Next Article in Journal
Dynamics of Lingulodinium polyedra Development in the Bulgarian Part of Black Sea (1992–2022)
Previous Article in Journal
Urbanization Influences on the Song Diversity of the Eurasian Nuthatch (Sitta europaea) in Northeast China
Previous Article in Special Issue
Morphogenesis and Organogenesis to Hatching of the Green Octopus, Octopus hubbsorum: A Species That Includes a Paralarval Stage in Its Life Cycle
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 17
Issue 2
10.3390/d17020104
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage

by
Wen-Bo Cui
1,†,
Prisca John Issangya
1,†,
Shuang Li
1,
Xu Zhou
1,
Li-Bing Zheng
1,2,* and
Chang-Feng Chi
1,*
1
National and Provincial Joint Engineering Research Centre for Marine Germplasm Resources Exploration and Utilization, School of Marine Science and Technology, Zhejiang Ocean University, 1st Haidanan Road, Changzhi Island, Lincheng, Zhoushan 316022, China
2
School of Food and Biotechnology, Bengbu University, Bengbu 233030, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Diversity 2025, 17(2), 104; https://doi.org/10.3390/d17020104
Submission received: 14 December 2024 / Revised: 24 January 2025 / Accepted: 27 January 2025 / Published: 30 January 2025
(This article belongs to the Special Issue Taxonomy, Biology and Evolution of Cephalopods)
Browse Figures
Versions Notes

Abstract

:
5-Hydroxytryptamine (5-HT) plays a vital role in the reproductive process of vertebrates and is also present in many invertebrates. The cDNA of the Sepiella japonica 5-HT6 receptor (Sj5-HT6r) was first cloned by RACE (Rapid Amplification of cDNA Ends). The length was 1450 bp, and the predicted open reading frame (ORF) was 1116 bp, which encoded 371 amino acids. Sequence characteristics analysis showed that Sj5-HT6r shares a high degree of identity with 5-HT6r from other cephalopods and forms a sister branch to bivalves. Subcellular localization showed that Sj5-HT6r protein was localized on the HEK293T cell membrane surface. Quantitative Real-time PCR (qPCR) analysis demonstrated that Sj5-HT6r was highly expressed in reproductive organs of both sexes. In particular, transcripts with significant expression were observed at stage III of female gonadal development in tissues of the ovary and nidamental gland, and at stage IV in tissues of the accessory nidamental gland. In situ hybridization (ISH) experiment results indicated that Sj5-HT6r mRNA was primarily distributed in all regions of the optic lobes except the plexiform zone. These results may provide a basis for the future exploration of the reproductive regulation of 5-HT and 5-HT6 receptors in S. japonica.

1. Introduction

The cephalopod Sepiella japonica was historically regarded as one of the ‘four traditional seafood[s]’ of the East China Sea, due to its exceptional nutritional and medicinal value [1]. Its unique biological and physiological characteristics, including its reproductive organs, have attracted increasing research interest in recent years. The reproductive organs of cuttlefish exhibit distinct sexual dimorphism, with different functional structures in males and females. The male reproductive system primarily includes the testis and spermatophore, responsible for producing sperm and transferring it to females via the hectocotylus (a specialized arm). The female reproductive system consists of the ovary, oviduct, nidamental glands, and accessory nidamental gland, which are involved in producing eggs and encapsulating them in egg cases. During the breeding season, females typically attach fertilized eggs to substrates on the seafloor, completing the reproductive process [2]. Unfortunately, the wild populations of this species have suffered greatly from overfishing and environmental degradation since the mid-1970s. Recent advances in artificial breeding and populations in numerous coastal regions have led to a notable recovery [3]. Even with these advancements, some problems still remain for S. japonica in artificial cultures, one of which is precocious puberty [4], and the mechanisms underlying precocious puberty in S. japonica are not well understood.
Serotonin (5-hydroxytryptamine, 5-HT), as one of the oldest monoamine neurotransmitters, carries out its various physiologically important functions via seven subfamilies of 5-HT receptors (5-HT1–7) [5]. All these receptors are currently categorized into 14 subtypes, and all except 5-HT3 belong to G protein-coupled receptors (GPCRs) [6]. 5-HT receptors have been identified and characterized in several species. For instance, in zebrafish (Danio rerio), three subtypes (5-HT1, 5-HT2, and 5-HT7) have been identified [7,8]. In the crab (Portunus pelagicus), the 5-HT receptor is highly distributed in the mature ovary and eyestalk and plays a role in reproductive regulation [9]. 5-HT has been shown to be involved in reproductive processes in humans and rats in the regulation of uterine contraction [10], urethrogenital reflex activity [11], and female sexual behavior through a variety of 5-HT receptors [12]. Recent studies have further expanded our understanding of 5-HT receptor functions. A phylogenetic analysis of 5-HT3 receptors across Metazoa was conducted, revealing their evolutionary relationships and molecular diversity [13]. A combined in silico and experimental approach was utilized to explore tissue-specific expression patterns of 5-HT3 receptors, emphasizing the importance of integrating computational and experimental methods to understand receptor functions [14].
Several 5-HT receptors have been cloned in mollusks, such as the 5-HT1 receptor of the pearl oyster (Pinctada fucata) [15], and the 5-HTLym and 5-HT2Lym receptors of the pond snail (Lymnaea stagnalis), which are currently classified as 5-HT1-like and 5-HT2 receptors [16,17]. Additionally, 5-HT plays essential roles in molluscan reproductive systems, particularly in the initiation of sexual maturation and gamete release. For instance, in the boring clam (Tridacna crocea), 5-HT1D-like receptor is widely distributed in gonads and plays a key role in regulating gametogenesis [18]. Studies have demonstrated that several 5-HT receptor subtypes, such as Hdh5-HT1B, Hdh5-HT4A, Hdh5-HT4B, and Hdh5-HT6, are significantly expressed in the ovaries of the Pacific abalone (Haliotis discus hannai) during sexual maturation [19]. Additionally, the 5-HT receptor gene family in the razor clam (Sinonovacula constricta) was identified and analyzed, revealing their rhythmic expression patterns and potential roles in circadian rhythm regulation [20]. These findings highlight the evolutionary and functional diversity of serotonin receptors, laying the groundwork for understanding their roles in molluscan species.
However, the diversity of 5-HT receptors in Cephalopoda and their functions in reproduction are not well understood. The objective of this research was to understand the function of the 5-HT6 receptor in the reproductive process of the S. japonica through sequence and gene expression analysis. In this research, the full-length cDNA sequence of the 5-HT6 receptor in S. japonica (Sj5-HT6r) was achieved by molecular cloning. Multiple sequence alignments and homology analysis were used to analyze the sequence. The evolutionary affinity of Sj5-HT6 receptors with 5-HT6 receptors of other species were compared. The expression levels of Sj5-HT6r at different developmental stages of male and female S. japonica were investigated by Quantitative Real-time PCR (qPCR). The location of Sj5-HT6r expression in tissues and cells was identified by in situ hybridization (ISH) and subcellular localization, respectively. Our results provide a theoretical basis for investigating the function of the 5-HT6 receptor in the S. japonica.

2. Materials and Methods

2.1. Biological Materials

Healthy cuttlefish (S. japonica) were taken from Xixuan Island breeding base in Zhoushan City, Zhejiang Province, China. Based on the growth time and gonad appearance [21,22], cuttlefish were divided into several developmental stages (stage I-II, stage III, stage IV, stage V, stage VI). At stage I-II, the gonads of both genders are indistinguishable by the naked eye. For females, the ovaries are grainy, milky white and translucent at stage III; at stage IV, eggs are milky white and slightly yellow, and they are adhered to each other in the ovary; at stage V, the ovary expands and the ovarian capsule becomes thin due to extrusion, the eggs appear yellow, and the ovary cavity and fallopian tube are filled with mature eggs; at stage VI, the mature free egg is basically discharged, and the ovarian capsule lacks elasticity [21,22]. For males, at stage III, the testis is small, elliptical, and white; at stage IV, the testis becomes larger and the spermatophores are closely arranged; at stage V, the testis is larger, the spermatophore exceeds the gill, and some spermatophores are released by squeezing the spermaduct; at stage VI, the spermatophore is basically discharged, and the spermatophore is slightly free in the cuttlefish body cavity [23]. Three females and males from different developmental stages were chosen to examine the expression levels of Sj5-HT6r. Tissues (brain, liver, heart, optic lobe, intestines, pancreas, stomach, gills, skin, muscle, testis, spermatophore, ovary, accessory nidamental gland, and nidamental gland) of male and female cuttlefish were extracted separately and preserved in liquid nitrogen, followed by storage at −80 °C in a refrigerator. Fixed preservation of the optic lobe and brain was in 4% paraformaldehyde (PFA) at 4 °C for 20 h.

2.2. Extraction of Total RNA from Tissues

The Trizol method was used to extract RNA from the tissues. S. japonica tissue (50–100 mg) was placed in a centrifuge tube and Trizol solution (Takara Bio Inc., Otsu, Kyoto, Japan) was added for grinding and extraction. The RNA quality was verified by 2.0% agarose gel electrophoresis and the quantity of RNA was measured by checking the absorbance at 260 and 280 nm.

2.3. Full-Length Amplification of Sj5-HT6r

Based on the Sj5-HT6r sequence annotated in the laboratory transcriptome library, the primers Sj5-HT6r-F/R were designed (Table 1), and the sequence of the conserved region was amplified and sequenced. The 5′-end and 3′-end RACE templates were prepared using 10.0 μg of total brain tissue RNA according to the instructions of the SMARTer RACE cDNA Amplification Kit (Takara Bio Inc., Otsu, Kyoto, Japan). The 5′/3′ end-specific RACE primers were designed (Table 1) according to the sequenced sequences. 5′/3′-Sj5-HT6r-outter/inner (Table 1) (Tm > 70 °C) were used to amplify the unknown sequence at both ends. The PCR products were checked by 2% agarose gel electrophoresis, and all PCR products were purified and connected to the pMD19-T vector for sequencing.

2.4. Expression Profile Analysis of Sj5-HT6r

qPCR primers were designed with Primer 6.0, according to the full-length cDNA sequence of the Sj5-HT6r. The product size was about 222 bp. β-actin (JN564496.1) and GAPDH (PQ349976) were selected as the internal reference genes. The expression levels of the Sj5-HT6r in different tissues of female and male individuals were detected using the relative quantitative method. Three biological replicates were used. The expression level of the tissue with the lowest expression level was selected as the reference standard. The qPCR experiment operation was conducted according to the SYBR Premix Ex Taq II (Tli RNaseH Plus, Takara Bio Inc., Japan) reagent instruction manual. Following the determination of reaction efficiency for qPCR using a standard curve (E = 99.3%), the specificity of qPCR was evaluated by melting curves analysis. The data were processed, analyzed, and calculated using the Microsoft Excel 2022 software, and converted into relative expression data using the 2−ΔΔCt method [24]. SPSS 25.0 software was used for statistical analysis, and the Turkey post hoc test was employed to ascertain the disparities in relative expression level between the various samples. GraphPad 8.0 software was used to construct the bar charts.

2.5. In Situ Hybridization of Sj5-HT6r

According to the Sj5-HT6r conserved coding region cDNA sequence, Primer 5.0 software was used to design the sense and anti-sense probe primers (S-Sj5-HT6r-F/R, A-Sj5-HT6r-F/R) (Table 1). The T7 promoter sequence was then added before the A-Sj5-HT6r-F and S-Sj5-HT6r-R primers, respectively. According to the designed probe primers, the brain tissue cDNA of S. japonica was used as a template for PCR amplification. The quality was checked by 1.5% agarose gel electrophoresis and sent for sequencing to detect whether the promoter sequence was connected to the target fragment. The method of probe labeling was based on Xie and Cao’s [25,26] and used the DIG RNA Labeling kit (Roche Diagnostics, Mannheim, Germany). The fixed optic lobe tissues were washed with 1 × PBST (0.01 M PBS, 1% Tween-20) and dehydrated with 75%, 85%, 95%, and 100% methanol sequentially for 2 h for each step, respectively. The dehydrated tissues were transparent for 90 min and then permeabilized in paraffin wax for 6 h. The permeabilized tissues were then sliced into 5 μm-thick sections with a slicer after completion of the permeabilization. The hybridization procedure was as follows: first, the slides were dewaxed in xylene for 20 min and rehydrated with 100%, 95%, 80%, 70%, 50% ethanol sequentially for 5 min per stage, and finally treated with 30% ethanol for 15 min. Then, the sectioned tissues were digested with proteinase K (0.5 μg/mL) for 5 min at 37 °C. Next, the reaction was terminated by treatment with Tris/glycine buffer for 10 min, and the slides were fixed with 4% PFA protected from light for 10 min. To eliminate nonspecific hybridization, prehybridization was carried out for 4–6 h at 55 °C. Slides were subsequently incubated with 5 μg/mL RNA probes overnight at 55 °C. The next day, the sections were rinsed at 37 °C with a gradient of sodium hypochlorite citrate (SSC) solution. The gradient washing procedure was as follows: two washes with 2 × SSC and 1 × SSC for 10 min each, then two washes with 0.5 × SSC and 0.2 × SSC sequentially for 15 min each. Then, the slides were treated in darkness for 2 h at 26 °C. Then, slides were incubated with anti-DIG-AP antibody Fab fragments (1:1000, Roche Diagnostics, Mannheim, Germany) for 14–16 h at 4 °C. On the next day, slides were stained with nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche Diagnostics, Mannheim, Germany), during which they were rinsed several times with NTMT (0.1 M NaCl, 0.05 M MgCl₂, 0.1 M Tris, 2.5% Tween) and the chromogenic solution was changed every 30 min. At last, the stained slides were cleared with glycerol, sealed with acrylic polymer, and observed under a microscope (Nikon). The specific ISH methods were based on Xie and Cao’s [25,26].

2.6. Subcellular Localization of Sj5-HT6r

Subcellular localization was performed following the previously described experimental methods [27]. In short, the obtained Sj5-HT6r gene was cloned into the pEGFP-N1 (Sangon Biotech, Shanghai, China) vector. The recombinant plasmid pEGFP-N1-Sj5-HT6r was constructed by double digestion with primers containing Xho1 and EcoR1 (Table 1) restriction sites, followed by ligation with the T4 DNA ligase system. The recombinant pEGFP-N1-Sj5-HT6r plasmid was then transfected into HEK293 cells with Lipo6000 transfection reagent (Beyotime Biotechnology, Shanghai, China). The accurate construction of pEGFP-N1-Sj5-HT6r was verified by DNA sequencing, and the cytomembranes and nuclei were stained in order with DiI and DAPI reagents (Beyotime Biotechnology, Shanghai, China). The recombinant plasmid pEGFP-N1-Sj5-HT6r and enhanced green fluorescent protein (EGFP) were surveyed with a microscope (TCS SP5II, Leica, Wetzlar, Germany).

2.7. Sequence Characteristics Analysis of Sj5-HT6r

ORF Finder (ORFfinder Home—NCBI (http://nih.gov.org)) was used to search and identify the open reading frame (ORF) sequence of the Sj5-HT6r gene. The SignalP 5.0 server (SignalP 5.0—DTU Health Tech—Bioinformatic Services) was employed to predict signal peptides. The molecular weights (MW) and isoelectric points (PI) of Sj5-HT6r were predicted using the Expasy ProtParam server (http://web.expasy.org, accessed on 30 January 2025). Some primers were designed with Primer 5.0. Multiple sequence alignment with consideration of the secondary structure was conducted with ESPript 3.0 (https://espript.ibcp.fr/, accessed on 30 January 2025). Protein intracellular and extracellular regions were predicted using the Topcons software (http://topcons.cbr.su.se/, accessed on 30 January 2025). MEGA-X was employed to establish a maximum-likelihood evolutionary tree.

3. Results

3.1. cDNA Information for the Sj5-HT6r Gene

The cDNA of Sj5-HT6r is 1450 bp in length, including 5’-untranslated region (UTR) 107 bp, 3’-UTR 227 bp, and the ORF 1116 bp, encoding 371 amino acids (Figure 1). The MW was 41.47 kDa, and the theoretical PI was 9.29. SignalP 5.0 online software predicted that there was no signal peptide at the N-terminal end of Sj5-HT6r, and SMART analysis showed that there were seven transmembrane regions in Sj5-HT6r. Sj5-HT6r was predicted to have two glycosylation sites, six serine sites (S), seven threonine sites (T), and two tyrosine sites (Y).

3.2. Multi-Sequence Alignment Analysis of the Sj5-HT6r

The 5-HT6 receptors amino acid sequences from six mollusks were selected for multi-sequence alignment with Sj5-HT6r. ESPript sequence alignment results showed that Sj5-HT6r has high sequence similarity with the 5-HT6r of other invertebrates, especially cephalopods. The results showed that the sequence identity between Sj5-HT6r and 5-HT6r of Sepia pharaonis (SpHT6r) was 98.92%. Additionally, Sj5-HT6r shared 75.64% identity with 5-HT6r of Octopus bimaculoides (Ob5-HT6r), 66.06% with 5-HT6r of H. discus hannai (Hdh5-HT6r-like), 65.83% with 5-HT6r-like of Mizuhopecten yessoensis (My5-HT6r-like), 62.51% with 5-HT6r-like of Pecten maximus (Pm5-HT6r-like), and 52.77% with 5-HT6r-like of Crassostrea virginica (Cv5-HT6r-like). The predicted secondary structure referenced the SpHT6r structure (A0A812BQG1.1. A), including 13 alpha helices and two 310 helices (Figure 2).

3.3. Evolutionary Analysis of Sj5-HT6r

The phylogenetic tree of Sj5-HT6r and 24 other 5-HT receptor sequences from 21 species was built using the maximum likelihood method (Figure 3). The results showed that Sj5-HT6r initially diverges into two major branches with other 5-HT receptors of the phylum Chordata and Arthropoda. Subsequently, it clusters into a single branch with the 5-HT6 receptors of the phylum Mollusca, which includes H. discus hannai, H. rufescens, H. rubra, and Mytilus galloprovinciallis. Finally, it was grouped with the 5-HT6 receptors of the S. pharanois, which gathered with bivalves as a sister branch.

3.4. Subcellular Localization of Sj5-HT6r

The results of subcellular localization (Figure 4) showed that the HEK293 cells transfected successfully with Sj5-HT6r-EGFP had a green fluorescence signal on the cell membrane. Blue fluorescence signals were the nucleus; green fluorescence signals were the Sj5-HT6r-EGFP fusion protein; red fluorescence signals were the cell membrane. Sj5-HT6r was mainly located on the cell membrane of HEK293 cells.

3.5. Expression of Sj5-HT6r Based on Sex and Life Stage

qPCR results showed that Sj5-HT6r was expressed in different tissues at various stages. The Sj5-HT6r gene showed no significant difference at stage I-II (p > 0.05) (Figure 5A). At stage III, the highest Sj5-HT6r expression level was in the nidamental gland, followed by the ovary and brain (Figure 5B). At stage IV of females, the Sj5-HT6r expression level was the highest in the optic lobe, approximately 42 times higher than that in the stomach (Figure 5C). At stage V of females, the highest Sj5-HT6r expression level was in the liver, next to the optic lobe, while the expression level in other tissues was relatively low (Figure 5D). At stage VI of females, the Sj5-HT6r mRNA levels were the highest in the nidamental gland, approximately 354 times higher than the mRNA level in the stomach (p < 0.05) (Figure 5E). The highest Sj5-HT6r expression level was seen in the nidamental gland and ovary of females at stage III, followed by a decreasing trend at stages IV, V, and VI (p < 0.05) (Figure 5F,G). For the accessory nidamental gland of females, the Sj5-HT6r expression levels peaked at stage IV (Figure 5H).
The expression levels of Sj5-HT6r mRNA at stages V and VI in males are shown in Figure 6. Sj5-HT6r expression level in the liver at stage V was not distinctly different from that in the testis, optic lobe, and gill, but was significantly higher than that in other tissues (p < 0.05) (Figure 6A). At stage VI, Sj5-HT6r expression was the highest in the spermatophore, which was distinctly higher than that in other tissues (Figure 6B).

3.6. In Situ Hybridization Localization of Sj5-HT6r

Sj5-HT6r mRNA localization in tissues was assessed by ISH. Figure 7A shows the hematoxylin and eosin (HE) staining results for the optic lobes. ISH results showed that the positive hybridization signals of Sj5-HT6r mRNA could be observed in the optic lobe (Figure 7C,D), compared with the sense probe control experiment without any hybridization signal (Figure 7B). The positive signal was stained blue by NBT/BCIP (Figure 7C,D). Cells with Sj5-HT6r precursor gene mRNA were observed in the central medulla, marginal medulla, inner cell granular layer, and outer cell granular layer of the optic lobes, and there was no positive signal in the plexiform zone (Figure 7C,D).

4. Discussion

The 5-HT6 receptor is a GPCR that was cloned for the first time from rat striatal tissue [28], which is a seven transmembrane protein with about 440 amino acids. The 5-HT6 receptor is specifically conjugated to adenylate cyclase with high constitutive activity [29]. In this study, we successfully cloned and characterized Sj5-HT6r. We found that this receptor has seven transmembrane sites on the cell membrane, a finding that was further confirmed by subcellular localization techniques (Figure 4), which is consistent with earlier studies. It might bind extracellular substances and transmit signals from these to intracellular molecules. The receptor has two glycosylation sites that help to determine the structure, function, and stability of the protein. It also contains six serine sites (S), two tyrosine sites (Y), and seven threonine sites (T) for a total of fifteen phosphorylation sites (Figure 1). Phosphorylation is catalyzed by specific kinases that transfer phosphate groups to target proteins and happens mainly on S, T, and Y residues. It is expected that these phosphorylation sites might also play a role in Sj5-HT6r signaling. The α-helices and 310 helices have important roles in the function of the 5-HT receptor. As typical GPCRs, the seven transmembrane α-helices (TM1-TM7) of the Sj5-HT6r might not only provide the basic backbone of the receptor [30], but also play key roles in the formation of the ligand-binding pocket and in signaling pathways, in particular, the conserved residues in TM3, TM5, TM6, and TM7, which interact with the ligand directly and mediate conformational changes that activate downstream signaling pathways [31]. In contrast, the 310 helix, although shorter and less distributed, plays a supporting role in certain GPCRs involved in maintaining rigidity of the transmembrane domain, receptor stability, and regulation of local conformational changes [32]. The synergistic action of these two secondary structures provides the structural basis for the signal transduction and conformational dynamics of the Sj5-HT6r. Of course, the three-dimensional structure and function of the receptor need to be further verified in the future. Analysis of the homology results showed that Sj5-HT6r exhibits a high identity of structural domain conservation with 5-HT6 receptors from other molluscan species, and displays an even greater degree of similarity to the 5-HT6 receptor sequence of S. pharaonis (Figure 2). The 5-HT6 receptor has the highest sequence consistency with the 5-HT2 receptor compared to other members of the 5-HT receptor family [33]. Our phylogenetic results are also consistent with this point (Figure 3).
qPCR analysis uncovered significant differences in the expression levels of the Sj5-HT6r gene across different developmental stages and tissues of male and female S. japonica. The results showed that the expression levels of the Sj5-HT6r gene increased progressively with the gonadal development of the cuttlefish. Particularly at stage III, as an early stage of preparation for reproduction, Sj5-HT6r expression peaked in the nidamental gland and ovary during stage III (Figure 5B), aligning with the period of oocyte maturation. This high expression likely reflects its involvement in the synthesis of gamete-supporting substances and the regulation of oocyte maturation. Similarly, in the accessory nidamental gland, Sj5-HT6r expression peaked at stage IV (Figure 5H), potentially supporting fertilization and early developmental processes. These observations highlight the stage-specific roles of Sj5-HT6r in female reproductive physiology. In males, Sj5-HT6r expression was notably higher in the liver at stage V and in the spermatophore at stage VI (Figure 6). This sex-specific expression pattern suggests that Sj5-HT6r might contribute to the production of substances essential for sperm maturation or delivery, a hypothesis that warrants further investigation. Undoubtedly, subcellular localization experiments confirmed that Sj5-HT6r is predominantly localized on the cell membrane of HEK293 cells (Figure 4), supporting its role as a GPCR involved in signal transduction.
Based on the function of 5-HT in fish reproduction, it is noted that 5-HT aids in gonadal development and stimulates the 5-HT receptor of reproductive hormones, indicating that the 5-HT receptor is also in charge of stimulating the secretion of gonadotropin-releasing hormone (GnRH), which is crucial for the stimulation of the 5-HT receptor of reproductive hormones and luteinizing hormone (LH), and the stimulation of the 5-HT receptor of hormones by the follicle, both of which are responsible for the testis and the growth of the ovary [34].
In Osteichthyes Fundulus heteroclitus, 5-HT receptor levels are regulated by the reproductive cycle and gonadal steroids in the brain and pituitary gland [35]. In tilapia, estrogen alters brain 5-HT receptor levels in the early development stages of the brain by decreasing tryptophan hydroxylase (TPH) activity and increasing monoamine oxidase (MAO) activity [36]. In male Lutjanus argentiventris adults, 5-HT receptor levels peak in the telencephalon before spawning, but levels are the lowest during spawning [37]. In our results, we found that at stage III in females, high expression levels were present in the nidamental glands, which play a critical role in the formation of the oval membrane, and then it starts to fall at stage IV and V. Furthermore, this phenomenon has also been seen in the ovary. These findings are also in accordance with alterations in 5-HT receptor expression observed in the fish brain during the reproductive cycle, implying that at this stage the S. japonica had already spawned, which is also supported by examples from other researchers in female brook trout (Salvelinus fontinalis) [38], who showed that, prior to the spawning period, adult female brook trout exhibited elevated levels of 5-HT in the brain relative to adult males, immature brook trout, and immature brown trout. Following the spawning process, male brook trout that were in a debilitated state exhibited the highest levels of tryptophan and demonstrated higher levels of 5-HT in their brains than females in a similar state and immature brook trout. Immature brook trout displayed elevated levels of 5-HT in comparison to pre-spawning adults. This discrepancy was no longer evident following the spawning season [38]. This means that 5-HT levels depend on the life stage of the fish. Our study showed that prior to spawning, females showed high levels of Sj5-HT6r in different tissues, especially in the nidamental glands and ovary. After spawning, it remained unchanged in both sexes. It was confirmed that Sj5-HT6r levels were lower at stage IV and V than at stage III, which means that females need high levels of Sj5-HT6r for oocyte maturation prior to egg laying; at this stage, the egg is already matured and ready for fertilization, and Sj5-HT6r levels must therefore be higher compared to other stages. An in vitro study of Oryzias latipes in Japan has shown that the 5-HT receptor has a dose-dependent stimulatory effect on oocyte maturation, which is regulated by stimulation of the synthesis of estrogens and maturation-inducing steroids produced by granulosa cells [39]. In contrast, in F. heteroclitus, the 5-HT6 receptor inhibits oocyte maturation, especially oocyte meiosis [35]. The results showed high levels of Sj5-HT6r in males at stage V, especially in the liver, and in males at stage VI, especially in the optic lobes, and generally higher amounts, increasing multiple times, of Sj5-HT6r in males than in females, which is supported by other studies suggesting that the 5-HT6 receptor in the brain may be associated with sexual dependence [40]. It has been shown that the 5-HT receptor promotes oocyte maturation and spawning both in the scallop (Patinopecten yessoensis) [41] and the abalone (H. discus hannai) [19]. The results of the studies indicated the presence of mRNA expression of Hdh5-HT1B, Hdh5-HT4A, Hdh5-HT4B, and Hdh5-HT6 receptors in the ovaries of the H. discus hannai. This suggests the potential involvement of these isoforms in the reproductive process [19]; however, the physiological significance of the 5-HT receptors in mollusk gonads remains unclear.
The function of the 5-HT6 receptor has been investigated over the past years. The 5-HT6 receptor’s protein localization has been determined using immunohistochemistry as well as radiolabeling techniques, and the receptor was found to be present in the rat brain in the olfactory nodes, cortex, hippocampus, striatum, hypothalamus, cerebellum, thalamus, parenchyma nigra, and superficial layers of the supraoptic cortex [42,43]. The 5-HT2A receptor is widely expressed in the gulf toadfish (Opsanus beta) brain, including the telencephalon, cerebellum, midbrain, and hindbrain, as well as the pituitary gland, and the 5-HT2A receptor is also expressed in the ovaries and spermathecae [44]. In D. rerio, the 5-HT2C receptor is distributed in the telencephalon, mesencephalon, rhombencephalon, and spinal cord [8]. With regard to 5-HT6 receptor distribution in rat, ISH studies showed that high expression levels are found in the striatum, olfactory tubercle, and nucleus accumbens; moderate expression levels in the cerebral cortex, hippocampus, thalamus, amygdala, and hypothalamus; and low expression levels in the hypothalamus and cerebellum [45]. In this study, the findings from in situ hybridization experiments further validated the expression of Sj5-HT6r in the optic lobe, with distinct localization in regions associated with sensory and neural integration (Figure 7). This distribution suggests that Sj5-HT6r might also mediate neural signaling related to reproductive behavior, a function previously reported in other mollusks and vertebrates. Sj5-HT6r was also expressed in different tissues such as the optic lobes of the S. japonica. Some research has focused on the physiological role of the 5-HT receptor on learning and memory [46,47], but others have demonstrated the involvement of the 5-HT6 receptor in feeding behavior [48]. This may suggest that Sj5-HT6r is involved in the regulation of physiological activities in the S. japonica. In the future, the function of the 5-HT/5-HT receptor in S. japonica in vivo needs to be further proved by more technical methods such as interference and overexpression. The lack of genomic information makes the research road tortuous, but the importance and interest of this species make us continue to explore the physiological functions and phenomena of S. japonica.

5. Conclusions

We obtained the full-length sequence of Sj5-HT6r by molecular cloning, and carried out homology analysis and multiple sequence comparison work. We also detected the changes of Sj5-HT6r expression in male and female S. japonica at different developmental stages by qPCR and localized this gene to cell membranes by the subcellular localization technique. Finally, we observed the expression of this gene in S. japonica optic lobe tissues by using ISH. It is hoped that this study can lay theoretical foundations for exploring the reproductive regulation of the S. japonica.

Author Contributions

W.-B.C. and P.J.I.: conceptualization, data curation, investigation, methodology, validation, and writing—original draft. S.L.: writing—review and editing. L.-B.Z.: supervision, writing—review and editing. X.Z.: funding acquisition, resources. C.-F.C.: conceptualization, funding acquisition, resources, supervision, writing—reviewing and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32473136 and 42406102) and the Natural Science Foundation of Zhejiang Province, China (No. LTGN24C190005).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The original manuscript of this study is included in the article and further information is available upon reasonable request to the corresponding author.

Acknowledgments

We thank H.-L.P. and H.-L.S. for their help in sampling the cuttlefish.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Fan, F.; Yin, F.; Wang, J.; Li, J. Status and prospects on biological research of Sepiella maindroni. Mod. Fish. Inf. 2011, 26, 6–9. (In Chinese) [Google Scholar]
  2. Vlasova, E.V.; Sabirov, R.M.; Golikov, A.V. Reproductive biology of the golden cuttlefish Sepia esculenta (Cephalopoda, Sepiida). Diversity 2023, 15, 455. [Google Scholar] [CrossRef]
  3. Gao, T.; Wang, L.; Chi, C.; Jiang, L.; Wang, S. Karyotype analysis of Sepiella maindroni. J. Zhejiang Ocean. Univ. (Nat. Sci.) 2019, 38, 281–285. (In Chinese) [Google Scholar]
  4. Zheng, X.; Lin, X.; Wang, Z.; Yu, R.; Tian, C.; Li, Q. Life history studies on Sepiella japonica under fully artificial culture conditions. Trans. Oceanol. Limnol. Haiyang Huzhao Tongbao 2010, 3, 24–28. (In Chinese) [Google Scholar]
  5. Hannon, J.; Hoyer, D. Molecular biology of 5-HT receptors. Behav. Brain Res. 2008, 195, 198–213. [Google Scholar] [CrossRef] [PubMed]
  6. Hoyer, D.; Hannon, J.P.; Martin, G.R. Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacol. Biochem. Behav. 2002, 71, 533–554. [Google Scholar] [CrossRef] [PubMed]
  7. Norton, W.H.; Folchert, A.; Bally-Cuif, L. Comparative analysis of serotonin receptor (HTR1A/HTR1B families) and transporter (slc6a4a/b) gene expression in the zebrafish brain. J. Comp. Neurol. 2008, 511, 521–542. [Google Scholar] [CrossRef] [PubMed]
  8. Schneider, H.; Fritzky, L.; Williams, J.; Heumann, C.; Yochum, M.; Pattar, K.; Noppert, G.; Mock, V.; Hawley, E. Cloning and expression of a zebrafish 5-HT2C receptor gene. Gene 2012, 502, 108–117. [Google Scholar] [CrossRef]
  9. Nakeim, J.; Kornthong, N.; Saetan, J.; Duangprom, S.; Sobhon, P.; Sretarugsa, P. Presence of serotonin and its receptor in the central nervous system and ovary and molecular cloning of the novel crab serotonin receptor of the blue swimming crab, Portunus pelagicus. Acta Histoche 2020, 122, 151457. [Google Scholar] [CrossRef] [PubMed]
  10. Minosyan, T.Y.; Lu, R.; Eghbali, M.; Toro, L.; Stefani, E. Increased 5-HT contractile response in late pregnant rat myometrium is associated with a higher density of 5-HT2A receptors. J. Physiol. 2007, 581, 91–97. [Google Scholar] [CrossRef]
  11. Ishigami, T.; Yoshioka, K.; Karicheti, V.; Marson, L. A role for peripheral 5-HT2 receptors in serotonin-induced facilitation of the expulsion phase of ejaculation in male rats. J. Sex. Med. 2013, 10, 2688–2702. [Google Scholar] [CrossRef]
  12. Uphouse, L. Pharmacology of serotonin and female sexual behavior. Pharmacol. Biochem. Behav. 2014, 121, 31–42. [Google Scholar] [CrossRef] [PubMed]
  13. Rao, S.; Turek, I.; Irving, H.R. Phylogenetic analyses of 5-hydroxytryptamine 3 (5-HT3) receptors in Metazoa. PLoS ONE 2023, 18, e0281507. [Google Scholar] [CrossRef] [PubMed]
  14. Tata, S.R. Combined In-Silico and Experimental Approach to Understanding 5-Hydroxytryptamine 3 (5-HT3) Receptor Expression. Ph.D. Thesis, La Trobe Rural Health School, Flora Hill, VIC, Australia, 2023. [Google Scholar]
  15. Wang, Q.; He, M. Molecular characterization and analysis of a putative 5-HT receptor involved in reproduction process of the pearl oyster Pinctada fucata. Gen. Comp. Endocrinol. 2014, 204, 71–79. [Google Scholar] [CrossRef] [PubMed]
  16. Gerhardt, C.C.; Leysen, J.E.; Planta, R.; Vreugdenhil, E.; van Heerikhuizen, H. Functional characterisation of a 5-HT2 receptor cDNA cloned from Lymnaea stagnalis. Eur. J. Pharmacol. 1996, 311, 249–258. [Google Scholar] [CrossRef]
  17. Sugamori, K.S.; Sunahara, R.K.; Guan, H.C.; Bulloch, A.G.; Tensen, C.P.; Seeman, P.; Niznik, H.B.; Van Tol, H.H. Serotonin receptor cDNA cloned from Lymnaea stagnalis. Proc. Natl. Acad. Sci. USA 1993, 90, 11–15. [Google Scholar] [CrossRef]
  18. Yang, X.; Noor, Z.; Guo, S.; Zhao, Z.; Cai, B.; Huang, G.; Ma, H.; Qin, Y.; Yu, Z.; Li, J.; et al. Analysis of molecular identity and function of putative serotonin receptors in the giant clam (Tridacna crocea) and the potential role of 5-HT1D-like receptor in reproduction. Aquaculture 2024, 593, 741247. [Google Scholar] [CrossRef]
  19. Kim, K.S.; Kim, M.A.; Sohn, Y.C. Molecular characterization, expression analysis, and functional properties of multiple 5-hydroxytryptamine receptors in Pacific abalone (Haliotis discus hannai). Gen. Comp. Endocrinol. 2019, 276, 52–59. [Google Scholar] [CrossRef]
  20. You, Q.; Li, Q.; Lv, L.; Lin, Z.; Dong, Y.; Yao, H. Genome-Wide Identification of 5-HT receptor gene family in razor clam Sinonovacula constricta and their circadian rhythm expression analysis. Animals 2023, 13, 3208. [Google Scholar] [CrossRef]
  21. Jiang, X.; Fu, F.; Li, Z.; Feng, X. Study on the oogenesis and ovarial development of Sepiella maindroni. J. Fish. China 2007, 31, 607–617. (In Chinese) [Google Scholar]
  22. Luo, J.; Jiang, X.M.; Liu, M.H.; Tang, F.; Peng, R.B. Oogenesis and ovarian development in Sepia lycidas. Acta Hydrobiol. Sin. 2014, 38, 1107–1116. [Google Scholar]
  23. Sauer, W.H.; Lipiński, M.R. Histological validation of morphological stages of sexual maturity in chokker squid Loligo vulgaris reynaudii D’Orb (Cephalopoda: Loliginidae). S. Afr. J. Mar. Sci. 1990, 9, 189–200. [Google Scholar] [CrossRef]
  24. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  25. Xie, J.J.; Li, Y.; Wu, J.H.; Fang, P.X.; Li, S.; Zhou, X.; Chi, C.F. FMRFamide G protein-coupled receptors (GPCR) in the cuttlefish Sepiella japonica: Identification, characterization and expression profile. Neuropeptides 2024, 109, 102491. [Google Scholar] [CrossRef] [PubMed]
  26. Cao, H.M.; Wu, J.H.; Li, S.; Zhou, X.; Zheng, L.B.; Chi, C.F. A Na+ channel receptor of FMRFamide in the cephalopod Sepiella japonica: Identification, characterisation, and expression profiling during different stages of gonadal development. Neuropeptides 2024, 106, 102437. [Google Scholar] [CrossRef] [PubMed]
  27. Zhu, Y.; Sun, L.L.; Wu, J.H.; Liu, H.H.; Zheng, L.B.; Lü, Z.M.; Chi, C.F. An FMRFamide neuropeptide in cuttlefish Sepia pharaonis: Identification, characterization, and potential function. Molecules 2020, 25, 1636. [Google Scholar] [CrossRef] [PubMed]
  28. Ruat, M.; Traiffort, E.; Arrang, J.; Tardivellacombe, J.; Diaz, J.; Leurs, R.; Schwartz, J.-C. A novel rat serotonin (5-HT6) receptor: Molecular cloning, localization and stimulation of cAMP accumulation. Biochem. Biophys. Res. Commun. 1993, 193, 268–276. [Google Scholar] [CrossRef] [PubMed]
  29. Kohen, R.; Fashingbauer, L.A.; Heidmann, D.E.A.; Guthrie, C.R.; Hamblin, M.W. Cloning of the mouse 5-HT6 serotonin receptor and mutagenesis studies of the third cytoplasmic loop. Mol. Brain Res. 2001, 90, 110–117. [Google Scholar] [CrossRef]
  30. Jones, R.D. Information transmission in G protein-coupled receptors. Int. J. Mol. Sci. 2024, 25, 1621. [Google Scholar] [CrossRef]
  31. Weis, W.I.; Kobilka, B.K. The Molecular basis of G protein-coupled receptor activation. Annu. Rev. Biochem. 2018, 87, 897–919. [Google Scholar] [CrossRef]
  32. Núñez-Villanueva, D. Revisiting 310-helices: Biological relevance, mimetics and applications. Explor. Drug Sci. 2024, 2, 6–37. [Google Scholar] [CrossRef]
  33. Wang, C.; Jiang, Y.; Ma, J.; Wu, H.; Wacker, D.; Katritch, V.; Han, G.W.; Liu, W.; Huang, X.P.; Vardy, E.; et al. Structural basis for molecular recognition at serotonin receptors. Science 2013, 340, 610–614. [Google Scholar] [CrossRef] [PubMed]
  34. Prasad, P.; Ogawa, S.; Parhar, I.S. Role of serotonin in fish reproduction. Front. Neurosci. 2015, 9, 195. [Google Scholar] [CrossRef]
  35. Cerda, J.; Subhedar, N.; Reich, G.; Wallace, R.A.; Selman, K. Oocyte sensitivity to serotonergic regulation during the follicular cycle of the teleost Fundulus heteroclitus. Biol. Reprod. 1998, 59, 53–61. [Google Scholar] [CrossRef] [PubMed]
  36. Tsai, C.-L.; Wang, L.-H. Effects of gonadal steroids on the serotonin synthesis and metabolism in the early developing tilapia brain. Neurosci. Lett. 1999, 264, 45–48. [Google Scholar] [CrossRef] [PubMed]
  37. Hernandez-Rauda, R.; Aldegunde, M. Changes in dopamine, norepinephrine and serotonin levels in the pituitary, telencephalon and hypothalamus during gonadal development of male Lutjanus argentiventris (Teleostei). Mar. Biol. 2002, 141, 209–216. [Google Scholar]
  38. Sloley, B.; Cunjak, R.; Power, G.; Downer, R. The influence of sex and spawning on levels of tryptophan, serotonin and 5-hydroxyindoleacetic acid in the brains of wild brook trout, Salvelinus fontinalis. J. Fish. Biol. 1986, 29, 663–669. [Google Scholar] [CrossRef]
  39. Iwamatsu, T.; Toya, Y.; Sakai, N.; Terada, Y.; Nagata, R.; Nagahama, Y. Effect of 5-hydroxytryptamine on steroidogenesis and oocyte maturation in pre-ovulatory follicles of the medaka Oryzias latipes. Dev. Growth Differ. 1993, 35, 625–630. [Google Scholar] [CrossRef]
  40. Lahogue, C.; Billard, J.M.; Freret, T.; Bouet, V. 5-HT6 receptors sex-dependently modulate hippocampal synaptic activity through GABA inhibition. Biomolecules 2023, 13, 751. [Google Scholar] [CrossRef] [PubMed]
  41. Tanabe, T.; Yuan, Y.; Nakamura, S.; Itoh, N.; Takahashi, K.G.; Osada, M. The role in spawning of a putative serotonin receptor isolated from the germ and ciliary cells of the gonoduct in the gonad of the Japanese scallop, Patinopecten yessoensis. Gen. Comp. Endocrinol. 2010, 166, 620–627. [Google Scholar] [CrossRef]
  42. Gérard, C.; Martres, M.-P.; Lefèvre, K.; Miquel, M.-C.; Vergé, D.; Lanfumey, L.; Doucet, E.; Hamon, M.; El Mestikawy, S. Immuno-localization of serotonin 5-HT6 receptor-like material in the rat central nervous system. Brain Res. 1997, 746, 207–219. [Google Scholar] [CrossRef] [PubMed]
  43. Roberts, J.C.; Reavill, C.; East, S.Z.; Harrison, P.J.; Patel, S.; Routledge, C.; Leslie, R.A. The distribution of 5-HT6 receptors in rat brain: An autoradiographic binding study using the radiolabelled 5-HT6 receptor antagonist [125I]SB-258585. Brain Res. 2002, 934, 49–57. [Google Scholar] [CrossRef] [PubMed]
  44. Mager, E.M.; Medeiros, L.R.; Lange, A.P.; McDonald, M.D. The toadfish serotonin 2A (5-HT2A) receptor: Molecular characterization and its potential role in urea excretion. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2012, 163, 319–326. [Google Scholar] [CrossRef] [PubMed]
  45. Helboe, L.; Egebjerg, J.; de Jong, I.E. Distribution of serotonin receptor 5-HT6 mRNA in rat neuronal subpopulations: A double in situ hybridization study. Neuroscience 2015, 310, 442–454. [Google Scholar] [CrossRef] [PubMed]
  46. Glikmann-Johnston, Y.; Saling, M.M.; Reutens, D.C.; Stout, J.C. Hippocampal 5-HT1A receptor and spatial learning and memory. Front. Pharmacol. 2015, 6, 289. [Google Scholar] [CrossRef]
  47. Stiedl, O.; Pappa, E.; Konradsson-Geuken, A.; Ogren, S.O. The role of the serotonin receptor subtypes 5-HT1A and 5-HT7 and its interaction in emotional learning and memory. Front. Pharmacol. 2015, 6, 162. [Google Scholar] [CrossRef] [PubMed]
  48. Pitoy, M.; Gauthier, L.; Debatisse, J.; Maulave, J.; Metereau, E.; Beaudoin, M.; Portier, K.; Sgambato, V.; Billard, T.; Zimmer, L.; et al. SB-258585 reduces food motivation while blocking 5-HT6 receptors in the non-human primate striatum. Prog. Neuropsychopharmacol. Biol. Psychiatry 2024, 131, 110970. [Google Scholar] [CrossRef]
Diversity 17 00104 g001
Figure 1. Nucleotide and deduced amino acid sequences of Sj5-HT6r. The initiation codon (ATG) and stop codon (TGA) are indicated with black boxes. The predicted transmembrane regions are indicated in gray shading; the predicted extracellular region is indicated in bold pink underline; the predicted intracellular region is indicated in bold green underline; the predicted glycosylation sites are indicated by ▲; the blue boxes mark the predicted phosphorylation sites for tyrosine (Y), the red for threonine (T), and the green for serine (S). The numbers on the left represent nucleotide and amino acid numbers, respectively. The polyadenylation signal sequence (TATAA) is marked with a black underline.
Figure 1. Nucleotide and deduced amino acid sequences of Sj5-HT6r. The initiation codon (ATG) and stop codon (TGA) are indicated with black boxes. The predicted transmembrane regions are indicated in gray shading; the predicted extracellular region is indicated in bold pink underline; the predicted intracellular region is indicated in bold green underline; the predicted glycosylation sites are indicated by ▲; the blue boxes mark the predicted phosphorylation sites for tyrosine (Y), the red for threonine (T), and the green for serine (S). The numbers on the left represent nucleotide and amino acid numbers, respectively. The polyadenylation signal sequence (TATAA) is marked with a black underline.
Diversity 17 00104 g001
Diversity 17 00104 g002
Figure 2. Alignments of the predicted amino acid sequences of Sj5-HT6r compared with homologous sequences from other species. The deduced amino acid sequences of Sj5-HT6r conserved residues are highlighted with identical amino acids marked in red shading and similar amino acids in yellow shading. Gaps are indicated by dashes. Green solid bold lines represent alpha helices, purple solid bold lines indicate 310 helices, and transmembrane regions are shown with red lines. Abbreviations: SpHT6r: 5-HT6r of S. pharaonis; Ob5-HT6r: 5-HT6r of O. bimaculoides; Hdh5-HT6r-like: 5-HT6r of H. discus hannai; My5-HT6r-like: 5-HT6r-like of M. yessoensis, Pm5-HT6r-like: 5-HT6r-like of P. maximus; Cv5-HT6r-like: 5-HT6r-like of C. virginica.
Figure 2. Alignments of the predicted amino acid sequences of Sj5-HT6r compared with homologous sequences from other species. The deduced amino acid sequences of Sj5-HT6r conserved residues are highlighted with identical amino acids marked in red shading and similar amino acids in yellow shading. Gaps are indicated by dashes. Green solid bold lines represent alpha helices, purple solid bold lines indicate 310 helices, and transmembrane regions are shown with red lines. Abbreviations: SpHT6r: 5-HT6r of S. pharaonis; Ob5-HT6r: 5-HT6r of O. bimaculoides; Hdh5-HT6r-like: 5-HT6r of H. discus hannai; My5-HT6r-like: 5-HT6r-like of M. yessoensis, Pm5-HT6r-like: 5-HT6r-like of P. maximus; Cv5-HT6r-like: 5-HT6r-like of C. virginica.
Diversity 17 00104 g002
Diversity 17 00104 g003
Figure 3. Phylogenetic tree of Sj5-HT6r amino acid sequence. Sj5-HT6r is indicated by the red 🔺. The tree was established with the maximum likelihood method. The topological stability was obtained by conducting 1000 bootstrap replicates. The LG model was applied to estimate evolutionary distances. The number at the node indicates the bootstrap value. Homo sapiens were selected as the outgroup to root the phylogenetic tree.
Figure 3. Phylogenetic tree of Sj5-HT6r amino acid sequence. Sj5-HT6r is indicated by the red 🔺. The tree was established with the maximum likelihood method. The topological stability was obtained by conducting 1000 bootstrap replicates. The LG model was applied to estimate evolutionary distances. The number at the node indicates the bootstrap value. Homo sapiens were selected as the outgroup to root the phylogenetic tree.
Diversity 17 00104 g003
Diversity 17 00104 g004
Figure 4. Localization of Sj5-HT6r-EGFP in HEK293 cells. DAPI (blue): nuclear staining; DiI (red): cell membrane staining; EGFP (green): Sj5-HT6r-EGFP fusion protein expression. The scale is 20 μm.
Figure 4. Localization of Sj5-HT6r-EGFP in HEK293 cells. DAPI (blue): nuclear staining; DiI (red): cell membrane staining; EGFP (green): Sj5-HT6r-EGFP fusion protein expression. The scale is 20 μm.
Diversity 17 00104 g004
Diversity 17 00104 g005
Figure 5. Expressions levels of Sj5-HT6r in female tissues at different stages. (A) Expression levels of Sj5-HT6r in different female tissues at Stage I–II. (B) Expression levels of Sj5-HT6r in different female tissues at Stage III. (C) Expression levels of Sj5-HT6r in different female tissues at Stage IV. (D) Expression levels of Sj5-HT6r in different female tissues at Stage V. (E) Expression levels of Sj5-HT6r in different female tissues at Stage VI. (F) Expression levels of Sj5-HT6r in the ovary at different stages. (G) Expression levels of Sj5-HT6r in the nidamental gland at different stages. (H) Expression levels of Sj5-HT6r in the accessory nidamental gland at different stages. Abbreviations: B, brain; OL, optic lobe; Gi, gill; H, heart; P, pancreas; Sk, skin; L, liver; M, muscle; St, stomach; I, intestine; NG, nidamental gland; OV, ovary; ANG, accessory nidamental gland. The letters (e.g., “a, ab, bc, abc”) above the bars indicate significant differences among groups. Bars sharing the same letter denote no significant difference (p > 0.05), whereas those with different letters represent statistically significant differences (p < 0.05). This analysis was conducted using a post hoc Tukey’s test.
Figure 5. Expressions levels of Sj5-HT6r in female tissues at different stages. (A) Expression levels of Sj5-HT6r in different female tissues at Stage I–II. (B) Expression levels of Sj5-HT6r in different female tissues at Stage III. (C) Expression levels of Sj5-HT6r in different female tissues at Stage IV. (D) Expression levels of Sj5-HT6r in different female tissues at Stage V. (E) Expression levels of Sj5-HT6r in different female tissues at Stage VI. (F) Expression levels of Sj5-HT6r in the ovary at different stages. (G) Expression levels of Sj5-HT6r in the nidamental gland at different stages. (H) Expression levels of Sj5-HT6r in the accessory nidamental gland at different stages. Abbreviations: B, brain; OL, optic lobe; Gi, gill; H, heart; P, pancreas; Sk, skin; L, liver; M, muscle; St, stomach; I, intestine; NG, nidamental gland; OV, ovary; ANG, accessory nidamental gland. The letters (e.g., “a, ab, bc, abc”) above the bars indicate significant differences among groups. Bars sharing the same letter denote no significant difference (p > 0.05), whereas those with different letters represent statistically significant differences (p < 0.05). This analysis was conducted using a post hoc Tukey’s test.
Diversity 17 00104 g005
Diversity 17 00104 g006
Figure 6. Expressions levels of Sj5-HT6r in male tissues at stages V and VI. (A) Expression levels of Sj5-HT6r in different male tissues at Stage V. (B) Expression levels of Sj5-HT6r in different male tissues at Stage VI. Abbreviations: B, brain; OL, optic lobe; Gi, gill; H, heart; P, pancreas; Sk, skin; L, liver; M, muscle; St, stomach; I, intestine; T, testis; SP, spermatophore. The letters (e.g., “a, ab, bc, abc”) above the bars indicate significant differences among groups. Bars sharing the same letter denote no significant difference (p > 0.05), whereas those with different letters represent statistically significant differences (p < 0.05). This analysis was conducted using a post hoc Tukey’s test.
Figure 6. Expressions levels of Sj5-HT6r in male tissues at stages V and VI. (A) Expression levels of Sj5-HT6r in different male tissues at Stage V. (B) Expression levels of Sj5-HT6r in different male tissues at Stage VI. Abbreviations: B, brain; OL, optic lobe; Gi, gill; H, heart; P, pancreas; Sk, skin; L, liver; M, muscle; St, stomach; I, intestine; T, testis; SP, spermatophore. The letters (e.g., “a, ab, bc, abc”) above the bars indicate significant differences among groups. Bars sharing the same letter denote no significant difference (p > 0.05), whereas those with different letters represent statistically significant differences (p < 0.05). This analysis was conducted using a post hoc Tukey’s test.
Diversity 17 00104 g006
Diversity 17 00104 g007
Figure 7. Expression of Sj5-HT6r mRNA in the optic lobe with ISH. (A): HE stains; (B): section treated with sense probe; (C,D): section treated with anti-sense probe. Abbreviations: med: medulla; out.gr.cel: outer granule cell layer of the deep retina; pl: plexiform; inn.gr.cel: inner granule cell layer of the deep retina. The blue dots are the positive signals.
Figure 7. Expression of Sj5-HT6r mRNA in the optic lobe with ISH. (A): HE stains; (B): section treated with sense probe; (C,D): section treated with anti-sense probe. Abbreviations: med: medulla; out.gr.cel: outer granule cell layer of the deep retina; pl: plexiform; inn.gr.cel: inner granule cell layer of the deep retina. The blue dots are the positive signals.
Diversity 17 00104 g007
Table 1. The PCR primers’ information.
Table 1. The PCR primers’ information.
NameSequence (5′-3′)Application
Sj5-HT6r-FGCTGATTTCTTGGTTGGCAAcDNA clone
Sj5-HT6r-RTCACTTCACCTTGATACCGAT
5′-RACE AdapterACCGTTCACCCGAAAAGCAACCGTCARACE
3′-RACE AdapterGGTTGGTCATTATGGTGTTGTAACGAAGTGG
5′-Sj5-HT6r-outterTGAGGCAGTTTGTAGATGTA
5′-Sj5-HT6r-innerGCCCAGATAGAGCAAAATGT
3′-Sj5-HT6r-outterTACCCGTTATTTATGCGAGAC
5′-Sj5-HT6r-innerGCCAACCAAGAAATCAGC
Sj5-HT6r-FCACCCGAAAAGCAACCGTCqPCR
Sj5-HT6r-RCGTCAAGCCCTCCATGTAAACT
GAPDH-FTGGTTCCTTGGCTTTTGCT
GAPDH-RGGTGGTGGTGCGGGTAGT
β-actin-FGCCAGTTGCTCGTTACAG
β-actin-RGCCAACAATAGATGGGAAT
S-Sj5-HT6r-FATTGTTGTCGCCTTTGTTCISH
S-Sj5-HT6r-RTAATACGACTCACTATAGGTTTTAGTTTTCGCTCGTT
A-Sj5-HT6r-FTAATACGACTCACTATAGATTGTTGTCGCCTTTGTTC
A-Sj5-HT6r-RGTTTTAGTTTTCGCTCGTT
Sj5-HT6r-Xho1-FCCGCTCGAGATGCAGAAATCTTTTSubcellular
localization
Sj5-HT6r-EcoR1-RCGGGAATTCGCACAGATGCTGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cui, W.-B.; Issangya, P.J.; Li, S.; Zhou, X.; Zheng, L.-B.; Chi, C.-F. Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity 2025, 17, 104. https://doi.org/10.3390/d17020104

AMA Style

Cui W-B, Issangya PJ, Li S, Zhou X, Zheng L-B, Chi C-F. Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity. 2025; 17(2):104. https://doi.org/10.3390/d17020104

Chicago/Turabian Style

Cui, Wen-Bo, Prisca John Issangya, Shuang Li, Xu Zhou, Li-Bing Zheng, and Chang-Feng Chi. 2025. "Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage" Diversity 17, no. 2: 104. https://doi.org/10.3390/d17020104

APA Style

Cui, W.-B., Issangya, P. J., Li, S., Zhou, X., Zheng, L.-B., & Chi, C.-F. (2025). Identification, Localization, and Expression Analysis of 5-HT6 Receptor, and Primary Role in Sepiella japonica, Based on Sex and Life Stage. Diversity, 17(2), 104. https://doi.org/10.3390/d17020104

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop