Tobacco Mild Green Mosaic Virus (TMGMV) Isolates from Different Plant Families Show No Evidence of Differential Adaptation to Their Host of Origin
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus Isolates
2.2. Assayed Plant Hosts and Inoculations
2.3. Nucleotide Sequence Determination and Analyses
2.4. Quantification of Infectivity, Virus Multiplication and Virulence
2.5. Statistical Analyses
3. Results
3.1. Characterisation of Two New Isolates of TMGMV
3.2. Assay of the Host Range of Four TMGMV Isolates
3.3. Accumulation of TMGMV Isolates in Ten Host Plant Species
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Primer | Sequence | Position a |
---|---|---|
TMGMV 5a-FW | 5′ GATGTTTTAATAGTTTTCGACAACAACAA 3′ | 1–29 nt |
801 REV | 5′ CGTAACCTCCGTCTGGTCTAG 3′ | 801–781 nt |
637 FW | 5′ CATCCRCCAGAGAATAGTGG 3′ | 637–656 nt |
1460 REV | 5′ GCAGCCAGCTT AGTCTGC 3′ | 1460–1443 nt |
1290 FW | 5′ CAGRACATATCAAGCCAAAGCG 3′ | 1290–1311 nt |
2127 REV | 5′ CACRCTATCCACGCAAGC 3′ | 2127–2110 nt |
1900 FW | 5′ GATAAGCCAACCGAGGAGA 3′ | 1900–1918 nt |
2723 REV | 5′ TCTACCGTTCTCACATTGTCC 3′ | 2723–2703 nt |
2531 FW | 5′ ACGAACCTACTGCAAAGATGG 3′ | 2531–2551 nt |
3331 REV | 5′ CTAAAGGATCTAACACTACGG 3′ | 3331–3311 nt |
3164 FW | 5′ TGAACACCGTTCATGAGATCC 3′ | 3164–3184 nt |
3976 REV | 5′ GTTGAGCCTTGATCATGTGC 3′ | 3976–3957 nt |
3753 FW | 5′ CGATTGACATTGAGAGCACYGC 3′ | 3752–3773 nt |
4647 REV | 5′ CACTATTGCTCCCTTATCATGG 3′ | 4647–4626 nt |
4443 FW | 5′ GGGYTCAATGTTACCKATGG 3′ | 4443–4462 nt |
5108 FW | 5′ GTAGTGTCTGGGGAGTGG 3′ | 5108–5125 nt |
5909 REV | 5′ ATCAACGGATCAAGCGTCG 3′ | 5909–5891 nt |
TMGMV_CP_RDA_F | 5′ CGAGTCTATCGCGTCATCGAGTACG 3′ | 5631–5655 nt |
TMGMV_CP_RDA_R | 5′ CTAAGTAGCCGGAGTTGTGGTCCAG 3′ | 6146–6122 nt |
References
- Elena, S.F.; Fraile, A.; García-Arenal, F. Evolution and emergence of plant viruses. Adv. Virus Res. 2014, 88, 161–191. [Google Scholar] [PubMed]
- McLeish, M.J.; Fraile, A.; García-Arenal, F. Ecological complexity in plant virus host range evolution. Adv. Virus Res. 2018, 101, 293–339. [Google Scholar]
- Woolhouse, M.E.J.; Gowtage-Sequeria, S. Host range and emerging and reemerging pathogens. Emerg. Infect. Dis. 2005, 11, 1842–1847. [Google Scholar] [CrossRef] [PubMed]
- Elena, S.F.; Sanjuán, R. Virus evolution: Insights from an experimental approach. Annu. Rev. Ecol. Evol. Syst. 2007, 38, 27–52. [Google Scholar] [CrossRef]
- Futuyma, D.J.; Moreno, G. The evolution of ecological specialization. Annu. Rev. Ecol. Syst. 1988, 19, 207–233. [Google Scholar] [CrossRef]
- García-Arenal, F.; Fraile, A. Trade-offs in host range evolution of plant viruses. Plant Pathol. 2013, 62, 2–9. [Google Scholar] [CrossRef]
- Woolhouse, M.E.J.; Taylor, L.H.; Haydon, D.T. Population biology of multihost pathogens. Science 2001, 292, 1109–1112. [Google Scholar] [CrossRef]
- Babalola, B.; Fraile, A.; McLeish, M.; García-Arenal, F. Ecological strategies for resource use by three bromoviruses in anthropic and wild plant communities. Viruses 2023, 15, 1779. [Google Scholar] [CrossRef]
- Peláez, A.; McLeish, M.J.; Paswan, R.R.; Dubay, B.; Fraile, A.; García-Arenal, F. Ecological fitting is the forerunner to diversification in a plant virus with broad host range. J. Evol. Biol. 2021, 34, 1917–1931. [Google Scholar] [CrossRef]
- Zamfir, A.D.; Babalola, B.M.; Fraile, A.; McLeish, M.J.; García-Arenal, F. Tobamoviruses show broad host ranges and little genetic diversity among four habitat types of a heterogeneous ecosystem. Phytopathology 2023, 113, 1697–1707. [Google Scholar] [CrossRef]
- Agosta, S.J.; Klemens, J.A. Ecological fitting by phenotypically flexible genotypes: Implications for species associations, community assembly and evolution. Ecol. Lett. 2008, 11, 1123–1134. [Google Scholar] [CrossRef] [PubMed]
- Alexander, H.M.; Mauck, K.E.; Whitfield, A.E.; Garrett, K.A.; Malmstrom, C.M. Plant-virus interactions and the agro-ecological interface. Eur. J. Plant Pathol. 2014, 138, 529–547. [Google Scholar] [CrossRef]
- Gibbs, A.J.; Hajizadeh, M.; Ohshima, K.; Jones, R.A.C. The Potyviruses: An Evolutionary Synthesis Is Emerging. Viruses 2020, 12, 132. [Google Scholar] [CrossRef] [PubMed]
- Roossinck, M.J.; García-Arenal, F. Ecosystem simplification, biodiversity loss and plant virus emergence. Curr. Opin. Virol. 2015, 10, 56–62. [Google Scholar] [CrossRef]
- Kutnjak, D.; Tamisier, L.; Adams, I.; Boonham, N.; Candresse, T.; Chiumenti, M.; De Jonghe, K.; Kreuze, J.F.; Lefebvre, M.; Silva, G.; et al. A Primer on the Analysis of High-Throughput Sequencing Data for Detection of Plant Viruses. Microorganisms 2021, 9, 841. [Google Scholar] [CrossRef] [PubMed]
- Maclot, F.; Candresse, T.; Filloux, D.; Malmstrom, C.M.; Roumagnac, P.; van der Vlugt, R.; Massart, S. Illuminating an Ecological Blackbox: Using High Throughput Sequencing to characterize the plant virome across scales. Front. Microbiol. 2020, 11, 578064. [Google Scholar] [CrossRef]
- Massart, S.; Candresse, T.; Gil, J.; Lacomme, C.; Predajna, L.; Ravnikar, M.; Reynard, J.-S.; Rumbou, A.; Saldarelli, P.; Škorić, D.; et al. A Framework for the Evaluation of Biosecurity, Commercial, Regulatory, and Scientific Impacts of Plant Viruses and Viroids Identified by NGS Technologies. Front. Microbiol. 2017, 8, 45. [Google Scholar] [CrossRef]
- McLeish, M.J.; Fraile, A.; García-Arenal, F. Trends and gaps in forecasting plant virus disease risk. Ann. Appl. Biol. 2020, 176, 102–108. [Google Scholar] [CrossRef]
- Bernardo, P.; Charles-Dominique, T.; Barakat, M.; Ortet, P.; Fernandez, E.; Filloux, D.; Hartnady, P.; Rebelo, T.A.; Cousins, S.R.; Mesleard, F.; et al. Geometagenomics illuminates the impact of agriculture on the distribution and prevalence of plant viruses at the ecosystem scale. ISME J. 2018, 12, 173–184. [Google Scholar] [CrossRef]
- Jones, R.A.C. Trends in plant virus epidemiology: Opportunities from new or improved technologies. Virus Res. 2014, 186, 3–19. [Google Scholar] [CrossRef]
- Kamitani, M.; Nagano, A.J.; Honjo, M.N.; Kudoh, H. A survey on plant viruses in natural Brassicaceae communities using RNA-Seq. Microb. Ecol. 2019, 78, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Marais, A.; Lefebvre, M.; Faure, C.; Candresse, T. Metagenomic analysis of virome cross-talk between cultivated Solanum lycopersicum and wild Solanum nigrum. Virology 2020, 540, 38–44. [Google Scholar] [CrossRef]
- Maachi, A.; Donaire, L.; Hernando, Y.; Aranda, M.A. Genetic differentiation and migration fluxes of viruses from melon crops and crop edge weeds. J. Virol. 2022, 96, e00421–e00422. [Google Scholar] [CrossRef] [PubMed]
- McLeish, M.J.; Zamfir, A.D.; Babalola, B.M.; Peláez, A.; Fraile, A.; Garcia-Arenal, F. Metagenomics show high spatiotemporal virus diversity and ecological compartmentalisation: Viromes of melon, Cucumis melo, crops and adjacent wild communities. Virus Evol. 2022, 8, veac095. [Google Scholar] [CrossRef] [PubMed]
- Muthukumar, V.; Melcher, U.; Pierce, M.M.; Wiley, G.B.; Roe, B.A.; Palmer, M.W.; Thapa, V.; Ali, A.; Ding, T. Non-cultivated plants of the Tallgrass Prairie Preserve of northeastern Oklahoma frequently contain virus-like sequences in particulate fractions. Virus Res. 2009, 141, 169–173. [Google Scholar] [CrossRef] [PubMed]
- Roossinck, M.J.; Saha, P.; Wiley, G.B.; Quan, J.; White, J.D.; Lai, H.; Chavarria, F.; Shen, G.; Roe, B.A. Ecogenomics: Using massively parallel pyrosequencing to understand virus ecology. Mol. Ecol. 2010, 19, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Souza, T.A.; Silva, J.M.F.; Nagata, T.; Martins, T.P.; Nakasu, E.Y.T.; Inoue-Nagata, A.K. A temporal diversity analysis of Brazilian Begomoviruses in tomato reveals a decrease in species richness between 2003 and 2016. Front. Plant Sci. 2020, 11, 1201. [Google Scholar] [CrossRef]
- Susi, H.; Filloux, D.; Frilander, M.J.; Roumagnac, P.; Laine, A.L. Diverse and variable virus communities in wild plant populations revealed by metagenomic tools. PeerJ 2019, 7, e6140. [Google Scholar] [CrossRef]
- Dombrovsky, A.; Tran-Nguyen, L.T.T.; Jones, R.A.C. Cucumber green mottle mosaic virus: Rapidly increasing global distribution, etiology, epidemiology, and management. Annu. Rev. Phytopathol. 2017, 55, 231–256. [Google Scholar] [CrossRef]
- Salem, N.M.; Jewehan, A.; Aranda, M.A.; Fox, A. Tomato brown rugose fruit virus pandemic. Annu. Rev. Phytopathol. 2023, 61, 137–164. [Google Scholar] [CrossRef]
- Velasco, L.; Ruiz, L.; Galipienso, L.; Rubio, L.; Janssen, D. A historical account of viruses in intensive horticultural crops in the Spanish Mediterranean Arc: New challenges for a sustainable agriculture. Agronomy 2020, 10, 860. [Google Scholar] [CrossRef]
- Dombrovsky, A.; Smith, E. Seed Transmission of Tobamoviruses: Aspects of Global Disease Distribution. In Seed Biology; Jiménez-López, J.C., Ed.; IntechOpen: London, UK, 2017; pp. 233–260. [Google Scholar]
- Gooding, G.V. Tobacco mosaic virus epidemiology and control. In The Plant Viruses. The Viruses; Van Regenmortel, M.H.V., Fraenkel-Conrat, H., Eds.; Springer: Boston, MA, USA, 1986; pp. 133–152. [Google Scholar]
- Darzi, E.; Smith, E.; Shargil, D.; Lachman, O.; Ganot, L.; Dombrovsky, A. The honeybee Apis mellifera contributes to Cucumber green mottle mosaic virus spread via pollination. Plant Pathol. 2018, 67, 244–251. [Google Scholar] [CrossRef]
- Levitzky, N.; Smith, E.; Lachman, O.; Luria, N.; Mizrahi, Y.; Bakelman, H.; Sela, N.; Laskar, O.; Milrot, E.; Dombrovsky, A. The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes. PLoS ONE 2019, 14, e0210871. [Google Scholar] [CrossRef] [PubMed]
- Okada, K.; Kusakari, S.M.; Kawaratani, N.; Negoro, J.; Ohki, S.Y.; Osaki, T. Tobacco mosaic virus Is transmissible from tomato to tomato by pollinating bumblebees. J. Gen. Plant Pathol. 2000, 88, 71–74. [Google Scholar] [CrossRef]
- Fraile, A.; García-Arenal, F. Tobamoviruses as models for the study of virus evolution. Adv. Virus Res. 2018, 102, 89–116. [Google Scholar]
- Gibbs, A.J.; Wood, J.; García-Arenal, F.; Ohshima, K.; Armstrong, J.S. Tobamoviruses have probably co-diverged with their eudicotyledonous hosts for at least 110 million years. Virus Evol. 2015, 1, vev0192. [Google Scholar] [CrossRef]
- Salem, N.M.; Abumuslem, M.; Turina, M.; Samarah, N.; Sulaiman, A.; Abu-Irmaileh, B.; Ata, Y. New weed hosts for tomato brown rugose fruit virus in wild Mediterranean vegetation. Plants 2022, 11, 2287. [Google Scholar] [CrossRef]
- Xu, W.; Li, H.; Sivasithamparam, K.; Tran, D.T.; Jones, M.G.K.; Chen, X.; Wylie, S.J. Spillover of a Tobamovirus from the Australian indigenous flora to invasive weeds. Viruses 2022, 14, 1676. [Google Scholar] [CrossRef]
- Skelton, A.; Nixon, T.; Monge, W.; Bennett, S.; Daly, M.; Hobden, E.; Harju, V. Tobacco mild green mosaic virus in Impatiens and Osteospermum: New hosts and first report in the UK. Plant Pathol. 2010, 59, 1160. [Google Scholar] [CrossRef]
- Wetter, C. Tobacco mild green mosaic virus. In The Plant Viruses. The Viruses; Van Regenmortel, M.H.V., Fraenkel-Conrat, H., Eds.; Springer: Boston, MA, USA, 1986; pp. 205–219. [Google Scholar]
- McKinney, H.H. Mosaic diseases in the Canary Islands, West Africa and Gibraltar. J. Agric. Res. 1929, 39, 577–578. [Google Scholar]
- Fraile, A.; Malpica, J.M.; Aranda, M.A.; Rodríguez-Cerezo, E.; García-Arenal, F. Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 1996, 223, 148–155. [Google Scholar] [CrossRef] [PubMed]
- Randles, J.W.; Palukaitis, P.; Davies, C. Natural distribution, spread, and variation, in the tobacco mosaic virus infecting Nicotiana glauca in Australia. Ann. Appl. Biol. 1981, 98, 109–119. [Google Scholar] [CrossRef]
- Bald, J.G.; Goodchild, D.J. Tobacco mosaic virus in Nicotiana glauca. Phytopathology 1960, 50, 497–499. [Google Scholar]
- Fraile, A.; Escriu, F.; Aranda, M.A.; Malpica, J.M.; Gibbs, A.J.; García-Arenal, F. A century of tobamovirus evolution in an Australian population of Nicotiana glauca. J. Virol. 1997, 71, 8316–8320. [Google Scholar] [CrossRef] [PubMed]
- Moury, B.; Verdin, E. Viruses of pepper crops in the Mediterranean basin: A remarkable stasis. Adv. Virus Res. 2012, 84, 127–162. [Google Scholar] [PubMed]
- Bera, S.; Fraile, A.; García-Arenal, F. Analysis of fitness trade-offs in the host range expansion of an RNA virus, tobacco mild green mosaic virus. J. Virol. 2018, 92, e01268-18. [Google Scholar] [CrossRef]
- Bruening, G.; Beachy, R.N.; Scalla, R.; Zaitlin, M. In vitro and in vivo translation of the ribonucleic acids of a cowpea strain of tobacco mosaic virus. Virology 1976, 71, 498–517. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Genetic Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Belgorodski, N.; Greiner, M.; Tolksdorf, K.; Schueller, K. rriskDistributions: Fitting Distributions to Given Data or Known Quantiles. R Package Version 2.1.2. 2017. Available online: https://CRAN.R-project.org/package=rriskDistributions (accessed on 14 October 2023).
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2023; Available online: https://www.R-project.org/ (accessed on 10 October 2023).
- Lajeunesse, M.J.; Forbes, M.R. Host range and local parasite adaptation. Proc. R. Soc. London. Ser. B Biol. Sci. 2002, 269, 703–710. [Google Scholar] [CrossRef]
- Roossinck, M.J. The good viruses: Viral mutualistic symbioses. Nat. Rev. Microbiol. 2011, 9, 99–108. [Google Scholar] [CrossRef]
- Holmes, F.O. A comparison of the experimental host ranges of tobacco etch and tobacco mosaic viruses. Phytopathology 1946, 36, 643–659. [Google Scholar]
- Kovachevsky, I.C. Untersuchungen über das Wegerichmosaic in Bulgarien. Phytopathol. J. 1963, 49, 127–146. [Google Scholar] [CrossRef]
- Varma, A. Sunn-Hemp Mosaic Virus. In The Plant Viruses. The Viruses; Van Regenmortel, M.H.V., Fraenkel-Conrat, H., Eds.; Springer: Boston, MA, USA, 1986; pp. 249–266. [Google Scholar]
- Moreno-Pérez, M.G.; García-Luque, I.; Fraile, A.; García-Arenal, F. Mutations that determine resistance breaking in a plant RNA virus have pleiotropic effects on its fitness that depend on the host environment and on the type, single or mixed, of infection. J. Virol. 2016, 90, 9128–9137. [Google Scholar] [CrossRef] [PubMed]
- Doumayrou, J.; Leblaye, S.; Froissart, R.; Michalakis, Y. Reduction of leaf area and symptom severity as proxies of disease-induced plant mortality: The example of the Cauliflower mosaic virus infecting two Brassicaceae hosts. Virus Res. 2013, 197, 91–100. [Google Scholar] [CrossRef] [PubMed]
- Fraile, A.; García-Arenal, F. Environment and evolution modulate plant virus pathogenesis. Curr. Opin. Virol. 2016, 17, 50–56. [Google Scholar] [CrossRef]
- Xu, P.; Chen, F.; Mannas, J.P.; Feldman, T.; Sumner, L.W.; Roossinck, M.J. Virus infection improves drought tolerance. New Phytol. 2008, 180, 911–921. [Google Scholar] [CrossRef]
- García-Arenal, F.; Fraile, A. Population dynamics and genetics of plant infection by viruses. In Recent Advances in Plant Virology; Caranta, C., Aranda, M.A., Tepfer, M., López-Moya, J.J., Eds.; Caister Academic Press: Poole, UK, 2011; pp. 263–282. [Google Scholar]
- Kawecki, T.J.; Ebert, D. Conceptual issues in local adaptation. Ecol. Lett. 2004, 7, 1225–1241. [Google Scholar] [CrossRef]
- Kurath, G.; Heick, J.A.; Dodds, J.A. RNase protection analyses show high genetic diversity among field isolates of satellite tobacco mosaic virus. Virology 1993, 194, 414–418. [Google Scholar] [CrossRef]
- Rodríguez-Cerezo, E.; Elena, S.F.; Moya, A.; García-Arenal, F. High genetic stability in natural populations of the plant RNA virus tobacco mild green mosaic virus. J. Mol. Evol. 1991, 32, 328–332. [Google Scholar] [CrossRef]
- Sacristán, S.; Díaz, M.; Fraile, A.; García-Arenal, F. Contact transmission of tobacco mosaic virus: A quantitative analysis of parameters relevant for virus evolution. J. Virol. 2011, 85, 4974–4981. [Google Scholar] [CrossRef]
Host Species | Family | 96/5 N. glauca | P92/10 C. annuum | PV081 L. arvense | PV063 C. melo | Total |
---|---|---|---|---|---|---|
A. undulata | Boraginaceae | 5/5 (100) | 4/4 (100) | 4/5 (80) | 3/5 (60) | 16/19 (84) |
B. distachyon | Poaceae | 8/10 (80) | 9/10 (90) | 10/10 (100) | 10/10 (100) | 37/40 (92) |
C. annuum | Solanaceae | 9/10 (90) | 10/10 (100) | 6/10 (60) | 10/10 (100) | 35/40 (87) |
C. assoi | Asteraceae | 5/10 (50) | 6/10 (60) | 7/10 (70) | 8/10 (90) | 26/40 (65) |
C. melo cv. Piel de Sapo | Cucurbitaceae | 0/10 (0) | 8/10 (80) | 4/9 (44) | 9/9 (100) | 21/38 (55) |
C. paniculata | Asteraceae | 7/10 (70) | 5/10 (50) | 5/9 (55) | 9/9 (100) | 26/38 (68) |
H. vulgare | Poaceae | 7/10 (70) | 10/10 (100) | 10/10 (100) | 8/10 (80) | 35/40 (87) |
M. supinum | Lamiaceae | 7/10 (70) | 6/9 (67) | 5/9 (55) | 8/10 (80) | 26/38 (68) |
N. tabacum | Solanaeae | 10/10 (100) | 9/10 (90) | 10/10 (100) | 10/10 (100) | 39/40 (98) |
S. eburneum | Asteraceae | 3/5 (60) | 4/5 (80) | 4/6 (67) | 5/6 (83) | 16/22 (73) |
Total | - | 61/90 (68) | 71/88 (81) | 65/88 (74) | 80/89 (90) | 277/355 (78) |
Host Species | Family | 96/5 N. glauca | P92/10 C. annuum | PV081 L. arvense | PV063 C. melo | Total |
---|---|---|---|---|---|---|
A. undulata | Boraginaceae | 0.040 ± 0.011 | 0.317 ± 0.165 | 4.264 ± 4.182 | 4.290 ± 4.253 | 2.230 ± 1.026 |
B. distachyon | Poaceae | 0.047 ± 0.013 | 0.058 ± 0.016 | 0.035 ± 0.009 | 0.032 ± 0.009 | 0.038 ± 0.008 |
C. annuum | Solanaceae | 27.450 ± 8.881 | 0.142 ± 0.049 | 36.610 ± 8.334 | 28.350 ± 6.147 | 23.100 ± 6.882 |
C. assoi | Asteraceae | 0.072 ± 0.031 | 0.116 ± 0.046 | 0.002 ± 0.001 | 1.524 ± 0.663 | 0.428 ± 0.317 |
C. melo cv. Piel de Sapo | Cucurbitaceae | - | 0.383 ± 0.077 | 0.258 ± 0.098 | 0.113 ± 0.026 | 0.251 ± 0.055 |
C. paniculata | Asteraceae | 0.073 ± 0.039 | 0.547 ± 0.480 | 0.104 ± 0.094 | 7.921 ± 4.302 | 2.160 ± 1.665 |
H. vulgare | Poaceae | 0.041 ± 0.027 | 0.041 ± 0.011 | 0.020 ± 0.011 | 0.032 ± 0.022 | 0.028 ± 0.007 |
M. supinum | Lamiaceae | 11.630 ± 4.769 | 0.023 ± 0.007 | 7.791 ± 3.111 | 5.062 ± 1.996 | 6.130 ± 2.110 |
N. tabacum | Solanaeae | 63.782 ± 5.520 | 32.429 ± 7.202 | 53.686 ± 3.463 | 40.773 ± 2.178 | 47.700 ± 5.998 |
S. eburneum | Asteraceae | 12.725 ± 6.377 | 0.136 ± 0.037 | 10.922 ± 10.841 | 15.631 ± 9.575 | 9.850 ± 2.929 |
Total | - | 12.873 ± 7.098 | 3.419 ± 3.224 | 11.369 ± 5.896 | 10.373 ± 4.402 | 9.191 ± 4.838 |
Host Species | Family | 96/5 N. glauca | P92/10 C. annuum | PV081 L. arvense | PV063 C. melo | Total |
---|---|---|---|---|---|---|
A. undulata | Boraginaceae | 0.1564 ± 0.1538 | 0.0015 ± 0.0006 | 0.0011 ± 0.0004 | 2.3508 ± 2.3498 | 0.627 ± 0.498 |
B. distachyon | Poaceae | 0.0004 ± 0.0002 | 0.0003 ± 0.0002 | 0.0003 ± 4 × 10−5 | 0.0014 ± 0.0003 | 0.0006 ± 0.0002 |
C. annuum | Solanaceae | 0.2604 ± 0.1238 | 0.2118 ± 0.0714 | 0.2795 ± 0.2578 | 0.0075 ± 0.0018 | 0.1900 ± 0.0540 |
C. assoi | Asteraceae | 0.0060 ± 0.0026 | 0.0032 ± 0.0011 | 0.0014 ± 0.0005 | 0.0112 ± 0.0056 | 0.0054 ± 0.0019 |
C. melo cv. Piel de Sapo | Cucurbitaceae | - | 0.00024 ± 6.3 × 10−5 | 0.0004 ± 0.0001 | 6.6 × 10−5 ± 8 × 10−6 | 0.0002 ± 0.00006 |
C. paniculata | Asteraceae | 0.0865 ± 0.0223 | 0.0819 ± 0.0182 | 0.0608 ± 0.0093 | 0.0284 ± 0.0061 | 0.0644 ± 0.0115 |
H. vulgare | Poaceae | 9.1 × 10−5 ± 2.1 × 10−5 | 0.0003 ± 0.0001 | 0.0001 ± 7.5 × 10−5 | 0.0002 ± 5.9 × 10−5 | 0.0002 ± 0.00005 |
M. supinum | Lamiaceae | 0.0018 ± 0.0003 | 0.0006 ± 0.0001 | 0.0012 ± 0.0004 | 0.0007 ± 9 × 10−5 | 0.0011 ± 0.0002 |
N. tabacum | Solanaeae | 16.6255 ± 7.3280 | 10.3038 ± 4.5800 | 22.5143 ± 5.6892 | 38.9237 ± 11.0730 | 22.1000 ± 5.3170 |
S. eburneum | Asteraceae | 0.0035 ± 0.0017 | 0.0036 ± 0.0013 | 0.0113 ± 0.0055 | 0.0151 ± 0.0079 | 0.0084 ± 0.0025 |
Total | - | 1.905 ± 1.840 | 1.061 ± 1.027 | 2.287 ± 2.248 | 4.134 ± 3.873 | 2.2989 ± 2.2001 |
Assayed Leaf | Host | Cultivar | 96/5 N. glauca | 92/73 N. glauca | PV063 C. melo |
---|---|---|---|---|---|
Inoculated | C. melo | Amarillo | 0.068 ± 0.016 | 0.237 ± 0.133 | 0.114 ± 0.022 |
Inoculated | C. melo | Piel de Sapo | 0.038 ± 0.016 | 0.133 ± 0.057 | 0.055 ± 0.02 |
Systemically infected | C. melo | Amarillo | 0.0002 ± 10−5 | 0.0003 ± 10−5 | 0.0009 ± 0.0004 |
Systemically infected | C. melo | Piel de Sapo | 0.0003 ± 10−5 | 0.0003 ± 10−5 | 0.0003 ± 10−5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Andrés-Torán, R.; Guidoum, L.; Zamfir, A.D.; Mora, M.Á.; Moreno-Vázquez, S.; García-Arenal, F. Tobacco Mild Green Mosaic Virus (TMGMV) Isolates from Different Plant Families Show No Evidence of Differential Adaptation to Their Host of Origin. Viruses 2023, 15, 2384. https://doi.org/10.3390/v15122384
de Andrés-Torán R, Guidoum L, Zamfir AD, Mora MÁ, Moreno-Vázquez S, García-Arenal F. Tobacco Mild Green Mosaic Virus (TMGMV) Isolates from Different Plant Families Show No Evidence of Differential Adaptation to Their Host of Origin. Viruses. 2023; 15(12):2384. https://doi.org/10.3390/v15122384
Chicago/Turabian Stylede Andrés-Torán, Rafael, Laura Guidoum, Adrian D. Zamfir, Miguel Ángel Mora, Santiago Moreno-Vázquez, and Fernando García-Arenal. 2023. "Tobacco Mild Green Mosaic Virus (TMGMV) Isolates from Different Plant Families Show No Evidence of Differential Adaptation to Their Host of Origin" Viruses 15, no. 12: 2384. https://doi.org/10.3390/v15122384
APA Stylede Andrés-Torán, R., Guidoum, L., Zamfir, A. D., Mora, M. Á., Moreno-Vázquez, S., & García-Arenal, F. (2023). Tobacco Mild Green Mosaic Virus (TMGMV) Isolates from Different Plant Families Show No Evidence of Differential Adaptation to Their Host of Origin. Viruses, 15(12), 2384. https://doi.org/10.3390/v15122384