada: Parachela: Macrobiotidae: Harmsworthi group) from the northern Afrotropic region. Turk. J. Zool. 2017, 41, 800–811. [Google Scholar] [CrossRef]
  98. Stec, D. Mesobiotus datanlanicus sp. nov., a new tardigrade species (Macrobiotidae: Mesobiotus harmsworthi group) from Lâm Đồng Province in Vietnam. Zootaxa 2019, 4679, 164–180. [Google Scholar] [CrossRef]
  99. Jørgensen, A.; Faurby, S.; Hansen, J.G.; Møbjerg, N.; Kristensen, R.M. Molecular phylogeny of Arthrotardigrada (Tardigrada). Mol. Phyl. Evol. 2010, 54, 1006–1015. [Google Scholar] [CrossRef]
  100. Schill, R.O.; Steinbrück, G. Identification and differentiation of Heterotardigrada and Eutardigrada species by riboprinting. J. Zool. Syst. Evol. Res. 2007, 45, 184–190. [Google Scholar] [CrossRef]
  101. Guil, N.; Giribet, G. A comprehensive molecular phylogeny of tardigrades—Adding genes and taxa to a poorly resolved phylum-level phylogeny. Cladistics 2010, 28, 21–49. [Google Scholar] [CrossRef]
  102. Tumanov, D.V. Integrative description of Mesobiotus anastasiae sp. nov.(Eutardigrada, Macrobiotoidea) and first record of Lobohalacarus (Chelicerata, Trombidiformes) from the Republic of South Africa. Eur. J. Taxon. 2020, 726, 102–131. [Google Scholar]
  103. Czechowski, P.; Sands, C.J.; Adams, B.J.; D’Haese, C.A.; Gibson, J.A.; McInnes, S.J.; Stevens, M.I. Antarctic Tardigrada: A first step in understanding molecular operational taxonomic units (MOTUs) and biogeography of cryptic meiofauna. Invertebr. Syst. 2012, 26, 526–538. [Google Scholar] [CrossRef]
Diversity 13 00394 g001 550
Figure 1. Bryodelphax mareki sp. nov.: habitus: (A) dorsal projection (holotype, PCM); (B) dorsal projection (SEM); (C) lateral projection; arrow indicates papilla-like structure on leg I, arrowhead indicates papilla on leg IV (SEM). Scale bars in µm.
Figure 1. Bryodelphax mareki sp. nov.: habitus: (A) dorsal projection (holotype, PCM); (B) dorsal projection (SEM); (C) lateral projection; arrow indicates papilla-like structure on leg I, arrowhead indicates papilla on leg IV (SEM). Scale bars in µm.
Diversity 13 00394 g001
Diversity 13 00394 g002 550
Figure 2. Bryodelphax mareki sp. nov.: (A) dorso-lateral view of the details of dorsal plates (paratype, PCM); (B) close up of the head plate (holotype, PCM); (C) close up of the pair plates II (holotype, PCM); (D) close up of the head and scapular plates (SEM). Scale bars in µm.
Figure 2. Bryodelphax mareki sp. nov.: (A) dorso-lateral view of the details of dorsal plates (paratype, PCM); (B) close up of the head plate (holotype, PCM); (C) close up of the pair plates II (holotype, PCM); (D) close up of the head and scapular plates (SEM). Scale bars in µm.
Diversity 13 00394 g002
Diversity 13 00394 g003 550
Figure 3. Bryodelphax mareki sp. nov.: ventral plates: (A) two ventral plates under head (filled arrowheads) (paratype, PCM); (B,C) three ventral plates around gonophore (empty arrowheads); asterisk indicates gonophore (paratypes, PCM and SEM, respectively); (D) ventral projection visible in SEM; filled arrowheads indicate two ventral plates under head, empty arrowheads indicate ventral plates around gonophore. Scale bars in µm.
Figure 3. Bryodelphax mareki sp. nov.: ventral plates: (A) two ventral plates under head (filled arrowheads) (paratype, PCM); (B,C) three ventral plates around gonophore (empty arrowheads); asterisk indicates gonophore (paratypes, PCM and SEM, respectively); (D) ventral projection visible in SEM; filled arrowheads indicate two ventral plates under head, empty arrowheads indicate ventral plates around gonophore. Scale bars in µm.
Diversity 13 00394 g003
Diversity 13 00394 g004 550
Figure 4. Bryodelphax mareki sp. nov.: (A,B) claws of leg I with visible papilla-like structure (arrow) (paratypes, PCM and SEM, respectively); (C,D) claws of leg IV; arrowhead indicates papilla on leg IV (paratypes, PCM and SEM, respectively). Scale bars in µm.
Figure 4. Bryodelphax mareki sp. nov.: (A,B) claws of leg I with visible papilla-like structure (arrow) (paratypes, PCM and SEM, respectively); (C,D) claws of leg IV; arrowhead indicates papilla on leg IV (paratypes, PCM and SEM, respectively). Scale bars in µm.
Diversity 13 00394 g004
Diversity 13 00394 g005 550
Figure 5. Macrobiotus birendrai sp. nov.: (A) dorso-ventral projection (holotype); (B) cuticular pores on dorsal side of the body (paratype). All PCM. Scale bars in µm.
Figure 5. Macrobiotus birendrai sp. nov.: (A) dorso-ventral projection (holotype); (B) cuticular pores on dorsal side of the body (paratype). All PCM. Scale bars in µm.
Diversity 13 00394 g005
Diversity 13 00394 g006 550
Figure 6. Macrobiotus birendrai sp. nov.: bucco-pharyngeal apparatus (dorso–ventral projection): (A) general view (paratype); (B) oral cavity armature with filled arrowhead indicating teeth of the first band (paratype); (C) oral cavity armature with arrow indicating teeth of the second band and indented filled arrowhead indicating dorsal teeth of the third band (paratype); (D) oral cavity armature with empty arrowhead indicating ventral teeth of the third band (paratype); (E) ventral placoids; the filled arrowhead indicates a first macroplacoid with central constriction (holotype). All PCM. Scale bars in µm.
Figure 6. Macrobiotus birendrai sp. nov.: bucco-pharyngeal apparatus (dorso–ventral projection): (A) general view (paratype); (B) oral cavity armature with filled arrowhead indicating teeth of the first band (paratype); (C) oral cavity armature with arrow indicating teeth of the second band and indented filled arrowhead indicating dorsal teeth of the third band (paratype); (D) oral cavity armature with empty arrowhead indicating ventral teeth of the third band (paratype); (E) ventral placoids; the filled arrowhead indicates a first macroplacoid with central constriction (holotype). All PCM. Scale bars in µm.
Diversity 13 00394 g006
Diversity 13 00394 g007 550
Figure 7. Macrobiotus birendrai sp. nov.: (A) claws III (paratype); (B) claws IV with dentate lunulas (arrowhead); arrow indicates granulation on legs IV (paratype); (C) lunulas under claws III with small teeth; indented arrowhead indicates cuticular bar under claws (paratype); (D) granulation on leg III (arrow) (holotype). All PCM. Scale bars in µm.
Figure 7. Macrobiotus birendrai sp. nov.: (A) claws III (paratype); (B) claws IV with dentate lunulas (arrowhead); arrow indicates granulation on legs IV (paratype); (C) lunulas under claws III with small teeth; indented arrowhead indicates cuticular bar under claws (paratype); (D) granulation on leg III (arrow) (holotype). All PCM. Scale bars in µm.
Diversity 13 00394 g007
Diversity 13 00394 g008 550
Figure 8. Macrobiotus birendrai sp. nov.: eggs: (A,B) egg chorion (PCM and SEM, respectively); (C) the surface between egg processes visible in PCM; (D) egg processes visible in PCM; (E,F) egg surface and processes visible in SEM; (G,H) egg processes visible in PCM. Scale bars in µm.
Figure 8. Macrobiotus birendrai sp. nov.: eggs: (A,B) egg chorion (PCM and SEM, respectively); (C) the surface between egg processes visible in PCM; (D) egg processes visible in PCM; (E,F) egg surface and processes visible in SEM; (G,H) egg processes visible in PCM. Scale bars in µm.
Diversity 13 00394 g008
Table
Table 1. Primers used for PCR amplification of four DNA molecular markers of Bryodelphax mareki sp. nov., Macrobiotus birendrai sp. nov. and Mesobiotus skorackii.
Table 1. Primers used for PCR amplification of four DNA molecular markers of Bryodelphax mareki sp. nov., Macrobiotus birendrai sp. nov. and Mesobiotus skorackii.
DNA FragmentPrimer Name/DirectionPrimer Sequence (5′-3′)Source
COILCO1490/forwardGGTCAACAAATCATAAAGATATTGGFolmer et al. [45]
HCO2198/reverseTAAACTTCAGGGTGACCAAAAAATCA
18S rRNASSU01_F/forwardAACCTGGTTGATCCTGCCAGTSands et al. [46]
SSU82_R/reverseTGATCCTTCTGCAGGTTCACCTAC
28S rRNA28SF0001/forwardACCCvCynAATTTAAGCATATMironov et al. [47]
28SR0990/reverseCCTTGGTCCGTGTTTCAAGAC
ITS-2ITS3/forwardGCATCGATGAAGAACGCAGCWhite et al. [48]
ITS4/reverseTCCTCCGCTTATTGATATGC
Table
Table 2. The GenBank accession numbers of obtained molecular markers of three tardigrade species.
Table 2. The GenBank accession numbers of obtained molecular markers of three tardigrade species.
SpeciesGenBank Accession Numbers (Voucher Numbers of Specimens)
COI18S rRNA28S rRNAITS-2
Bryodelphax mareki sp. nov.MW655785-87
(CN8.17/S, CN8.25/S, CN8.28/S)		MW680639-40
(CN8.21/S, CN8.25/S)		MW680637-38
(CN8.21/S, CN8.22/S)		NA
Macrobiotus birendrai sp. nov.MW656266
(CN8.101/S)		MW680641
(CN8.101/S)		MW680644
(CN8.101/S)		MW680418
(CN8.101/S)
Mesobiotus skorackiiMW656257
(CN8.115/S)		MW680642-43
(CN8.22/S, CN8.115/S)		MW680636
(CN8.115/S)		NA
Table
Table 3. Measurements (in µm) and sc values of selected morphological structures of adult females of Bryodelphax mareki sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).
Table 3. Measurements (in µm) and sc values of selected morphological structures of adult females of Bryodelphax mareki sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).
CharacterNRangeMeanSDHolotype
µmscµmscµmscµmsc
Body length16122–181577–7801416891560146749
Scapular plate length1618.4–24.0 – 20.4–1.7–19.5–
Head appendages lengths
 Cirrus internus165.3–7.326.8–34.66.230.60.52.75.327.0
 Cephalic papilla154.1–5.921.7–29.14.924.10.52.34.322.0
 Cirrus externus1611.1–13.153.4–63.011.958.70.73.211.157.0
 Clava124.3–6.220.4–33.05.226.10.53.74.824.6
 Cirrus A1535.2–46.7174.1–212.939.6193.63.210.736.5186.9
 Cirrus A/body length ratio1525%–32% – 28%–2%–25%–
 Cirrus int/ext length ratio1647%–56% – 52%–3%–47%–
Body appendages lengths
Papilla on leg IV length141.6–3.38.1–14.32.310.90.51.92.211.3
Claw 1 heights
 Branch165.8–8.430.3–42.07.637.50.72.87.035.9
 Spur131.3–1.75.4–8.21.57.20.10.81.47.2
 Spur/branch length ratio1316%–21% – 18%–2%–0–
Claw 2 heights
 Branch166.7–8.630.8–42.67.637.70.53.67.538.3
 Spur141.0–1.55.2–7.21.36.60.10.71.47.2
 Spur/branch length ratio1415%–20% – 18%–1%–0–
Claw 3 heights
 Branch165.8–8.630.6–45.17.537.30.84.07.035.6
 Spur121.2–1.55.4–7.51.46.60.10.81.36.7
 Spur/branch length ratio1216%–20% – 18%–1%–0–
Claw 4 lengths
 Branch167.3–9.938.3–48.28.943.80.63.78.845.2
 Spur131.4–1.96.3–8.91.67.80.10.71.68.0
 Spur/branch height ratio1315%–21% – 18%–2%–0–
Table
Table 4. Measurements (in µm) and pt values of selected morphological structures of individuals of Macrobiotus birendrai sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation, pt—ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).
Table 4. Measurements (in µm) and pt values of selected morphological structures of individuals of Macrobiotus birendrai sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation, pt—ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).
CharacterNRangeMeanSDHolotype
µmptµmptµmptµmpt
Body length15271–589815–1291449105597133368978
Buccopharyngeal tube
 Buccal tube length1633.2–52.6 – 42.7–5.9–37.7–
 Stylet support insertion point1626.2–43.078.0–82.834.380.25.21.629.678.7
 Buccal tube external width165.2–8.413.5–17.06.615.31.01.15.514.7
 Buccal tube internal width163.4–5.68.7–11.94.410.20.81.03.810.0
 Ventral lamina length1319.9–32.956.0–66.225.760.94.23.222.960.8
Placoid lengths
 Macroplacoid 1168.2–16.023.0–31.611.326.22.22.68.723.0
 Macroplacoid 2166.0–11.217.2–22.08.118.91.61.56.516.3
 Microplacoid162.4–4.96.5–9.63.58.00.80.92.87.4
 Macroplacoid row1616.3–30.249.1–57.922.652.64.43.418.849.9
 Placoid row1619.2–35.257.9–67.926.962.74.93.423.261.5
Claw 1 heights
 External primary branch168.5–13.220.6–29.810.825.31.62.310.026.5
 External secondary branch166.1–10.314.5–22.18.119.01.42.27.820.7
 Internal primary branch168.2–12.720.3–27.710.324.21.51.89.324.8
 Internal secondary branch166.2–10.716.7–24.38.419.61.42.37.820.8
Claw 2 heights
 External primary branch168.1–14.023.8–29.311.526.91.71.610.327.2
 External secondary branch167.0–11.717.5–23.99.021.11.51.97.519.8
 Internal primary branch168.6–13.623.0–30.711.126.01.62.111.129.5
 Internal secondary branch166.8–11.016.5–23.68.520.01.32.28.823.3
Claw 3 heights
 External primary branch168.7–14.824.9–31.711.727.41.72.110.427.5
 External secondary branch167.1–11.717.5–25.29.221.51.51.77.820.8
 Internal primary branch168.2–13.522.7–30.310.925.51.71.99.725.8
 Internal secondary branch166.5–11.118.0–23.28.820.61.51.78.321.9
Claw 4 lengths
 Anterior primary branch169.5–15.823.9–34.912.529.21.92.911.730.9
 Anterior secondary branch166.7–13.018.3–28.79.522.21.72.78.923.5
 Posterior primary branch168.4–14.223.7–32.212.128.31.52.411.630.8
 Posterior secondary branch166.5–12.018.3–24.39.221.51.71.98.322.1
Table
Table 5. Measurements (in µm) of selected morphological structures of eggs of Macrobiotus birendrai sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured eggs; SD—standard deviation).
Table 5. Measurements (in µm) of selected morphological structures of eggs of Macrobiotus birendrai sp. nov. mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured eggs; SD—standard deviation).
CharacterNRangeMeanSD
Egg bare diameter574.9–86.987.27.6
Egg full diameter587.8–103.9102.49.3
Process height335.9–9.47.91.1
Process base width335.5–9.06.60.8
Process base/height ratio3365–100%84%10%
Terminal disc width333.2–6.14.10.7
Inter-process distance331.0–3.32.10.7
Number of processes on the egg circumference522–2623.62.0
Table
Table 6. Measurements (in µm) and pt values of selected morphological structures of individuals of Mesobiotus skorackii mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation; pt—ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).
Table 6. Measurements (in µm) and pt values of selected morphological structures of individuals of Mesobiotus skorackii mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation; pt—ratio of the length of a given structure to the length of the buccal tube expressed as a percentage).
CharacterNRangeMeanSD
µmptµmptµmpt
Body length11281–485818–11024189916276
Buccopharyngeal tube
 Buccal tube length1134.3–47.6 – 42.0–4.4–
 Stylet support insertion point1125.9–35.674.6–77.031.775.53.20.8
 Buccal tube external width115.9–8.015.2–18.07.016.80.70.7
 Buccal tube internal width113.8–5.611.0–12.74.911.50.60.6
 Ventral lamina length1121.0–29.854.4–62.925.560.62.92.7
Placoid lengths
 Macroplacoid 1114.3–6.711.6–14.35.513.10.71.0
 Macroplacoid 2113.7–5.49.8–12.64.711.30.50.8
 Macroplacoid 3114.1–6.411.1–13.85.312.50.70.9
 Microplacoid112.5–4.86.7–10.33.68.50.61.2
 Macroplacoid row1115.3–22.944.4–48.219.446.22.41.2
 Placoid row1119.7–27.654.2–60.524.457.92.91.7
Claw 1 heights
 External primary branch116.9–11.218.3–26.29.522.51.42.1
 External secondary branch115.6–9.514.5–20.77.116.91.32.1
 Internal primary branch116.8–11.419.8–25.99.522.61.31.7
 Internal secondary branch115.3–8.915.4–20.67.718.21.01.5
Claw 2 heights
 External primary branch116.9–11.420.2–26.79.923.61.41.8
 External secondary branch115.4–9.715.8–22.78.019.01.62.6
 Internal primary branch117.1–11.020.1–25.69.221.91.01.6
 Internal secondary branch105.5–10.316.0–24.27.617.91.32.6
Claw 3 heights
 External primary branch117.8–11.622.8–28.110.424.71.21.8
 External secondary branch115.2–9.915.2–23.18.219.41.32.7
 Internal primary branch116.7–10.719.6–27.29.522.61.21.9
 Internal secondary branch115.3–9.615.5–22.28.018.91.12.0
Claw 4 lengths
 Anterior primary branch117.2–13.021.0–29.611.427.01.72.4
 Anterior secondary branch115.9–10.317.1–23.79.021.31.32.1
 Posterior primary branch116.5–13.218.9–30.710.725.32.13.6
 Posterior secondary branch115.2–10.715.1–24.48.520.11.52.6
Table
Table 7. Measurements (in μm) of selected morphological structures of eggs of Mesobiotus skorackii mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured eggs; SD—standard deviation).
Table 7. Measurements (in μm) of selected morphological structures of eggs of Mesobiotus skorackii mounted in Hoyer’s medium (N—number of specimens/structures measured; RANGE refers to the smallest and the largest structure among all measured eggs; SD—standard deviation).
CharacterNRangeMeanSD
Egg bare diameter1662.8–89.574.18.1
Egg full diameter1687.6–113.6102.27.6
Process height4813.5–20.417.11.7
Process base width4812.7–19.016.11.4
Process base/height ratio4872–127%95%12%
Inter-process distance481.3–5.63.51.2
Number of processes on the egg circumference169–1311.11.2
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kayastha, P.; Roszkowska, M.; Mioduchowska, M.; Gawlak, M.; Kaczmarek, Ł. Integrative Descriptions of Two New Tardigrade Species along with the New Record of Mesobiotus skorackii Kaczmarek et al., 2018 from Canada. Diversity 2021, 13, 394. https://doi.org/10.3390/d13080394

AMA Style

Kayastha P, Roszkowska M, Mioduchowska M, Gawlak M, Kaczmarek Ł. Integrative Descriptions of Two New Tardigrade Species along with the New Record of Mesobiotus skorackii Kaczmarek et al., 2018 from Canada. Diversity. 2021; 13(8):394. https://doi.org/10.3390/d13080394

Chicago/Turabian Style

Kayastha, Pushpalata, Milena Roszkowska, Monika Mioduchowska, Magdalena Gawlak, and Łukasz Kaczmarek. 2021. "Integrative Descriptions of Two New Tardigrade Species along with the New Record of Mesobiotus skorackii Kaczmarek et al., 2018 from Canada" Diversity 13, no. 8: 394. https://doi.org/10.3390/d13080394

APA Style

Kayastha, P., Roszkowska, M., Mioduchowska, M., Gawlak, M., & Kaczmarek, Ł. (2021). Integrative Descriptions of Two New Tardigrade Species along with the New Record of Mesobiotus skorackii Kaczmarek et al., 2018 from Canada. Diversity, 13(8), 394. https://doi.org/10.3390/d13080394

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop