Next Article in Journal
Predator Diversity Does Not Contribute to Increased Prey Risk: Evidence from a Mesocosm Study
Next Article in Special Issue
High-Throughput DNA Metabarcoding as an Approach for Ichthyoplankton Survey in Oujiang River Estuary, China
Previous Article in Journal
Community Governance, Financial Awareness, and Willingness to Participate in National Park Development: Evidence from the Giant Panda National Park
Previous Article in Special Issue
Population Genetic Differentiation and Structure of Maruca vitrata (Lepidoptera: Crambidae) in India
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 14
Issue 8
10.3390/d14080580
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

First Eastern Mediterranean Record of Xenoligophoroides cobitis, the Only Dactylogyrid Monogenean Infecting Mediterranean Gobies: Just Arrived or Missed the Boat?

by
Maarten P. M. Vanhove
1,2,3,4,*,
Sofia Giakoumi
2,5,
Dimitris Zogaris
6,
Marcelo Kovačić
7 and
Tine Huyse
3,8
1
Centre for Environmental Sciences, Research Group Zoology: Biodiversity and Toxicology, Hasselt University, Agoralaan Gebouw D, B-3590 Diepenbeek, Belgium
2
Institute of Marine Biological Resources and Inland Waters, Hellenic Centre for Marine Research, 46.7 km Athens-Sounio Avenue, 190 13 Anavyssos, Greece
3
Laboratory of Biodiversity and Evolutionary Genomics, Department of Biology, KU Leuven, Charles Deberiotstraat 32, B-3000 Leuven, Belgium
4
Department of Botany and Zoology, Faculty of Science, Masaryk University, Kotlářská 2, 611 37 Brno, Czech Republic
5
Department of Biology, National and Kapodistrian University of Athens, Panepistimiopolis Athens, 15784 Athens, Greece
6
Hydrobiology—Ichthyology Lab., Department of Ichthyology and Aquatic Environment (DIAE), University of Thessaly, 38 445 Volos, Greece
7
Natural History Museum Rijeka, Lorenzov Prolaz 1, 51000 Rijeka, Croatia
8
Biology Department, Royal Museum for Central Africa, Leuvensesteenweg 13, 3080 Tervuren, Belgium
*
Author to whom correspondence should be addressed.
Diversity 2022, 14(8), 580; https://doi.org/10.3390/d14080580
Submission received: 31 May 2022 / Revised: 6 July 2022 / Accepted: 14 July 2022 / Published: 22 July 2022
(This article belongs to the Special Issue DNA Barcodes for Evolution and Biodiversity)
Browse Figures
Review Reports Versions Notes

Abstract

:
Gobies and their ectoparasitic monogenean flatworms are promising models for species diversification because of their species richness. Recent decades have seen the discovery of several new species of Gyrodactylus (Monogenea: Gyrodactylidae) on European gobies, mostly in the sand goby lineage and especially in the eastern Mediterranean. However, the monogenean fauna of other gobies is much less understood. Therefore, we inspected five gobiid species (34 specimens, vouchered, with some representatives sequenced), sampled in Greece, for monogenean ectoparasites. Only specimens of the giant goby, Gobius cobitis, were infected; they harbored Xenoligophoroides cobitis (Monogenea: Dactylogyridae) on their gills. Here, we provide the first record from Greece, and the first ITS rDNA and COI sequences of the representative of this monotypic genus. Additionally, 28S rDNA was sequenced and compared with published data from across its known distribution, suggesting clinal variation. No sister-group for Xenoligophoroides could be proposed, nor could we explain the presence of a single known member of this genus on gobies, due to a lack of sequence data of closely related dactylogyrid monogeneans in public databases. Possible hypotheses include either the ancestral long-term presence on gobiids but “missing the boat” of the diversification events in the “Gobius-lineage”, or a recent host switch from a non-gobiid host.

1. Introduction

Gobiidae is the most species-rich fish family worldwide, with 1964 valid species as of 28 May 2022 [1], and the most species-rich group of European marine fishes [2]. There are 76 Mediterranean species [3]. Their diversity makes them prime models in evolutionary biology. For example, the occurrence of representatives in a wide variety of salinity conditions, and the often high levels of endemicity of gobies, render them conducive to study biogeographical patterns in aquatic ecosystems [2]. Furthermore, the radiation and local adaptation events in gobies have been fruitfully exploited in speciation research [4,5,6,7]. In addition, several goby species are successful invaders, rendering them useful models for the genomics of colonization and invasion [8] or as proof-of-principle of the use of fish parasites to elucidate introduction pathways [9]. Indeed, not only are the gobies valuable targets for biodiversity research, the same goes for their parasites. European sand gobies, with the gyrodactylid monogeneans that infect them [10,11], constitute one of the best studied fish–Gyrodactylus host–parasite systems. Since flatworms belonging to Gyrodactylus von Nordmann, 1832 are considered “the drosophilids of the parasitic world”, sand gobies and their gyrodactylids are, therefore, a promising model in ecological and evolutionary parasitology [12]. Indeed, the parasites of assemblages of closely related host species may reveal important insights in parasite speciation [13]. Goby parasites also hold a lot of potential for biodiversity discovery. The recent description of seven species of Gyrodactylus infecting freshwater sand gobies from the Balkan region, the center of endemism of these hosts, underscores that even European species diversity is far from fully inventoried [14]. Despite the recent focus on sand gobies, the discovery of Gyrodactylus quadratidigitus Longshaw, Pursglove et Shinn, 2003 on British Thorogobius ephippiatus (Lowe, 1839) by Longshaw et al. [15] illustrates that non-sand gobies also hold the promise of undiscovered gyrodactylids. Next to Gyrodactylidae, another species-rich family of Monogenea is represented among goby parasites: Dactylogyridae. In Europe, only one dactylogyrid species is reported from marine gobies: Xenoligophoroides cobitis (Ergens, 1963), with its only known host the giant goby, Gobius cobitis Pallas, 1814 [16,17]. In general, the discovery of a plethora of marine monogenean species is to be expected: Appeltans et al. [18] estimated that among marine flatworms, Monogenea is the group of which the lowest percentage (7 to 13%) of existing species has been formally described.
Here, we expand our survey of the monogenean parasite diversity of eastern Mediterranean gobies, specifically towards marine gobies outside of the sand goby lineage, with the expectation of retrieving representatives of Gyrodactylus and Xenoligophoroides.

2. Materials and Methods

2.1. Sampling and Morphological Characterization of Parasites

Gobies outside of the sand goby lineage were collected as bycatch by Vanhove et al. [19]. They were diagnosed by a minimum combination of characters that positively identified the collected specimens among species of the family Gobiidae in the CLOFNAM area ([20,21] and references therein). We focused on larger gobiid species that often may also occur in brackish water. The fish were inspected for monogeneans on their gills, body, and fins; also, the vial and medium were checked.
About half of the monogeneans recovered were transferred to a water droplet using a dissection needle, fixed in Hoyer’s medium, and mounted between slide and coverslip for morphological characterization of haptoral and genital hard parts. Measurements and micrographs were taken under phase contrast with an Olympus BX61 microscope fitted with a DP71 camera and Olympus Stream Motion software. Since only dactylogyrid monogeneans were found (Figure 1a–e), measurements followed Sasal et al. [16], whose study was the most recent publication on dactylogyrid parasites of European gobies at the onset of this work.
The remaining specimens were stored in absolute ethanol for subsequent molecular work. To allow taxonomic identification of these animals, photographic vouchers were made prior to DNA extraction. To this end, flatworms were temporarily mounted in water and photographed under a 100× (oil immersion) phase contrast objective using a Leica DM5000B microscope equipped with a Leica DFC420C camera and LAS imaging software (Figure 1f,g). Host vouchers were deposited in the Natural History Museum Rijeka (Rijeka, Croatia) (PMR), and parasite vouchers in the general invertebrate collection of the Department of Zoology, Swedish Museum of Natural History (Stockholm, Sweden) (SMNH).

2.2. Molecular and Genetic Analysis

For the host specimens, DNA extraction, PCR amplification of mitochondrial 12S and 16S rDNA, subsequent purification of the PCR product, and Sanger sequencing were performed following the procedures described by Vanhove et al. [19]. Host sequences were deposited in the NCBI GenBank under accession numbers ON847338-45 (16S rDNA) and ON853912-19 (12S rDNA). Parasite DNA was extracted with the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s instructions. Three potential monogenean barcoding markers [22] with different mutation rates were amplified for the parasites: a fragment of the large nuclear ribosomal subunit gene (28S rDNA); the region spanning internal transcribed spacer (ITS) 1 and 2 including the 5.8S rDNA; and a fragment of the mitochondrial cytochrome c oxidase subunit 1 (COI). Although the former is widely used in monogenean molecular systematics and in somewhat deeper phylogenetic reconstruction (e.g., [23]), the combination of the two latter markers has recently proven valuable for phylogenetics of closely related monogenean species in the context of host (and parasite) radiation [24]. Sequences of the ITS region are well-established in the molecular taxonomy of gyrodactylid monogeneans and, hence, also in the species assemblage of Gyrodactylus on European gobies [10]; this includes the first-ever western Mediterranean record of members of Gyrodactylus [25]. Conversely, the broad applicability of COI as a marker for monogeneans and other flatworms has been questioned [22], although recent work on representatives of Cichlidogyrus Paperna, 1960 (Monogenea, Dactylogyridae) highlights its potential for barcoding [26]. Hence, taken together, sequence data of COI and of 28S rDNA and ITS rDNA served as versatile genetic resources for work on the monogenean goby parasites retrieved in this study. Primer combinations were C1 (5′-ACCCGCTGAATTTAAGCAT-3′) and D2 (5′-TGGTCCGTGTTTCAAGAC-3′) [27] for 28S rDNA, ITS1A (5′-GTAACAAGGTTTCCGTAGGTG-3′) and ITS2 (5′-TCCTCCGCTTAGTGATA-3′) [28] for ITS rDNA, and ASmit1 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) [29] and Schisto3 (5′–TAATGCATMGGAAAAAAACA–3′) [30] for COI. In the latter case, the first polymerase chain reaction (PCR) was followed by a nested PCR, replacing the Schisto3 primer with ASmit2 (5′–TAAAGAAAGAACATAATGAAAATG–3′) [29]. We performed PCR using Illustra PuReTaq Ready-To-Go PCR Beads (GE Healthcare), adding 1 μL of each primer (20 μM) (Sigma Aldrich), 2 μL of template DNA, and 21 μL of double distilled, autoclaved, and filter-sterilized water. A GeneAmp PCR System 9700 (Applied Biosystems) thermocycler was used. Cycling conditions are outlined in Table 1.
We purified the PCR product using the QIAquick PCR Purification Kit (Qiagen), following the manufacturer’s guidelines. Bidirectional sequencing was carried out in an Applied Biosystems 3730 DNA analyzer using the BigDye protocol v.1.1. Sequences were validated by eye in MEGA v.7 [31] and aligned in the same software using ClustalW [32]. Pairwise distances were also calculated in MEGA. Sequences were subject to a BLAST search [33] on NCBI GenBank, and deposited there under accession numbers ON847354 (COI), ON853990-96 (28S rDNA) and ON854080-83 (ITS rDNA). In case published sequences of the same markers for conspecifics were found, a median-joining network [34] was inferred in PopART (http://popart.otago.ac.nz/index.shtml, accessed on 5 December 2021). Maps were rendered in QGIS [35].

3. Results

3.1. Host Records

A total of 34 specimens belonging to five goby species were checked for monogenean ectoparasites; species identities and sampling data are provided in Figure 2 and Table 2, rendering the host–parasite relationships traceable (see [36]). Interestingly, for Gobius couchi Miller & El-Tawil, 1974, our sample contains the first record in the Corinthian Gulf, quite geographically distant from surrounding records of this species from Corfu, Crete, and the northeastern Aegean Sea coast [37].

3.2. Parasite Identification

Among the five goby species studied, only representatives of G. cobitis were infected by monogenean ectoparasites. A specimen caught in the Acheloos Delta was infected with nine monogenean gill parasites, five of which were used for genetic analyses and four of which were prepared as whole mounts (SMNH 207585-86). For an individual from Kryoneri Estuary, the infection intensity was seven. Three of these worms were subject to molecular analyses and the four others mounted on a slide (SMNH 207587). The two infected individuals were the only representatives of Gobius cobitis studied, leading to a prevalence of 100%. The results of measurements performed on the whole mounts are provided in Table 3. Based on Sasal et al. [16] and Dmitrieva et al. [17], all specimens belong to X. cobitis (Figure 1).

3.3. Sequence Analyses

After trimming, sequence fragments of a maximal length of 858 bp (28S rDNA), 880 bp (ITS rDNA), and 171 bp (COI) were retained. Although only a single COI sequence was retrieved (from the Acheloos Delta), the four obtained ITS sequences (two from each locality) yielded a maximal uncorrected pairwise distance of 0.9% between specimens collected from the two different sites.
After searching nucleotide BLAST for the ITS fragment of X. cobitis, the highest identity score (93.2%) was found for two species of Dactylogyrus Diesing, 1850 (unpublished sequences KX369215 and KX369219), followed by a score of 91.2% for several representatives of Cichlidogyrus (sequences of [24,39]). These high scores were only found for a fragment that covered 23–25% of the total query (ca. 220 bp), or more specifically, in the region spanning 5.8S rDNA and internal transcribed spacer 2. For the COI fragment, the sequences with the highest pairwise similarity score belonged to Kapentagyrus tanganicanus Kmentová, Gelnar et Vanhove, 2018 (between 79.5% and 80.2% identity, sequences of [40]), followed by Euryhaliotrema pirulum (Plaisance et Kritsky, 2004) (identity 84.5%, sequence of [41]) and by species of Cichlidogyrus (maximal similarity of 82.0%, sequences of [24]) and Sciadicleithrum Kritsky, Thatcher et Boeger, 1989 (maximal similarity of 81.4%, sequences of [42]).
Only a single 28S rDNA genotype was found for all seven specimens successfully sequenced for this marker. Since other 28S rDNA sequences of X. cobitis are available [17], we only carried out intraspecific comparisons for this marker. The Greek genotype differed 0.7 to 3.1% (uncorrected p-distance) from those from the Black Sea, and between 0.6 and 1.3% from Sardinian conspecifics. The median-joining haplotype network, including all other published sequences of X. cobitis for this marker, situated the Greek population in between the Sardinian and Black Sea ones (Figure 3). In contrast to the Greek specimens all sharing a genotype, all genotypes from the Sardinian and Black Sea populations were unique.

4. Discussion

To further our understanding of the monogenean fauna of eastern Mediterranean gobies, we screened a number of Greek gobies belonging to five species for monogenean ectoparasites. The 2 individuals of the giant goby G. cobitis harbored a total of 16 dactylogyrid flatworms on their gills, morphologically and genetically identified as X. cobitis; no other monogeneans were found in any of the studied individuals. Given these infection parameters, and since X. cobitis is, here and in other studies (e.g., [16,17,43]), consistently reported on G. cobitis from different localities, an accidental infection is unlikely.
Ergens [43] described this parasite species as Ancyrocephalus cobitis. It was synonymized with Haliotrema cupensis Sasal, Pages et Euzet, 1998 and assigned to Haliotrema Johnston et Tiegs, 1922 by Merella et al. [44] as Haliotrema cobitis (Ergens, 1963). Dmitrieva et al. [17] erected the new monospecific genus Xenoligophoroides Dmitrieva, Sanna, Piras, Garippa et Merella, 2018 for it. With its type locality in the Adriatic Sea, and earlier observations from the western Mediterranean and the Black Sea, we here report X. cobitis (and hence any representative of Xenoligophoroides) for the first time in Greece, in the Ionian Sea and the eastern Mediterranean (Figure 4).
Dmitrieva et al. [17] provided an overview of morphometric data of the various populations of X. cobitis hitherto studied. In addition to the similarity these authors observed in overall body morphology, in shape of the hard parts, and in soft-part anatomy, they also mentioned considerable size ranges. For example, the (inner) length of the copulatory tube varies from minimally 25 µm in France to maximally 63 µm in the Black Sea; of the dorsal anchor, from 37 µm to 57 µm, and of the ventral anchor, from 25 µm to 45 µm (each time the minimal size in the French population and the maximal size in that of the Black Sea). Dmitrieva et al. [17] mentioned the geographical origin of the parasite populations, and the different sizes of the hosts studied from the Mediterranean compared to the Black Sea localities, as potential explanations for the size difference in the parasites. Measurements performed on the specimens from Greece fit within the ranges mentioned by Dmitrieva et al. [17]. It is noteworthy that the average value for most hard-part measurements is higher for the parasites collected at Kryoneri Estuary in comparison to their conspecifics in the Acheloos Delta (Table 3). The Kryoneri host specimen (total length = 88.9 mm, standard length = 72.1 mm + caudal fin length 16.8 mm) was larger than the one from the Acheloos (total length = 35.6 mm, standard length = 28.1 mm + caudal fin length 7.5 mm). Despite the limitations of our sample size, given the fact that these two Greek localities are only about 65 km apart, this could suggest an influence of host size on the size of the hard parts of X. cobitis. Morphological differences in various haptoral structures correlating with host size have been reported in other dactylogyrid monogeneans (e.g., [40]) though other studies did not find such correlations (e.g., [45] for a gill-infecting polyopisthocotylean monogenean). An increasing size of the gill lamellae in larger host specimens, potentially rendering larger haptoral hard parts an advantage for attachment to bigger-sized hosts, has been cited as a potential explanation for the link between host size and haptor morphology in monogeneans ([46] and references therein).
We consider the variation found in the ITS rDNA sequences of our specimens of X. cobitis to be intraspecific, as it remains below the threshold of 1% divergence, for this marker often associated with a difference between species (in Gyrodactylus: [47]). In contrast to the Sardinian and Black Sea populations sequenced by Dmitrieva et al. [17], all parasites in our sample sequenced for 28S rDNA yielded a single identical genotype. This contrasts with the diversity found by Dmitrieva et al. [17], where all five specimens from a single site in Sardinia and all four specimens from a single site in the Black Sea had a unique genotype (Figure 3).
Based on phylogenetic analyses by Dmitrieva et al. [17] using 28S rDNA, the species most similar to X. cobitis all seemed to share a marine lifestyle, belonging to Ergenstrema Paperna, 1964, Ligophorus Euzet et Suriano, 1977, Euryhaliotrema Kritsky et Boeger, 2002, and Haliotrematoides Kritsky, Yang et Sun, 2009. Our BLAST analyses based on the ITS and COI markers pointed towards similarities with both marine (e.g., Euryhaliotrema) and freshwater (e.g., Kapentagyrus Kmentová, Gelnar et Vanhove, 2018) genera. We consider our BLAST results a consequence of the scarcity of barcoding data for monogenean flatworms. Hopefully, the advent of mitochondrial genomes of an ever-increasing phylogenetic range of monogeneans (e.g., [48,49]) will help alleviate this important data gap in the near future.
The most recent and much more comprehensive phylogeny of dactylogyrids [23] placed all above-mentioned genera under Dactylogyrinae, but did not confirm a close relationship between any of them and X. cobitis. This dactylogyrid phylogeny also positions the members of Gobioecetes Ogawa et Itoh, 2017, infecting freshwater and diadromous gobies, in the Palearctic Far East [50], in Dactylogyrinae. Gobioecetes, with its sister taxon Ancyrocephalus mogurndae (Yamaguti, 1940) that is known to infect the Asian freshwater goby Gymnogobius urotaenia (Hilgendorf, 1879) among other hosts (see [51]), belonged to an entirely different clade than X. cobitis, indicating that gobies have been colonized by members of Dactylogyrinae at least twice independently.
Kmentová et al. [23] could not suggest a lineage closely related to Xenoligophoroides. Hence, it is impossible to propose a scenario of how (and when) this monogenean, currently the only known dactylogyrid from European gobies, colonized its host. Additionally, the host phylogeny adds little information: as the “Gobius-lineage” also includes eastern Atlantic genera from Norway to South Africa, Ponto–Caspian freshwater representatives, and even has affinities with tropical Pacific and neotropical gobies [4,52], we cannot reliably hypothesize where this lineage first infected gobies, and whether this happened in a marine or freshwater environment.
In contrast to the species-rich assemblage of Gyrodactylus on European (sand) gobies, only a single species of Xenoligophoroides is known. Although one has to caution against overinterpretation as many more goby species should be studied for parasites, this difference in species richness between goby-infecting monogenean lineages could be due to, for example, a recent colonization of the “Gobius-lineage” (long after it diversified) from another host lineage, or to “missing the boat” of diversification of these gobies, i.e., the absence on the founder populations of diverging goby lineages (see [53]). In order to favor any of these scenarios, identifying the sister group relationships of Xenoligophoroides would be key, as would inspecting fish species occurring in sympatry with G. cobitis. It would perhaps allow the inference of host-switching events such as those proposed by Huyse et al. [54], who studied sand goby-infecting members of Gyrodactylus. These authors suggested recent host-switches between sand gobies and sticklebacks, and between sand gobies and eels. In this respect, it may be useful to reflect on the former taxonomic affinities of X. cobitis. This species was previously assigned to Haliotrema and to Ancyrocephalus Creplin, 1839. Although no other Mediterranean monogeneans are classified under Haliotrema, other monogeneans occurring in the Mediterranean (e.g., Ancyrocephalus salinus Paperna, 1964 infecting Aphaniops dispar (Rüppell, 1829)) currently belong to Ancyrocephalus, which can safely be assumed to be a catch-all taxon (see [51,55]). Therefore, we concur with Dmitrieva et al. [17] that it will be fruitful to verify their systematic position in general, and their potential affinity to X. cobitis in particular. Apart from, e.g., the killifish host of A. salinus, further screening of gobiids and fishes occurring sympatrically with gobiids seems a fruitful approach to increase our understanding of the Mediterranean gyrodactylid and dactylogyrid fauna.

Author Contributions

Conceptualization, M.P.M.V.; methodology, M.P.M.V.; formal analysis, M.P.M.V.; investigation, M.P.M.V. and M.K.; resources, S.G. and T.H.; data Curation, M.P.M.V. and M.K.; writing—original draft preparation, M.P.M.V.; writing—review and editing, S.G., M.K. and T.H.; visualization, D.Z.; supervision, T.H.; funding Acquisition, M.P.M.V., S.G. and T.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research received support from the Special Research Fund of Hasselt University (BOF20TT06) and research grant 1513419N of the Research Foundation–Flanders (FWO–Vlaanderen). At the time of sampling, MPMV was the recipient of a PhD fellowship and TH of a postdoctoral fellowship from the Research Foundation–Flanders (FWO–Vlaanderen). MPMV was supported for fieldwork by a travel grant from the Belgian Network for Coastal Research (BeNCoRe: ENCORA coordination action contract number FP6-2004-Global-3–518120), and for lab work by the Synthesis of Systematic Resources (SYNTHESYS) project (GB-TAF-2984) (http://www.synthesys.info/), which is financed by the European Community Research Infrastructure Action under the FP7 Integrating Activities Programme, and by the European Centre for IchthyoParasitology (Centre of excellence financed by the Czech Science Foundation, project no. P505/12/G112).

Institutional Review Board Statement

This study was carried out in accordance with Research Permit 85404/130/9-1-2008 from the Greek Ministry of Environment, Energy and Climate Change, Directorate of Development and Protection of Forests and Natural Environment.

Data Availability Statement

Voucher specimens were deposited in the Natural History Museum Rijeka (PMR VP 3175 to PMR VP 3210, and PMR VP 3215), and in the Swedish Museum of Natural History (SMNH 207585-87). Sequences were deposited in NCBI GenBank, accession numbers ON847338-45, ON847354, ON853990-96, ON853912-19, and ON854080-83. Observations of X. cobitis were posted on iNaturalist under https://www.inaturalist.org/observations/119560694 to https://www.inaturalist.org/observations/119560698, https://www.inaturalist.org/observations/124777745, https://www.inaturalist.org/observations/124777746, https://www.inaturalist.org/observations/124774873, https://www.inaturalist.org/observations/124774874, https://www.inaturalist.org/observations/124774877, https://www.inaturalist.org/observations/124775414, https://www.inaturalist.org/observations/124775939, and https://www.inaturalist.org/observations/124777025 to https://www.inaturalist.org/observations/124777027.

Acknowledgments

Andrea Waeschenbach, D. Tim J. Littlewood, and the staff of the Wolfson Wellcome Biomedical Laboratories (Natural History Museum) are thanked for hosting and supporting the molecular work; Alcibiades N. Economou and Stamatis Zogaris (Hellenic Centre for Marine Research) for co-organizing this study and for hosting MPMV as a post-doctoral fellow; Walter A. Boeger (Universidade Federal do Paraná) and Eva Řehulková (Masaryk University) for sharing insights on dactylogyrid morphology and identification; Chahinez Bouguerche and Ulf Jondelius (Swedish Museum of Natural History) for curatorial services; Evgenija V. Dmitrieva (A.O. Kovalevsky Institute of Marine Biological Research), Daria Sanna (Università di Sassari), and Armando J. Cruz Laufer (Hasselt University) for interesting discussions on the current study; and Filip A.M. Volckaert (KU Leuven) for PhD supervision of MPMV and for constructive comments on this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Fricke, R.; Eschmeyer, W.N.; Fong, J.D. Eschmeyer’s Catalog of Fishes: Genera/Species by Family/Subfamily. Available online: http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp (accessed on 28 May 2022).
  2. Schwarzhans, W.; Agiadi, K.; Carnevale, G. Late Miocene–Early Pliocene evolution of Mediterranean gobies and their environmental and biogeographic significance. Riv. Ital. Paleontol. Stratigr. 2020, 126, 657–724. [Google Scholar]
  3. Kovačić, M.; Renaoult, J.P.; Pillon, R.; Svensen, R.; Bogorodsky, S.; Engin, S.; Louisy, P. Identification of Mediterranean marine gobies (Actinopterygii: Gobiidae) of the continental shelf from photographs of “in situ” individuals. Zootaxa 2022, 5144. [Google Scholar] [CrossRef]
  4. McCraney, W.T.; Thacker, C.E.; Alfaro, M.E. Supermatrix phylogeny resolves goby lineages and reveals unstable root of Gobiaria. Mol. Phylogenet. Evol. 2020, 151, 106862. [Google Scholar] [CrossRef] [PubMed]
  5. Yamasaki, Y.Y.; Takeshima, H.; Kano, Y.; Oseko, N.; Suzuki, T.; Nishida, M.; Watanabe, K. Ecosystem size predicts the probability of speciation in migratory freshwater fish. Mol. Ecol. 2020, 29, 3071–3083. [Google Scholar] [CrossRef] [PubMed]
  6. Bernardi, G. Inter-island local adaptation in the Galápagos Archipelago: Genomics of the Galápagos blue-banded goby, Lythrypnus gilberti. Coral Reefs 2021, 41, 625–633. [Google Scholar] [CrossRef]
  7. Ito, R.K.; Harada, S.; Tabata, R.; Watanabe, K. Molecular evolution and convergence of the rhodopsin gene in Gymnogobius, a goby group having diverged into coastal to freshwater habitats. J. Evol. Biol. 2022, 35, 333–346. [Google Scholar] [CrossRef]
  8. Adrian-Kalchhauser, I.; Blomberg, A.; Larsson, T.; Musilova, Z.; Peart, C.R.; Pippel, M.; Solbakken, M.H.; Suurväli, J.; Walser, J.-C.; Wilson, J.Y.; et al. The round goby genome provides insights into mechanisms that may facilitate biological invasions. BMC Biol. 2020, 18, 11. [Google Scholar] [CrossRef] [Green Version]
  9. Huyse, T.; Vanhove, M.P.M.; Mombaerts, M.; Volckaert, F.A.M.; Verreycken, H. Parasite introduction with an invasive goby in Belgium: Double trouble? Parasitol. Res. 2015, 114, 2789–2793. [Google Scholar] [CrossRef]
  10. Huyse, T.; Volckaert, F.A.M. Identification of a host associated species complex using molecular and morphometric analyses, with the description of Gyrodactylus rugiensioides n. sp. (Gyrodactylidae, Monogenea). Int. J. Parasitol. 2002, 32, 907–919. [Google Scholar] [CrossRef]
  11. Huyse, T.; Volckaert, F.A.M. Comparing host and parasite phylogenies: Gyrodactylus flatworms jumping from goby to goby. Syst. Biol. 2005, 54, 710–718. [Google Scholar] [CrossRef] [Green Version]
  12. Bakke, T.A.; Cable, J.; Harris, P.D. The biology of gyrodactylid monogeneans: The “Russian-doll killers”. Adv. Parasitol. 2007, 64, 161–460. [Google Scholar] [CrossRef] [PubMed]
  13. Pariselle, A.; Morand, S.; Deveney, M.; Pouyaud, L. Parasite species richness of closely related hosts: Historical scenario and “genetic” hypothesis. In Hommage à Louis Euzet—Taxonomie, Écologie et Évolution des Métazoaires Parasites. Taxonomy, Ecology and Evolution of Metazoan Parasites; Combes, C., Jourdane, J., Eds.; Presses Universitaires de Perpignan: Perpignan, France, 2003; pp. 147–166. [Google Scholar]
  14. Vanhove, M.P.M.; Economou, A.N.; Zogaris, S.; Giakoumi, S.; Zanella, D.; Volckaert, F.A.M.; Huyse, T. The Gyrodactylus (Monogenea, Gyrodactylidae) parasite fauna of freshwater sand gobies (Teleostei, Gobioidei) in their centre of endemism, with description of seven new species. Parasitol. Res. 2014, 113, 653–668. [Google Scholar] [CrossRef] [PubMed]
  15. Longshaw, M.; Pursglove, M.; Shinn, A.P. Gyrodactylus quadratidigitus n. sp. (Monogenea: Gyrodactylidae), a parasite of the leopard-spotted goby Thorogobius ephippiatus (Lowe) from the south-western coast of the UK. Syst. Parasitol. 2003, 55, 151–157. [Google Scholar] [CrossRef] [PubMed]
  16. Sasal, P.; Pagès, J.R.; Euzet, L. Haliotrema cupensis n. sp. (Monogenea, Ancyrocephalidae) from a marine gobiid (Teleostei, Perciformes) of the Mediterranean coast. Syst. Parasitol. 1998, 39, 107–112. [Google Scholar] [CrossRef]
  17. Dmitrieva, E.V.; Sanna, D.; Piras, M.C.; Garippa, G.; Merella, P. Xenoligophoroides cobitis (Ergens, 1963) n. g., n. comb. (Monogenea: Ancyrocephalidae), a parasite of Gobius cobitis Pallas (Perciformes: Gobiidae) from the Mediterranean and Black seas. Syst. Parasitol. 2018, 95, 625–643. [Google Scholar] [CrossRef]
  18. Appeltans, W.; Ahyong, S.T.; Anderson, G.; Angel, M.V.; Artois, T.; Bailly, N.; Bamber, R.; Barber, A.; Bartsch, I.; Berta, A.; et al. The magnitude of global marine species diversity. Curr. Biol. 2012, 22, 2189–2202. [Google Scholar] [CrossRef] [Green Version]
  19. Vanhove, M.P.M.; Economou, A.N.; Zogaris, S.; Larmuseau, M.H.D.; Giakoumi, S.; Kalogianni, E.; Volckaert, F.A.M.; Huyse, T. Phylogenetics and biogeography of the Balkan “sand gobies” (Teleostei, Gobiidae): Vulnerable species in need of taxonomic revision. Biol. J. Linn. Soc. 2012, 105, 73–91. [Google Scholar] [CrossRef]
  20. Miller, P.J. Gobiidae. In Fishes of the North-Eastern Atlantic and the Mediterranean 3; Whitehead, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., Eds.; UNESCO: Paris, France, 1986; pp. 1019–1085. [Google Scholar]
  21. Kovačić, M. Checklist of gobies (Actinopterii: Gobiidae) of the Mediterranean Sea and a key for species identification. Zootaxa 2020, 4877, 75–101. [Google Scholar] [CrossRef]
  22. Vanhove, M.P.M.; Tessens, B.; Schoelinck, C.; Jondelius, U.; Littlewood, D.T.J.; Artois, T.; Huyse, T. Problematic barcoding in flatworms: A case-study on monogeneans and rhabdocoels (Platyhelminthes). ZooKeys 2013, 365, 355–379. [Google Scholar] [CrossRef] [Green Version]
  23. Kmentová, N.; Cruz-Laufer, A.J.; Pariselle, A.; Smeets, K.; Artois, T.; Vanhove, M.P.M. Dactylogyridae 2022: A meta-analysis of phylogenetic studies and generic diagnoses of parasitic flatworms using published genetic and morphological data. Int. J. Parasitol. 2022, 52, 427–457. [Google Scholar] [CrossRef]
  24. Vanhove, M.P.M.; Pariselle, A.; Van Steenberge, M.; Raeymaekers, J.A.M.; Hablützel, P.I.; Gillardin, C.; Hellemans, B.; Breman, F.C.; Koblmüller, S.; Sturmbauer, C.; et al. Hidden biodiversity in an ancient lake: Phylogenetic congruence between Lake Tanganyika tropheine cichlids and their monogenean flatworm parasites. Sci. Rep. 2015, 5, 13669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Huyse, T.; Pampoulie, C.; Audenaert, V.; Volckaert, F.A.M. First report of Gyrodactylus spp. (Platyhelminthes: Monogenea) in the western Mediterranean sea: Molecular and morphological descriptions. J. Parasitol. 2006, 92, 682–690. [Google Scholar] [CrossRef] [PubMed]
  26. Jorissen, M.W.P.; Vanhove, M.P.M.; Pariselle, A.; Snoeks, J.; Vreven, E.; Šimková, A.; Wamuini Lunkayilakio, S.; Chocha Manda, A.; Kapepula Kasembele, G.; Muterezi Bukinga, F.; et al. Molecular footprint of parasite co-introduction with Nile tilapia in the Congo Basin. Org. Divers. Evol. 2022. [Google Scholar] [CrossRef]
  27. Hassouna, N.; Michot, B.; Bachellerie, J.P. The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Res. 1984, 12, 3563–3583. [Google Scholar] [CrossRef] [Green Version]
  28. Matějusová, I.; Gelnar, M.; McBeath, A.J.A.; Collins, C.M.; Cunningham, C.O. Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five fish families (Teleostei). Int. J. Parasitol. 2001, 31, 738–745. [Google Scholar] [CrossRef]
  29. Littlewood, D.T.J.; Rohde, K.; Clough, K.A. Parasite speciation within or between host species? Phylogenetic evidence from site-specific polystome monogeneans. Int. J. Parasitol. 1997, 27, 1289–1297. [Google Scholar] [CrossRef]
  30. Lockyer, A.E.; Olson, P.D.; Østergaard, P.; Rollinson, D.; Johnston, D.A.; Attwood, S.W.; Southgate, V.R.; Horak, P.; Snyder, S.D.; Le, T.H.; et al. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology 2003, 126, 203–224. [Google Scholar] [CrossRef] [Green Version]
  31. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
  32. Higgins, D.; Thompson, J.; Gibson, T.; Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Green Version]
  33. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  34. Bandelt, H.; Forster, P.; Röhl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef] [PubMed]
  35. QGIS Association. QGIS Geographic Information System. 2021. Available online: http://www.qgis.org (accessed on 30 May 2022).
  36. Justine, J.L.; Rahmouni, C.; Gey, D.; Schoelinck, C.; Hoberg, E.P. The monogenean which lost its clamps. PLoS ONE 2013, 8, e79155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Renoult, J.P.; Pillon, R.; Kovačić, M.; Louisy, P. Frontiers in Fishwatching Series—Gobies of the North-eastern Atlantic and the Mediterranean: Gobius and Thorogobius. In Les Cahiers de la Fondation Biotope; Fondation Biotope: Cayenne, France, 2022; Volume 37, pp. 1–237. [Google Scholar]
  38. Řehulková, E.; Mendlová, M.; Šimková, A. Two new species of Cichlidogyrus (Monogenea: Dactylogyridae) parasitizing the gills of African cichlid fishes (Perciformes) from Senegal: Morphometric and molecular characterization. Parasitol. Res. 2013, 112, 1399–1410. [Google Scholar] [CrossRef] [PubMed]
  39. Vanhove, M.P.M.; Briscoe, A.G.; Jorissen, M.W.P.; Littlewood, D.T.J.; Huyse, T. The first next-generation sequencing approach to the mitochondrial phylogeny of African monogenean parasites (Platyhelminthes: Gyrodactylidae and Dactylogyridae). BMC Genom. 2018, 19, 520. [Google Scholar] [CrossRef]
  40. Kmentová, N.; Koblmüller, S.; Van Steenberge, M.; Raeymaekers, J.A.M.; Artois, T.; De Keyzer, E.L.R.; Milec, L.; Muterezi Bukinga, F.; Mulimbwa N’sibula, T.; Masilya Mulungula, P.; et al. Weak population structure and expansive demographic history of the monogenean parasite Kapentagyrus spp. infecting clupeid fishes of Lake Tanganyika, East Africa. Int. J. Parasitol. 2020, 50, 471–486. [Google Scholar] [CrossRef]
  41. Plaisance, L.; Rousset, V.; Morand, S.; Littlewood, D.T.J. Colonization of Pacific islands by parasites of low dispersal ability: Phylogeography of two monogenean species parasitizing butterflyfishes in the South Pacific Ocean. J. Biogeogr. 2008, 35, 76–87. [Google Scholar] [CrossRef]
  42. Santacruz, A.; Barluenga, M.; Pérez-Ponce de León, G. The macroparasite fauna of cichlid fish from Nicaraguan lakes, a model system for understanding host-parasite diversification and speciation. Sci. Rep. 2022, 12, 3944. [Google Scholar] [CrossRef]
  43. Ergens, R. Über Pseudochetostoma leucisci n. sp. (Trematoidea) und Ancyrocephalus cobitis n. sp. (Monogenoidea), zwei neue parasitische Würmer der fische Albaniens. Z. Parasitenkd. 1963, 22, 287–291. [Google Scholar] [CrossRef]
  44. Merella, P.; Dmitrieva, E.V.; Piras, M.C.; Huyse, T.; Gerasev, P.; Garippa, G. Two monogenean species (Platyhelminthes) infecting Gobius cobitis Pallas, 1811 (Osteichthyes: Gobiidae) off Sardinia, western Mediterranean Sea. SOIPA XXVI Abstracts. Parassitologia 2010, 52, 359. [Google Scholar]
  45. Baker, T.G.; Viricel, A.; Meraziz, L.; de Buron, I. Size variation of adult polyopisthocotylid Metamicrocotyla macracantha (Monogenea) in relation to host size. Comp. Parasitol. 2005, 72, 179–182. [Google Scholar] [CrossRef]
  46. Lakshmi Perera, K.M. The effect of host size on large hamuli length of Kuhnia scombri (Monogenea: Polyopisthocotylea) from Eden, New South Wales, Australia. Int. J. Parasitol. 1992, 22, 123–124. [Google Scholar] [CrossRef]
  47. Ziętara, M.S.; Lumme, J. Speciation by host-switching and adaptive radiation in a fish parasite genus Gyrodactylus (Monogenea, Gyrodactylidae). Evolution 2002, 56, 2445–2458. [Google Scholar] [CrossRef] [PubMed]
  48. Zhang, D.; Li, W.X.; Zou, H.; Wu, S.G.; Li, M.; Jakovlić, I.; Zhang, J.; Chen, R.; Wang, G. Homoplasy or plesiomorphy? Reconstruction of the evolutionary history of mitochondrial gene order rearrangements in the subphylum Neodermata. Int. J. Parasitol. 2019, 49, 819–829. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, D.; Zou, H.; Jakovlić, I.; Wu, S.G.; Li, M.; Zhang, J.; Chen, R.; Li, W.X.; Wang, G.T. Mitochondrial genomes of two Thaparocleidus species (Platyhelminthes: Monogenea) reveal the first rRNA gene rearrangement among the Neodermata. Int. J. Mol. Sci. 2019, 20, 4214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Nitta, M.; Nagasawa, K. Gobioecetes longibasis n. sp. (Monogenea: Dactylogyridae) from Rhinogobius similis Gill (Perciformes: Gobiidae) from Okinawa-jima Island, the Ryukyu Archipelago, southern Japan, with a new host record for Gobioecetes biwaensis Ogawa & Itoh, 2017. Syst. Parasitol. 2020, 97, 193–200. [Google Scholar] [CrossRef]
  51. Pugachev, O.N.; Gerasev, P.I.; Gussev, A.V.; Ergens, R.; Khotenowsky, I. Guide to Monogenoidea of Freshwater Fish of Palaeartic and Amur Regions; Galli, P., Pugachev, O.N., Kritsky, D., Eds.; Ledizione-LediPublishing: Milan, Italy, 2009. [Google Scholar]
  52. Agorreta, A.; San Mauro, D.; Schliewen, U.; Van Tassell, J.L.; Kovačić, M.; Zardoya, R.; Rüber, L. Molecular phylogenetics of Gobioidei and phylogenetic placement of European gobies. Mol. Phylogenet. Evol. 2013, 69, 619–633. [Google Scholar] [CrossRef] [Green Version]
  53. Johnson, K.P.; Adams, R.J.; Page, R.D.M.; Clayton, D.H. When do parasites fail to speciate in response to host speciation? Syst. Biol. 2003, 52, 37–47. [Google Scholar] [CrossRef]
  54. Huyse, T.; Audenaert, V.; Volckaert, F.A.M. Speciation and host-parasite relationships in the parasite genus Gyrodactylus (Monogenea, Platyhelminthes) infecting gobies of the genus Pomatoschistus (Gobiidae, Teleostei). Int. J. Parasitol. 2003, 33, 1679–1689. [Google Scholar] [CrossRef]
  55. Kmentová, N.; Van Steenberge, M.; Raeymaekers, J.A.M.; Koblmüller, S.; Hablützel, P.I.; Muterezi Bukinga, F.; Mulimbwa N’sibula, T.; Masilya Mulungula, P.; Nzigidahera, B.; Ntakimazi, G.; et al. Monogenean parasites of sardines in Lake Tanganyika: Diversity, origin and intra-specific variability. Contrib. Zool. 2018, 87, 105–132. [Google Scholar] [CrossRef] [Green Version]
Diversity 14 00580 g001 550
Figure 1. Micrographs of Xenoligophoroides cobitis. (a) Haptoral hard parts, specimen from Acheloos Delta. (b) Male copulatory organ, specimen from Acheloos Delta. (c) Whole mount, specimen from Acheloos Delta. (d) Haptoral hard parts, specimen from Kryoneri Estuary. (e) Male copulatory organ, specimen from Kryoneri Estuary. (f) Photo voucher of temporarily water-mounted specimen from Acheloos Delta. (g) Photo voucher of temporarily water-mounted specimen from Kryoneri Estuary. Both photo vouchers show the characteristic “bilobed” (sensu Sasal et al. [16]) or “two-chambered” base (sensu Dmitrieva et al. [17]) of the male copulatory organ of X. cobitis. Scale bars: 50 µm (c), 20 µm (a,d,f,g), 10 µm (b,e).
Figure 1. Micrographs of Xenoligophoroides cobitis. (a) Haptoral hard parts, specimen from Acheloos Delta. (b) Male copulatory organ, specimen from Acheloos Delta. (c) Whole mount, specimen from Acheloos Delta. (d) Haptoral hard parts, specimen from Kryoneri Estuary. (e) Male copulatory organ, specimen from Kryoneri Estuary. (f) Photo voucher of temporarily water-mounted specimen from Acheloos Delta. (g) Photo voucher of temporarily water-mounted specimen from Kryoneri Estuary. Both photo vouchers show the characteristic “bilobed” (sensu Sasal et al. [16]) or “two-chambered” base (sensu Dmitrieva et al. [17]) of the male copulatory organ of X. cobitis. Scale bars: 50 µm (c), 20 µm (a,d,f,g), 10 µm (b,e).
Diversity 14 00580 g001
Diversity 14 00580 g002 550
Figure 2. Species and localities sampled for gobies and parasites; see Table 2 for more sampling information.
Figure 2. Species and localities sampled for gobies and parasites; see Table 2 for more sampling information.
Diversity 14 00580 g002
Diversity 14 00580 g003 550
Figure 3. Median-joining haplotype network based on 702 bp of 28S rDNA from the newly sequenced individuals of Xenoligophoroides cobitis from Greece, and the sequences from Dmitrieva et al. [17]. Genotypes are represented by circles with the size of the circle correlating with the number of specimens displaying the respective genotype. Colors denote sampling localities; genotypes are connected with lines, indicating the number of mutations between them. Colors correspond to the sampling localities in Figure 4.
Figure 3. Median-joining haplotype network based on 702 bp of 28S rDNA from the newly sequenced individuals of Xenoligophoroides cobitis from Greece, and the sequences from Dmitrieva et al. [17]. Genotypes are represented by circles with the size of the circle correlating with the number of specimens displaying the respective genotype. Colors denote sampling localities; genotypes are connected with lines, indicating the number of mutations between them. Colors correspond to the sampling localities in Figure 4.
Diversity 14 00580 g003
Diversity 14 00580 g004 550
Figure 4. Distribution of Xenoligophoroides cobitis. Star: type locality, Gulf of Vlorë, Albania. Triangles: previously published records without accompanying genetic data (overview: see [17] and references therein). Green: population from northwestern Sardinia, Italy; orange: population from Gelendzhik, Russia, both sequenced by Dmitrieva et al. [17]. Pink: population from the Acheloos Delta, Greece; turquoise: population from Kryoneri Estuary, Greece, both sequenced in the present study. Colors correspond to those in the haplotype network (Figure 3).
Figure 4. Distribution of Xenoligophoroides cobitis. Star: type locality, Gulf of Vlorë, Albania. Triangles: previously published records without accompanying genetic data (overview: see [17] and references therein). Green: population from northwestern Sardinia, Italy; orange: population from Gelendzhik, Russia, both sequenced by Dmitrieva et al. [17]. Pink: population from the Acheloos Delta, Greece; turquoise: population from Kryoneri Estuary, Greece, both sequenced in the present study. Colors correspond to those in the haplotype network (Figure 3).
Diversity 14 00580 g004
Table
Table 1. Polymerase chain reaction protocols for the genetic markers of monogenean parasites; the expected amplicon size is mentioned for each marker. The number of cycles was 39 for the fragment of large subunit rDNA, and 40 for internal transcribed spacer rDNA and the partial cytochrome c oxidase subunit 1 gene.
Table 1. Polymerase chain reaction protocols for the genetic markers of monogenean parasites; the expected amplicon size is mentioned for each marker. The number of cycles was 39 for the fragment of large subunit rDNA, and 40 for internal transcribed spacer rDNA and the partial cytochrome c oxidase subunit 1 gene.
ProtocolLarge Subunit 28S rDNA
(ca. 700–900 bp)		Internal Transcribed Spacer rDNA
(ca. 900–1200 bp)		Cytochrome c Oxidase
Subunit 1
(ca. 445 bp)
initial denaturation2 min/94 °C3 min/96 °C5 min/95 °C
cycle: denaturation
annealing
elongation 		20 s/94 °C
30 s/56 °C
1 min 30 s/72 °C		50 s/95 °C
50 s/52 °C
50 s/72 °C		1 min/94 °C
1 min/50 °C
1 min/72 °C
final elongation10 min/72 °C7 min/72 °C7 min/72 °C
cooling4 °C4 °C4 °C
Table
Table 2. Non-sand gobies inspected for monogenean ectoparasites and hosts sequenced for host identification in this study.
Table 2. Non-sand gobies inspected for monogenean ectoparasites and hosts sequenced for host identification in this study.
SpeciesLocalitySampling DateNumber of Host Specimens Inspected for Parasites/SequencedVoucher SpecimensGenBank Accession Numbers
Gobius cobitis Pallas, 1814Acheloos Delta
38°20′17.6″ N 21°07′39.0″ E		10 June 20081/-PMR VP 3175/
Kryoneri Estuary
38°22′23.4″ N 21°51′55.0″ E		7 June 20081/1PMR VP 3215ON847338 (16S rDNA),
ON853912 (12S rDNA)
Gobius couchi1 Miller & El-Tawil 1974Lake Heraion
38°01′31.8″ N 22°52′34.6″ E		8 September 20081/-PMR VP 3208/
Gobius niger Linnaeus, 1758Drepano Beach
39°30′54.3″ N 20°12′39.4″ E		8 June 200816/2PMR VP 3179 to PMR VP 3194ON847339-40 (16S rDNA),
ON853913-14 (12S rDNA)
Lake Heraion
38°01′31.8″ N 22°52′34.6″ E		8 September 200811/2PMR VP 3195 to PMR VP 3206,
PMR VP 3207, and PMR VP 3209		ON847341-42 (16S rDNA),
ON853915-16 (12S rDNA)
Gobius ophiocephalus Pallas, 1814Acheloos Delta
38°20′17.6″ N 21°07′39.0″ E		10 June 20082/1PMR VP 3176,
PMR VP 3178		ON847343 (16S rDNA), ON853917 (12S rDNA)
Gobius paganellus Linnaeus, 1758Acheloos Delta
38°20′17.6″ N 21°07′39.0″ E		10 June 20081/1PMR VP 3177ON847344 (16S rDNA), ON853918 (12S rDNA)
Euboea Island (Livadaki, Karystos)
38°00′15.8″ N 24°23′30.3″ E		3 June 20081/1PMR VP 3210ON847345 (16S rDNA), ON853919 (12S rDNA)
1 The specimen PMR VP 3208 was identified as G. couchi based on the following diagnosis: (1) suborbital papillae of lateral-line system without longitudinal row a; (2) all three head canals of lateral-line system present; (3) predorsal area scaled; (4) six suborbital transversal papillae rows; (5) anterior oculoscapular head canal with pore α at rear of orbit; (6) oculoscapular papillae row x1 not extending forwards to head canal pore β; (7) scales in lateral series 35–45 (present specimen had 35 and 36); (7) suborbital row d divided below between suborbital rows 2 and 3; (8) pelvic disc complete or no more than 1/8 emarginate (pelvic disc complete in present specimen); (9) pectoral fin count 15–18 (present specimen, for both sides, had 17).
Table
Table 3. Morphometric data of the haptoral and genital hard parts of specimens of Xenoligophoroides cobitis sampled in Greece. Measurements and their symbols follow Sasal et al. [16] with terminology adapted from Řehulková et al. [38]; measurements, all in µm, are presented as the range, followed by the average and the number of measured structures (n) in parentheses.
Table 3. Morphometric data of the haptoral and genital hard parts of specimens of Xenoligophoroides cobitis sampled in Greece. Measurements and their symbols follow Sasal et al. [16] with terminology adapted from Řehulková et al. [38]; measurements, all in µm, are presented as the range, followed by the average and the number of measured structures (n) in parentheses.
ParameterAcheloos Delta PopulationKryoneri Estuary Population
Body
Total length387.6–476.2
(425.7, n = 4)		337.3–408.3
(369.3, n = 4)
Total width140.1–181.4
(160.0, n = 4)		134.5–203.7
(157.0, n = 4)
Dorsal anchor
Total length (a)43.0–46.4
(44.5, n = 4)		49.6–53.7
(51.2, n = 3)
Length to notch (b)32.3–34.1
(33.2, n = 4)		36.4–40.7
(38.6, n = 3)
Inner root length (c)18.3–22.9
(20.3, n = 4)		23.7–24.6
(24.2, n = 3)
Outer root length (d)5.1–9.6
(8.0, n = 4)		9.5–11.5
(10.5, n = 3)
Point length (e)11.8–16.4
(14.4, n = 4)		13.5–20.0
(17.0, n = 3)
Ventral anchor
Total length (a)34.0–40.1
(37.4, n = 4)		36.8–40.1
(38.0, n = 3)
Length to notch (b)40.4–44.2
(42.0, n = 4)		42.8–46.2
(45.0, n = 3)
Inner root length (c)10.3–10.9
(10.6, n = 2)		9.8–10.9
(10.4, n = 3)
Outer root length (d)5.4–6.3
(6.0, n = 3)		6.4–9.3
(8.2, n = 3)
Point length (e)4.3–5.5
(4.7, n = 4)		5.6–6.3
(6.1, n = 3)
Dorsal bar
Branch length (h)35.2–38.4
(36.2, n = 4)		40.1–43.3
(41.7, n = 3)
Thickness at mid-length (w)8.7–13.5
(11.7, n = 4)		12.8–19.3
(15.4, n = 3)
Total straight width (x)37.2–59.3
(50.7, n = 4)		56.6–72.4
(67.0, n = 3)
Ventral bar
Thickness at mid-length (w)4.6–6.2
(5.5, n = 4)		7.7–9.2
(8.4, n = 3)
Total straight width (x)41.1–45.0
(43.0, n = 4)		50.6–54.0
(52.3, n = 3)
Hook
Pair I: total length (o)15.5–18.1
(16.9, n = 4)		16.9–19.2
(17.7, n = 3)
Pair I: shank length (p)9.1–12.2
(10.9, n = 4)		10.7–12.7
(11.5, n = 3)
Pair V: total length (o)13.8–16.0
(14.9, n = 4)		14.6–15.5
(15.1, n = 3)
Pair V: shank length (p)8.6–9.5
(9.1, n = 4)		8.3–10.2
(9.2, n = 3)
Other pairs: total length (o)14.2–18.4
(16.4, n = 20)		14.1–20.7
(17.5, n = 18)
Other pairs: shank length (p)8.7–11.7
(10.4, n = 20)		8.7–14.4
(11.5, n = 18)
Male copulatory organ
Copulatory tube total straight length (q)23.3–31.6
(26.7, n = 4)		14.7–35.2
(24.5, n = 4)
Total straight length of the base of the copulatory tube (r)15.3–19.2
(16.5, n = 4)		13.9–21.0
(17.5, n = 4)
Copulatory tube total curved length (s)46.7–53.7
(50.4, n = 4)		53.3–60.9
(56.2, n = 4)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Vanhove, M.P.M.; Giakoumi, S.; Zogaris, D.; Kovačić, M.; Huyse, T. First Eastern Mediterranean Record of Xenoligophoroides cobitis, the Only Dactylogyrid Monogenean Infecting Mediterranean Gobies: Just Arrived or Missed the Boat? Diversity 2022, 14, 580. https://doi.org/10.3390/d14080580

AMA Style

Vanhove MPM, Giakoumi S, Zogaris D, Kovačić M, Huyse T. First Eastern Mediterranean Record of Xenoligophoroides cobitis, the Only Dactylogyrid Monogenean Infecting Mediterranean Gobies: Just Arrived or Missed the Boat? Diversity. 2022; 14(8):580. https://doi.org/10.3390/d14080580

Chicago/Turabian Style

Vanhove, Maarten P. M., Sofia Giakoumi, Dimitris Zogaris, Marcelo Kovačić, and Tine Huyse. 2022. "First Eastern Mediterranean Record of Xenoligophoroides cobitis, the Only Dactylogyrid Monogenean Infecting Mediterranean Gobies: Just Arrived or Missed the Boat?" Diversity 14, no. 8: 580. https://doi.org/10.3390/d14080580

APA Style

Vanhove, M. P. M., Giakoumi, S., Zogaris, D., Kovačić, M., & Huyse, T. (2022). First Eastern Mediterranean Record of Xenoligophoroides cobitis, the Only Dactylogyrid Monogenean Infecting Mediterranean Gobies: Just Arrived or Missed the Boat? Diversity, 14(8), 580. https://doi.org/10.3390/d14080580

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop