Next Article in Journal
Enteroviruses, Respiratory Syncytial Virus and Seasonal Coronaviruses in Influenza-like Illness Cases in Nepal
Previous Article in Journal
Dietary Administration Effects of Microbial Exopolysaccharide from Bacillus subtilis P1 on Growth Performance and Immunity in Nile Tilapia (Oreochromis niloticus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 15
Issue 4
10.3390/microbiolres15040149
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Mycotoxins Effects on Nile Tilapia (Oreochromis niloticus) Microbiomes Can Be Mitigated with Addition of Organically Modified Clinoptilolites

by
Wanvisa Hussein
1,2,
Paulina Cholewińska
1,
Konrad Wojnarowski
1,*,
Natalia Szeligowska
1,
Fangyuan Hu
1,
Monika Greguła-Kania
3,
Jiraporn Rojtinnakorn
2,* and
Dušan Palić
1
1
Fish Diseases and Fisheries Biology, Ludwig Maximilian University of Munich, 80539 Munich, Germany
2
Faculty of Fisheries Technology and Aquatic Resources, Maejo University, Chiang Mai 50290, Thailand
3
Department of Animal Breeding and Agriculture Advisory, Faculty of Animal Sciences and Bioeconomy, University of Life Sciences in Lublin, 20-400 Lublin, Poland
*
Authors to whom correspondence should be addressed.
Microbiol. Res. 2024, 15(4), 2232-2246; https://doi.org/10.3390/microbiolres15040149
Submission received: 10 October 2024 / Revised: 28 October 2024 / Accepted: 29 October 2024 / Published: 31 October 2024
Browse Figures
Versions Notes

Abstract

:
Mechanisms of action attributed to feed additives are of continuous research interest, increasing our knowledge about the side effects (direct or indirect) of their application. The primary role of organically modified clinoptilolite is to bind multiple polar and non-polar mycotoxins contaminating the feed and remove them during the digestion process and through feces, therefore preventing adsorption and consequences of mycotoxicosis on fish health. However, it is not fully understood if this binding action can influence bacterial communities in the fish digestive tract and possibly other organs, as well as the aquatic environment. Therefore, in this study, Nile tilapias (Oreochromis niloticus) (average weight: 30 ± 2 g; n = 48) were simultaneously exposed to low-level mycotoxins (AFB1 40 µg/kg, FB 600 µg/kg, ZEN 50 µg/kg, and DON 150 µg/kg) added to diet, with and without supplementation of commercially available organically modified clinoptilolite feed additive (MinazelPlus®, 2 g/kg). After 42 days of continuous exposure, gill tissue, feces, and water were collected, and DNA was extracted from the samples. Results of RT-PCR analysis have revealed significant changes in microbiomes in fish from different groups, most prominently in mycotoxin-exposed fish. No significant changes were detected in water samples between the control and MinazelPlus® groups, confirming the safety of MinazelPlus® for aquatic microbial communities. MinazelPlus® addition to the mycotoxin spiked diet, stabilized fish natural microbiota, and prevented the disbalance of microbial homeostasis observed in fish exposed to dietary mycotoxins.

1. Introduction

Microbial communities associated with fishes are highly variable and diverse and can be influenced by the surrounding environment, diet, or age, affecting the host in multiple ways. Microbiomes influence digestion, nutrient assimilation, the immune system, metabolite production, and the overall health of the host [1]. Bacteria are the most abundant and key components of the microbial communities found on the external (skin, gills) and internal surfaces (digestive system). Microbiome composition is variable, depending on the type of tissue as well as localization. For example, the gastro-intestinal (GI) tract microbiome is dominated by anaerobes or facultative aerobes (strict aerobes have also been detected, although in much smaller quantities) [2]. The bacterial composition of the GI tract consists of about 90% organisms that belong to Proteobacteria (especially Enterobacteriaceae family), Firmicutes, and Bacteroidetes, and the remaining 10% belong to less numerous phyla such as Fusobacteria, Actinobacteria, Tenericutes, and Verrucomicroba [2,3,4]. The presence of mucus can significantly affect the microbial composition of the gills and skin because of the presence of immunoglobulins and antimicrobial peptides (AMPs) with antibacterial or bacteriostatic effects [5,6]. Fish gills mucus cover contains bacterial populations in the range of 102 to 104 CFU cm2 (reported for Atlantic salmon) [6]. Toxins, antimicrobial substances, and diet are contributing factors that may change digestive tract microbiota in aquatic animals and cause microbial dysbiosis, therefore impacting the immune system of fish and increasing the risk of diseases [7,8,9,10].
Mycotoxins are widespread feed-related fungal contaminant toxins in aquaculture, attributed to plant-based components of fish diets such as soybeans, wheat, grains, and corn. These secondary metabolites are produced under stress conditions by several mold species: Aspergillus flavus (Alphatoxin B1), Gibberella zeae (Zearalenone, ZEN), Fusarium verticillioides (Fumonisin B1) and Penicillium chrysogenum (Penicillin) [11,12,13,14]. Mycotoxins pose serious problems in aquaculture production worldwide [15] and present significant risks to human and animal health, causing or contributing to chronic and acute illnesses. Mycotoxins are regarded as a global health concern and included in the broad framework of the One-Health concept [16,17], following “an integrated, unifying approach that aims to sustainably balance and optimize the health of people, animals, and ecosystems” (after: Joint Tripartite FAO, OIE, WHO commission and UNEP Statement, December 2021).
Exposure of fish to feed contaminated with mycotoxins is associated with liver and kidney pathologies, carcinogenic effects, gastro-intestinal disturbances, reproductive disorders, microbial dysbiosis, and immune system suppression [11,14,15,18,19]. Exposure to mycotoxins can, therefore, increase the risk of diseases and infections with pathogens such as Aeromonas hydrophila—which is one of the most common pathogens in aquaculture worldwide [20,21]. Frequent bacterial infection outbreaks may lead to overuse or misuse of antimicrobial substances, further influencing the emergence of resistance in bacteria and the increased presence of antimicrobial resistance genes (ARG) in water environments [22,23]. Therefore, mitigation measures and good manufacturing practices are necessary to reduce mycotoxin-related health problems.
Prevention of mycotoxins entering the food chain via animal feedstuff is carried out with different approaches, including monitoring and detection of residues and the addition of adsorbents. Clinoptilolite is a naturally occurring mineral, first described in the scientific literature in the early 1960s. Clinoptilolite is characterized by its exceptional ion-exchange properties, which make it a potent adsorbent. Its unique physicochemical properties include a complex structure comprised of the three-dimensional scaffoldlike framework of tetrahedrons built from Si(O4)-4 and Al2O3, where Al ion is in the center, and the presence of additional exchangeable cations of Na, K, and Ca that allow the clinoptilolites to exchange the ions with the chemicals present in the environment [24,25,26,27]. At a higher level, clinoptilolites are characterized by the lamellar rigid structure, further enhancing their ion-exchange properties. Such physicochemical properties are highly effective in the adsorption of various chemicals, simultaneously supporting the safety of use that has been determined in 2006 as “generally recognized as safe” by the US Food and Drug Administration, followed by the same designation in the EU in 2013 [28].
Clinoptilolite can be further modified to magnify some of its adsorptive properties and improve its selectivity, and one example of such modifications is a patented organically modified clinoptilolite-based product called MinazelPlus®. Three-step tribochemical surface modification and addition of the long-chain organic cations to the clinoptilolite surface resulted in the development of a two-fold layer of organic ligands to which non-polar mycotoxins are being adsorbed. MinazelPlus® modifications allow it to not only adsorb the mycotoxins but, at the same time, provide it with higher stability (strong binding) in the entire gastro-intestinal (GI) tract of the animals, even with large sectional differences in pH and other GI environments [24,25,29]. Modified and unmodified clinoptilolite effects on fish health and other production parameters were the subject of intensive studies in recent years. In studies performed on rainbow trout (Oncorhynchus mykiss) by Ergün et al. [30], supplementation of feed with a certain amount of zeolite has decreased levels of ammonia excretion from farmed fish. In studies performed by Zahran et al. [31], MinazelPlus® supplementation to aflatoxins contaminated diet has mitigated adverse aflatoxin effects on fish health, including antioxidant and immune responses in fish [31]. Those observations correspond with studies performed on sea bream (Sparus aurata), where the addition of MinazelPlus® has significantly improved the production parameters of the fish [32].
Recent studies demonstrated that clinoptilolite can affect the composition of the microbiome of the gut and adsorb some of the metabolites associated with it [33,34]. Clinoptilolites are known to interact with pathogenic bacteria metabolites, such as biogenic amines and ammonia, and can influence levels of Enterobacteriaceae abundance in microbial communities [33,35]. Therefore, it is of interest to determine if MinazelPlus®, with its modifications, can potentially have an even stronger influence on the state of the gut microbiota.
The aim of the present study was to analyze the effect of commercially available organically modified clinoptilolite (MinazelPlus®) on selected bacteria in intestines (including feces) and gills of Nile tilapia (Oreochromis niloticus) exposed to low doses of multiple mycotoxins in food for an extended period (42 days). The selection was based on the most abundant phyla as reported in the literature, including the Clostridiaceae family, which contains important pathogenic bacteria [2,3,4,36,37,38].

2. Materials and Methods

2.1. Animals and Feed Preparation

Nile tilapia (Oreochromis niloticus) of 30 ± 2 g individual weight were distributed randomly in 12 aquaria (50 L) equipped with continuous single pass flow system sourced from conditioned water. Three aquaria were randomly assigned per each experimental group. The fish were randomly divided into the following 4 groups (n = 12/group):
C–control group (no mycotoxin, no MinazelPlus®, basal diet).
T–a mixture of mycotoxins was added to the basal diet (Aflatoxin B1/AFB1, 40 µg/kg; Fumonisin/FUM, 600 µg/kg; Zearalenone/ZEN, 50 µg/kg; and Deoxynivalenol/DON, 150 µg/kg).
M–basal diet with mycotoxin mixture as in diet T with the addition of MinazelPlus® (2 g/kg).
Z–basal diet with the addition of MinazelPlus® (2 g/kg).
Commercially available organically modified clinoptilolite (MinazelPlus®; Patent Co., Mišićevo, Serbia) was added to the basal diet according to the safety and efficacy study protocols. The determination of the mycotoxin concentrations used in the experiment was based on the analysis of mycotoxins presence in animal feeds from Southeast Asia, as reported by Gruber-Dorninger et al. [39]. The feed was analyzed by Patent Co. for mycotoxin concentration to confirm that the required amount of mycotoxin concentration was achieved (Table 1, Supplementary File Figure S1) [24,25]. Water quality was monitored daily (NO2, temperature, pH) and weekly (NO3, KH—Carbonate Hardness, DO—Dissolved oxygen) to ensure constant environmental conditions (Table 2). Observation of general fish behavior before and during feeding was performed twice daily as part of the general laboratory animal routine check that was recorded in the animal facility logbook. Over 42 days, no differences were observed in the case of growth performance or behavior of fish. All animals were kept in condition’s accordance with the European Union Directives regarding the requirements for the use of acceptable technologies in breeding and animal welfare conditions. The research has received approval from the Ethical Committee for Animal Experiments of the Regierung von Oberbayern, Maximilianstr. 39, 80534 München (ROB–55.2-2532.Vet_02-20-142).

2.2. Experimental Design and Sampling

All fish were kept in individual tanks and fed a basal diet for 14 days in order to acclimatize, then fed with respective experimental and control diets for 42 days. After 42 days of exposure, fish were sampled (n = 10 per group), and intestines (including feces), gills, and aquarium water (n = 6/per group) were collected under aseptic conditions and placed in sterile containers. The samples were kept at −80 °C until analysis.

2.3. DNA Extraction

Extraction of DNA from water, intestines (including feces), and gills was performed using the Genomic Bacteria AX Mini kit (A&A Biotechnology, Gdansk, Poland). Then, the quality of the performed DNA isolations was checked using the Thermo Scientific NanoDrop 2000 Spectrophotometer device (Thermo Fisher, Waltham, MA, USA) and concentration on Qubit 4 Fluorometer (Thermo Fisher, Waltham, MA, USA). The average DNA content of the samples was 40 μg/μL (in 50 μL). The contamination at 260/230 (contamination related to, among others, reagents used for isolation): 2.0–2.2, and for 260/280 (contamination with substances such as enzymes and inhibitors): 1.8–2.0 (correct levels, according to the instruction manual of the device).

2.4. RT-PCR

Analysis of RT—PCR was performed with the use of an apparatus Agilent MX 3000 (Agilent Technologies, Inc., Santa Clara, CA, USA) with the SsoAdvanced™ Universal SYBR® Green Supermix kit (Bio-Rad Laboratories, Inc., Irvine, CA, USA) at a volume of 10 μL in 3 technical repetitions (Table 3). A no template control (NTC–without DNA sample, only primers and water with PCR mix) test was additionally performed for each amplicon. The real-time PCR analysis strategy was based on the amplification of specific amplicons for the tested cluster (Firmicutes, Bacteroidetes, Actinobacteria, and Proteobacteria) and family Clostridiaceae against the reference amplicon for all bacteria (16S rDNA) (Table 4). In addition, the obtained results were compared to the sample constituting the calibrator with the lowest level of the studied cluster and the lowest level of the reference amplicon in order to determine the relative level of DNA in terms of the tested amplicons [40].
A standard curve was performed for the genes tested to determine the efficiency of each gene. A sample dilution of 10−4 from the 10−2 to 10−7 series of dilutions was selected for analysis. A linear line of the fluorescent signals converted to the cycle threshold (Ct) values was plotted, and the slope of the linear equation was applied to calculate the primer efficiency according to the equation Efficiency (%) = (10 [−1/slope] −1) × 100. It was 89.4% for the Firmicutes phylum, 100.9% for Bacteroidetes, 91.6% for Actinobacteria, 94.1% for Proteobacteria, 95.4% for Clostridiaceae 98.4% and for the Universal Eubacterial Gene 94.4%.
The amplification was performed according to a protocol of 40 cycles: polymerase activation and DNA denaturation at 95 °C (3 min), denaturation at 95 °C (15 s), annealing at 60.5 °C (15 s), extension and plate reading at 72 °C (40 s). The analysis of the melting curves for the samples was performed at temperatures ranging from 65 °C (5 s) to 95 °C (0.5 °C increments in 2 s). The obtained Ct values were used for relative quantification of the DNA expression level according to the 2-ΔΔCt method (assigned as DNA level) [41].
Table 4. Primers used for analysis.
Table 4. Primers used for analysis.
NamePrimer Sequence (5′ → 3′)Forward (F)/Reverse (R)Reference
Universal Eubacterial gene530F (GTCCCAGCMGCNGCGG)F[42]
1100R (GGGTTNCGNTCGTTG)R
Firmicutes928F (TGAAACTYAAAGGAATTGACG)F[43]
1040R (ACCATGCACCACCTGTC)R
Bacteroidetes798cfbF (CRAACAGGATTAGATACCCT)F[43]
cfb967R (GGTAAGGGTTCCTCGCGTAT)R
ActinobacteriaEub338F (ACGGGCGGTGTGTACA)F[44]
Act1159R (TCCGAGTTRACCCCGGC)R
Proteobacteria27F (GAGTTTGATCMTGGCTCAG)F[45]
1529R (CAKAAAGGAGGTGATCC)R
ClostridiaceaeClos-58-f (AAAGGAAGATTAATACCGCATAA)F[46]
Clos780-r (ATCTTGCGACCGTACTCCCC)R

2.5. Statistical Analysis

The data were analyzed using R statistics software (v. 4.2.3, freely available) with packages “dyplr”, “ggpubr”, “FSA”, “vegan” and “devtools”. The Shapiro–Wilk test was performed–the data distribution was not normal for tested bacteria. As a result, the analyses were performed using PCA and the Kruskal–Wallis test (p < 0.05), where the factors were diet type. Results of the Kruskal–Wallis test and the post hoc Dunn’s multiple comparisons test showed the significance of differences between groups. Plots were created in R using ggplot2.

3. Results

3.1. Gills

In the case of gills, significant differences between the studied groups (p < 0.01) (Figure 1) were observed. Significant differences were shown in the level of bacteria (Figure 2) from the Actinobacteriota phylum between group C and Z (p = 0.0014), M and Z (p = 0.00014), and M and T (p = 0.00144). The highest levels of bacteria occurred in groups T and Z. Analysis of the Bacteroidota phylum showed differences between group C and Z (p = 0.037), where the level was lowest in group C. The Firmicutes phylum showed significant differences between groups C and M (p = 0.024), where the level of bacteria in group C was the lowest. In contrast, the greatest variation was observed in the Proteobacteria phylum. Highly significant differences were shown for this cluster between groups C and M (p = 0.0079), C and T (p = 0.0016), M and Z (p = 0.0018), and T and Z (p = 0.000408). The lowest level was shown in the T group and the highest in the Z group. However, for the Clostrodiaceae family analyzed, highly significant differences were shown between groups C and M (p = 0.00421) and M and Z (p = 0.00392), while significant differences were shown between groups M and T—p = 0.025. The highest level of Clostridiaceae bacteria occurred in group Z, while the lowest level was in group M.

3.2. Intestines

The analysis of intestines (including stool) samples showed significant differences between the analyzed groups (p < 0.01), which is also illustrated in Figure 3. In the case of the Firmicutes phylum (Figure 4), there were significant differences between group C and T (p = 0.003), where the level in group C was the highest compared to the other groups (5.84 DNA level). On the other hand, analysis of the level of the Actinobacteria phylum (Figure 4) showed significant differences between all the groups studied. Highly significant differences were shown between groups C and M (p = 0.0016), M and T (p = 0.0049), and C and Z (p = 0.0068). In turn, differences were found between groups T and Z at p = 0.0222. The highest levels of bacteria were found in group M (22.5 DNA level), while the lowest was in group C (16.8 DNA level). Significant differences were also shown between groups M and T in the level of the Clostridiaceae family, with group M having the highest level.

3.3. Water

In the case of water samples, differences in the level of bacteria (Figure 5) from the Actinobacteriota phylum were shown between groups M and Z (p = 0.0112), where the highest level of that bacteria occurred in group Z. On the other hand, analysis of the Firmicutes phylum showed highly significant differences between groups C and M (p = 0.0075), where the level of this cluster was highest in group C. Analysis of the Proteobacteria phylum showed the greatest variation. Highly significant differences were shown between groups C and M (p = 0.0018) and C and T (p = 0.0005). Significant differences were shown between groups T and Z (p = 0.0285), and the highest level of this phylum occurred in group C and the lowest in T. Analysis of the level of the Clostridiaceae family showed highly significant differences between group C and M (p = 0.00564), where group C had the highest level of this family, while group T had the lowest.

4. Discussion

Mycotoxins are secondary metabolites produced by filamentous fungi and prevention of their toxic effects is critical to food and feed safety. They negatively affect the health of the host by various mechanisms, including interference with proteins and peptides that have important functions in the immune system and metabolism, causing malfunction in the intestinal epithelium and leading to poor intestinal health and integrity [42]. Such changes also affect the composition of the microbial community, which can result in an increased risk of infection by pathogenic bacteria [47,48,49].
In this study, most of the changes in selected bacteria’s DNA levels were observed in gills (Figure 2). Gills have direct contact with the water environment, which constitutes one of the most prolific habitats of microorganisms on Earth. It is the main way of their spread in nature, as well as the most microbiologically loaded animal environment [50,51]. Gill epithelium releases mucus with defensive substances, such as immunoglobulins and antimicrobial peptides (e.g., β-defensin), to reduce the colonization potential of pathogenic or opportunistic bacteria, simultaneously supporting the abundance of neutral and beneficial bacterial microbiome composition [5,6]. Similar results to gills can also be observed in water and intestine samples. This could be due to the influence of mycotoxins on bacteria present in the water environment [52,53]. Additionally, a comparison between intestine samples, gill, and water has shown that the intestine microbial community is less vulnerable to environmental changes and toxins [50,51,54].
One of the ways to remove the mycotoxin from the feed or the environment is to use adsorption with organically modified clinoptilolite. This mineral belongs to the heulandite (HEU) group, which possesses a two-dimensional structure and manifests ion-exchange properties in water. It is used in various fields, medicine, industry, and the environment, mostly for the sequestration of toxic pollutants from industrial effluent and wastes. Additionally, it is used to absorb and remove harmful or toxic substances like mycotoxins from human and animal digestive tracts [55,56]. In animals, it may, therefore, have a stabilizing effect on the intestinal barrier due to properties that have the effect of attracting and buffering excess protons that cause acidification. It also has an inhibitory effect on the growth of pathogenic bacteria that pose a danger to both humans and farm animals, and in the case of aquatic animals, it could positively influence environmental surroundings [57,58].
In vivo studies have shown that synthetic or modified clinoptilolite can prevent pathogenic bacteria colonization (e.g., E. coli or Salmonella typhimurium), as well as selectively bind toxins (but not essential micro and macro elements, vitamins, and amino acids), further improving animal growth performance [35,57,59]. Minazel Plus® is produced by a patent-protected industrial process that embeds negatively charged organic long chains in inorganic cations from the surface of clinoptilolite (E568), allowing it to maintain a balance of positive and negative charges on the clinoptilolite surface, leading to the formation of organic-inorganic complexes on the surface of the mineral. As a result, this organic modification of clinoptilolite allows for a broader mycotoxin adsorption characteristic with improved selectivity and adsorption stability [32,60].
In our studies we have observed significant differences between group M (mycotoxin + Minazel Plus®) and T (mycotoxin). In the case of intestines, the differences were observed in Actinobacteriota phyla and the Clostridiaceae family, and in the case of gills, differences were observed in the level of Actinobacteriota phyla only. However, differences in water samples between M and T groups were not observed. Additionally, gill samples presented differences between the M group and C (control) samples, strongly suggesting that modified clinoptilolites have the potential to influence the composition of microbiota as also supported by other studies [32,57,59]. We further observed differences in intestine samples between groups M and C at the Actinobacteriota phylum level. Similar changes were seen in gills with Actinobacteriota and Bacteroidota phyla. There were no significant differences in phyla composition in the water environment between those groups. These findings suggest that there is a potentially selective effect of organically modified clinoptilolites on the microbial community [47,57,59]. However, further research is needed to determine the exact effect of the Minazel Plus® on the composition of microbiomes in different exposure routes and durations [61,62]. From a different perspective, and related to the use of antibiotics in aquaculture, it is important to investigate possibilities for using alternative products to support the homeostasis of the microbial community of the body without adversely affecting the aquatic environment [63,64,65].

5. Conclusions

In summary, the study indicates the potential for organically modified clinoptilolites to be used in the prevention of mycotoxin effects on microbiomes, as well as a tool to manipulate the fish microbiomes. The study showed that both mycotoxins and the addition of MinazelPlus® changed the composition of bacteria in intestines and gills. Observed differences in microbial communities suggest the potential of organically modified clinoptilolites to reduce mycotoxin levels and prevent mycotoxin-related microbial dysbiosis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microbiolres15040149/s1, Figure S1: Results of the feed analysis, representing diets, which were utilized in the experiment. Diet 1—Control group, Diet 2—MinazelPlus® group, Diet 3—Mycotoxins group, Diet 4—MinazelPlus® + Mycotoxins.

Author Contributions

W.H.—Conceptualization, Methodology, Investigation, Formal analysis; P.C.—Methodology, Validation, Formal analysis, Writing—original draft; K.W.—Conceptualization, Validation, Formal analysis, Writing—original draft, Writing—review and editing. N.S.—Investigation, Formal analysis; F.H.—Investigation, Formal analysis; M.G.-K., Validation, Investigation; D.P.—Supervisor, Conceptualization, Resources, Validation, Writing—review and editing; J.R.—Supervisor. All authors have read and agreed to the published version of the manuscript.

Funding

The LMU Chair for Fish Diseases and Fisheries Biology did not receive any external funding associated with this work. The Patent Co. provided in-kind material and analytical services.

Institutional Review Board Statement

The animal study protocol was approved by the Ethical Committee for Animal Experiments of the Regierung von Oberbayern, Maximilianstr. 39, 80534 München (ROB–55.2-2532.Vet_02-20-142, date of approval: 6 September 2021).

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. All data generated or analyzed during this study are included in this published article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Parata, L.; Sammut, J.; Egan, S. Opportunities for microbiome research to enhance farmed freshwater fish quality and production. Rev. Aquac. 2021, 13, 2027–2037. [Google Scholar] [CrossRef]
  2. Talwar, C.; Nagar, S.; Lal, R.; Negi, R.K. Fish gut microbiome: Current approaches and future perspectives. Indian J. Microbiol. 2018, 58, 397–414. [Google Scholar] [CrossRef]
  3. Dehler, C.E.; Secombes, C.J.; Martin, S.A. Environmental and physiological factors shape the gut microbiota of Atlantic salmon parr (Salmo salar L.). Aquaculture 2017, 467, 149–157. [Google Scholar] [CrossRef]
  4. Ghanbari, M.; Kneifel, W.; Domig, K.J. A new view of the fish gut microbiome: Advances from next-generation sequencing. Aquaculture 2015, 448, 464–475. [Google Scholar] [CrossRef]
  5. Casadei, E.; Wang, T.; Zou, J.; Vecino, J.L.G.; Wadsworth, S.; Secombes, C.J. Characterization of three novel β-defensin antimicrobial peptides in rainbow trout (Oncorhynchus mykiss). Mol. Immunol. 2009, 46, 3358–3366. [Google Scholar] [CrossRef] [PubMed]
  6. Merrifield, D.L.; Rodiles, A. The fish microbiome and its interactions with mucosal tissues. In Mucosal Health in Aquaculture; Academic Press: New York, NY, USA, 2015; pp. 273–295. [Google Scholar]
  7. Mougin, J.; Joyce, A. Fish disease prevention via microbial dysbiosis-associated biomarkers in aquaculture. Rev. Aquac. 2023, 15, 579–594. [Google Scholar] [CrossRef]
  8. Caruso, G.; Pedà, C.; Cappello, S.; Leonardi, M.; La Ferla, R.; Lo Giudice, A.; Romeo, T. Effects of microplastics on trophic parameters, abundance and metabolic activities of seawater and fish gut bacteria in mesocosm conditions. Environ. Sci. Pollut. Res. 2018, 25, 30067–30083. [Google Scholar] [CrossRef] [PubMed]
  9. Kong, Y.; Liao, Z.; Ma, X.; Liang, M.; Xu, H.; Mai, K.; Zhang, Y. Response of Intestinal Microbiota of Tiger Puffer (Takifugu rubripes) to the Fish Oil Finishing Strategy. Microorganisms 2023, 11, 208. [Google Scholar] [CrossRef]
  10. Miao, S.; Zhu, J.; Zhao, C.; Sun, L.; Dong, X.; Chen, G. Effect of dietary soybean meal associated with feeding time on the growth performance and intestinal microbiota composition of northern snakehead. Aquac. Res. 2019, 50, 2751–2759. [Google Scholar] [CrossRef]
  11. Yu, Y.; Liu, Y.; Tan, Y.; Kumkhong, S.; Gu, Y.; Yu, H.; Yang, Y. Effects of deoxynivalenol-contaminated diet on the composition and diversity of the intestinal microbial community and intestinal ultrastructure of juvenile largemouth bass (Micropterus salmoides). Aquaculture 2021, 538, 736544. [Google Scholar] [CrossRef]
  12. Matejova, I.; Svobodova, Z.; Vakula, J.; Mares, J.; Modra, H. Impact of mycotoxins on aquaculture fish species: A review. J. World Aquac. Soc. 2017, 48, 186–200. [Google Scholar] [CrossRef]
  13. AFSSA. Risk Assessment for Mycotoxins in Human and Animal Food Chains; AFSSA: Oklahoma City, OK, USA, 2006. [Google Scholar]
  14. Gonçalves, R.A.; Naehrer, K.; Santos, G.A. Occurrence of mycotoxins in commercial aquafeeds in Asia and Europe: A real risk to aquaculture? Rev. Aquac. 2018, 10, 263–280. [Google Scholar] [CrossRef]
  15. Anater, A.; Manyes, L.; Meca, G.; Ferrer, E.; Luciano, F.B.; Pimpão, C.T.; Font, G. Mycotoxins and their consequences in aquaculture: A review. Aquaculture 2016, 451, 1–10. [Google Scholar] [CrossRef]
  16. Imran, M.; Cao, S.; Wan, S.F.; Chen, Z.; Saleemi, M.K.; Wang, N.; Munawar, J. Mycotoxins–A global one health concern: A review. Agrobiol. Rec. 2020, 2, 1–16. [Google Scholar] [CrossRef]
  17. Hernando-Amado, S.; Coque, T.M.; Baquero, F.; Martínez, J.L. Defining and combating antibiotic resistance from One Health and Global Health perspectives. Nat. Microbiol. 2019, 4, 1432–1442. [Google Scholar] [CrossRef]
  18. Marijani, E.; Kigadye, E.; Okoth, S. Occurrence of fungi and mycotoxins in fish feeds and their impact on fish health. Int. J. Microbiol. 2019, 2019, 6743065. [Google Scholar] [CrossRef]
  19. Di Gregorio, M.C.; Neeff, D.V.D.; Jager, A.V.; Corassin, C.H.; Carão, Á.C.D.P.; Albuquerque, R.D.; Oliveira, C.A.F. Mineral adsorbents for prevention of mycotoxins in animal feeds. Toxin Rev. 2014, 33, 125–135. [Google Scholar] [CrossRef]
  20. Derome, N.; Gauthier, J.; Boutin, S.; Llewellyn, M. Bacterial opportunistic pathogens of fish. In The Rasputin Effect: When Commensals and Symbionts Become Parasitic; Springer: Cham, Switzerland, 2016; pp. 81–108. [Google Scholar]
  21. Cavalcante, R.B.; Telli, G.S.; Tachibana, L.; de Carla Dias, D.; Oshiro, E.; Natori, M.M.; Ranzani-Paiva, M.J. Probiotics, Prebiotics and Synbiotics for Nile tilapia: Growth performance and protection against Aeromonas hydrophila infection. Aquac. Rep. 2020, 17, 100343. [Google Scholar] [CrossRef]
  22. Shi, X.; Xia, Y.; Wei, W.; Ni, B.J. Accelerated spread of antibiotic resistance genes (ARGs) induced by non-antibiotic conditions: Roles and mechanisms. Water Res. 2022, 224, 119060. [Google Scholar] [CrossRef]
  23. Zhang, X.X.; Zhang, T.; Fang, H.H. Antibiotic resistance genes in water environment. Appl. Microbiol. Biotechnol. 2009, 82, 397–414. [Google Scholar] [CrossRef]
  24. Marković, M.; Daković, A.; Rottinghaus, G.E.; Kragović, M.; Petković, A.; Krajišnik, D.; de Gennaro, B. Adsorption of the mycotoxin zearalenone by clinoptilolite and phillipsite zeolites treated with cetylpyridinium surfactant. Colloids Surf. B Biointerfaces 2017, 151, 324–332. [Google Scholar] [CrossRef] [PubMed]
  25. Raj, J.; Vasiljević, M.; Tassis, P.; Farkaš, H.; Bošnjak-Neumüller, J.; Männer, K. Effects of a modified clinoptilolite zeolite on growth performance, health status and detoxification of aflatoxin B1 and ochratoxin A in male broiler chickens. Br. Poult. Sci. 2021, 62, 601–610. [Google Scholar] [CrossRef] [PubMed]
  26. Mohammadzadeh Kakhki, R.; Zirjanizadeh, S.; Mohammadpoor, M. A review of clinoptilolite, its photocatalytic, chemical activity, structure and properties: In time of artificial intelligence. J. Mater. Sci. 2023, 58, 10555–10575. [Google Scholar] [CrossRef]
  27. Sallam, G.R.; Habib, Y.J.; El Basuini, M.F.; Fayed, W.M.; Shehata, A.I. Synergistic interactions of zeolite, stocking density, and water exchange: A holistic approach to optimizing aquaculture performance of juvenile European seabass (Dicentrarchus labrax). Sci. Afr. 2024, 23, e02043. [Google Scholar] [CrossRef]
  28. Pavlovich-Cristopulos, G.; Schiavo, B.; Romero, F.M.; Hernández-Mendiola, E.; Angulo-Molina, A.; Meza-Figueroa, D. Oral bioaccessibility of metal (oid) s in commercial zeolite used as a dietary supplement: Implications to human health risk. J. Food Compos. Anal. 2023, 115, 104990. [Google Scholar] [CrossRef]
  29. Magdalena Tomasevic-Canovic, S.M. Patent Co Preduzece Za Proizvodnju Usluge I Pro. EU Patent No. EP1363854B1, 22 April 2009. [Google Scholar]
  30. Ergün, S.; Yigit, M.; Türker, A. Growth and Feed Consumption of Young Rainbow Trout (Oncorhynchus Mykiss) Exposed To Different Photoperiods. Isr. J. Aquac. Bamidgeh 2003, 55, 132–138. [Google Scholar] [CrossRef]
  31. Zahran, E.; Risha, E.; Hamed, M.; Ibrahim, T.; Palić, D. Dietary mycotoxicosis prevention with modified zeolite (Clinoptilolite) feed additive in Nile tilapia (Oreochromis niloticus). Aquaculture 2020, 515, 734562. [Google Scholar] [CrossRef]
  32. Kaya, D.; Genc, E.; Palić, D.; Genc, M.A.; Todorović, N.; Sevgili, H.; Guroy, D. Effect of dietary modified zeolite (Clinoptilolite) on growth performance of gilthead sea bream (Sparus aurata) in the recirculating aquaculture system. Aquac. Res. 2022, 53, 1284–1292. [Google Scholar] [CrossRef]
  33. Prasai, T.P.; Walsh, K.B.; Bhattarai, S.P.; Midmore, D.J.; Van, T.T.; Moore, R.J.; Stanley, D. Zeolite food supplementation reduces abundance of enterobacteria. Microbiol. Res. 2017, 195, 24–30. [Google Scholar] [CrossRef]
  34. Amr, E.; Elazab, M.A.; Soltan, Y.A.; Elkomy, A.E.; El-Zaiat, H.M.; Sallam, S.M.; El-Azrak, K.E.D. Nano and natural zeolite feed supplements for dairy goats: Feed intake, ruminal fermentation, blood metabolites, and milk yield and fatty acids profile. Anim. Feed. Sci. Technol. 2023, 295, 115522. [Google Scholar]
  35. Özogul, F.; Šimat, V.; Gokdogan, S.; Regenstein, J.M.; Özogul, Y. Effect of natural zeolite (Clinoptilolite) on in vitro biogenic amine production by gram positive and gram-negative pathogens. Front. Microbiol. 2018, 9, 2585. [Google Scholar] [CrossRef] [PubMed]
  36. Novoslavskij, A.; Terentjeva, M.; Eizenberga, I.; Valciņa, O.; Bartkevičs, V.; Bērziņš, A. Major foodborne pathogens in fish and fish products: A review. Ann. Microbiol. 2016, 66, 1–15. [Google Scholar] [CrossRef]
  37. Sabry, M.; Abd El-Moein, K.; Hamza, E.; Kader, F.A. Occurrence of Clostridium perfringens types A, E, and C in fresh fish and its public health significance. J. Food Prot. 2016, 79, 994–1000. [Google Scholar] [CrossRef] [PubMed]
  38. Song, W.; Li, L.; Huang, H.; Jiang, K.; Zhang, F.; Chen, X.; Zhao, M.; Ma, L. 2016 The gut microbial commu-nity of antarctic fish detected by 16S rRNA gene sequence analysis. BioMed Res. Int. 2016, 1, 3241529. [Google Scholar]
  39. Gruber-Dorninger, C.; Jenkins, T.; Schatzmayr, G. Global mycotoxin occurrence in feed: A ten-year survey. Toxins 2019, 11, 375. [Google Scholar] [CrossRef]
  40. Cholewińska, P.; Szeligowska, N.; Wojnarowski, K.; Nazar, P.; Greguła-Kania, M.; Junkuszew, A.; Bodkowski, R. Selected bacteria in sheep stool depending on breed and physiology state. Sci. Rep. 2023, 13, 11739. [Google Scholar] [CrossRef]
  41. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  42. Dowd, S.E.; Callaway, T.R.; Wolcott, R.D.; Sun, Y.; McKeehan, T.; Hagevoort, R.G.; Edrington, T.S. Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP). BMC Microbiol. 2008, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
  43. De Gregoris, T.B.; Aldred, N.; Clare, A.S.; Burgess, J.G. Improvement of phylum-and class-specific primers for real-time PCR quantification of bacterial taxa. J. Microbiol. Methods 2011, 86, 351–356. [Google Scholar] [CrossRef]
  44. Blackwood, C.B.; Oaks, A.; Buyer, J.S. Phylum-and class-specific PCR primers for general microbial community analysis. Appl. Environ. Microbiol. 2005, 71, 6193–6198. [Google Scholar] [CrossRef]
  45. Mitsumori, M.; Ajisaka, N.; Tajima, K.; Kajikawa, H.; Kurihara, M. Detection of Proteobacteria from the rumen by PCR using methanotroph-specific primers. Lett. Appl. Microbiol. 2002, 35, 251–255. [Google Scholar] [CrossRef] [PubMed]
  46. Amit-Romach, E.; Sklan, D.; Uni, Z. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci. 2004, 83, 1093–1098. [Google Scholar] [CrossRef] [PubMed]
  47. Du, K.; Wang, C.; Liu, P.; Li, Y.; Ma, X. Effects of dietary mycotoxins on gut microbiome. Protein Pept. Lett. 2017, 24, 397–405. [Google Scholar] [CrossRef]
  48. Zhang, P. Influence of foods and nutrition on the gut microbiome and implications for intestinal health. Int. J. Mol. Sci. 2022, 23, 9588. [Google Scholar] [CrossRef] [PubMed]
  49. Gareau, M.G.; Sherman, P.M.; Walker, W.A. Probiotics and the gut microbiota in intestinal health and disease. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 503–514. [Google Scholar] [CrossRef]
  50. Ingerslev, H.C.; von Gersdorff Jørgensen, L.; Strube, M.L.; Larsen, N.; Dalsgaard, I.; Boye, M.; Madsen, L. The development of the gut microbiota in rainbow trout (Oncorhynchus mykiss) is affected by first feeding and diet type. Aquaculture 2014, 424, 24–34. [Google Scholar] [CrossRef]
  51. Baquero, F.; Martínez, J.L.; Cantón, R. Antibiotics and antibiotic resistance in water environments. Curr. Opin. Biotechnol. 2008, 19, 260–265. [Google Scholar] [CrossRef]
  52. Perrone, G.; Ferrara, M.; Medina, A.; Pascale, M.; Magan, N. Toxigenic fungi and mycotoxins in a climate change scenario: Ecology, genomics, distribution, prediction and prevention of the risk. Microorganisms 2020, 8, 1496. [Google Scholar] [CrossRef]
  53. Mateo, E.M.; Tarazona, A.; Aznar, R.; Mateo, F. Exploring the impact of lactic acid bacteria on the biocontrol of toxigenic Fusarium spp. and their main mycotoxins. Int. J. Food Microbiol. 2023, 387, 110054. [Google Scholar] [CrossRef]
  54. Kuang, T.; He, A.; Lin, Y.; Huang, X.; Liu, L.; Zhou, L. Comparative analysis of microbial communities associated with the gill, gut, and habitat of two filter-feeding fish. Aquac. Rep. 2020, 18, 100501. [Google Scholar] [CrossRef]
  55. Mastinu, A.; Kumar, A.; Maccarinelli, G.; Bonini, S.A.; Premoli, M.; Aria, F.; Memo, M. Zeolite clinoptilolite: Therapeutic virtues of an ancient mineral. Molecules 2019, 24, 1517. [Google Scholar] [CrossRef]
  56. Ambrozova, P.; Kynicky, J.; Urubek, T.; Nguyen, V.D. Synthesis and modification of clinoptilolite. Molecules 2017, 22, 1107. [Google Scholar] [CrossRef] [PubMed]
  57. Wu, Q.J.; Wang, L.C.; Zhou, Y.M.; Zhang, J.F.; Wang, T. Effects of clinoptilolite and modified clinoptilolite on the growth performance, intestinal microflora, and gut parameters of broilers. Poult. Sci. 2023, 92, 684–692. [Google Scholar] [CrossRef] [PubMed]
  58. Zhou, P.; Wang, F.; Shen, Y.; Duan, X.; Zhao, S.; Chen, X.; Liang, J. Removal of emerging organic pollutants by zeolite mineral (Clinoptilolite) composite photocatalysts in drinking water and watershed water. Catalysts 2024, 14, 216. [Google Scholar] [CrossRef]
  59. Ghasemi, Z.; Sourinejad, I.; Kazemian, H.; Rohani, S. Application of zeolites in aquaculture industry: A review. Rev. Aquac. 2018, 10, 75–95. [Google Scholar] [CrossRef]
  60. Eroglu, N.; Emekci, M.; Athanassiou, C.G. Applications of natural zeolites on agriculture and food production. J. Sci. Food Agric. 2017, 97, 3487–3499. [Google Scholar] [CrossRef]
  61. Medina-Félix, D.; Garibay-Valdez, E.; Vargas-Albores, F.; Martínez-Porchas, M. Fish disease and intestinal microbiota: A close and indivisible relationship. Rev. Aquac. 2023, 15, 820–839. [Google Scholar] [CrossRef]
  62. Kim, A.; Kim, N.; Roh, H.J.; Chun, W.K.; Ho, D.T.; Lee, Y.; Kim, D.H. Administration of antibiotics can cause dysbiosis in fish gut. Aquaculture 2019, 512, 734330. [Google Scholar] [CrossRef]
  63. Foysal, M.J.; Nguyen, T.T.T.; Sialumano, M.; Phiri, S.; Chaklader, M.R.; Fotedar, R.; Tay, A. Zeolite mediated processing of nitrogenous waste in the rearing environment influences gut and sediment microbial community in freshwater crayfish (Cherax cainii) culture. Chemosphere 2022, 298, 134276. [Google Scholar] [CrossRef]
  64. Feng, Y.; Hu, J.; Chen, Y.; Xu, J.; Yang, B.; Jiang, J. Ecological effects of antibiotics on aquaculture ecosystems based on microbial community in sediments. Ocean. Coast. Manag. 2022, 224, 106173. [Google Scholar] [CrossRef]
  65. Bondad-Reantaso, M.G.; MacKinnon, B.; Karunasagar, I.; Fridman, S.; Alday-Sanz, V.; Brun, E.; Caputo, A. Review of alternatives to antibiotic use in aquaculture. Rev. Aquac. 2023, 15, 1421–1451. [Google Scholar] [CrossRef]
Microbiolres 15 00149 g001
Figure 1. PCA results of analyzed gill samples: C—control group; T—a mixture of a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Figure 1. PCA results of analyzed gill samples: C—control group; T—a mixture of a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Microbiolres 15 00149 g001
Microbiolres 15 00149 g002aMicrobiolres 15 00149 g002b
Figure 2. Differences between selected bacteria in gill samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Figure 2. Differences between selected bacteria in gill samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Microbiolres 15 00149 g002aMicrobiolres 15 00149 g002b
Microbiolres 15 00149 g003
Figure 3. PCA results of analyzed intestines (including feces) samples: C—control group; T—a mixture of a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Figure 3. PCA results of analyzed intestines (including feces) samples: C—control group; T—a mixture of a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Microbiolres 15 00149 g003
Microbiolres 15 00149 g004aMicrobiolres 15 00149 g004b
Figure 4. Differences between selected bacteria in intestines (including feces) samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Figure 4. Differences between selected bacteria in intestines (including feces) samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Microbiolres 15 00149 g004aMicrobiolres 15 00149 g004b
Microbiolres 15 00149 g005aMicrobiolres 15 00149 g005b
Figure 5. Differences between selected bacteria in water samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Figure 5. Differences between selected bacteria in water samples: C—control group (basal diet); T—mycotoxins mixture was added to the basal diet; M—Minazel Plus® and mycotoxin mixture was combined with basal diet; Z—Minazel Plus® was mixed added to the basal diet. p < 0.05—*; p < 0.01—**.
Microbiolres 15 00149 g005aMicrobiolres 15 00149 g005b
Table 1. Results of the feed analysis, representing diets that were utilized in the experiment. Diet 1—Control group ©, Diet 2—MinazelPlus® group (Z), Diet 3—Mycotoxins group (T), Diet 4—MinazelPlus® + Mycotoxins (M).
Table 1. Results of the feed analysis, representing diets that were utilized in the experiment. Diet 1—Control group ©, Diet 2—MinazelPlus® group (Z), Diet 3—Mycotoxins group (T), Diet 4—MinazelPlus® + Mycotoxins (M).
Sample NumberSample NameResults(µg/kg) or ppb Relative to Feed with Moisture Content of 12%
AflatoxinOchratoxin AZearalenoneDeoxynivalenolFumonisinHAT-2T-2
B1B2G1G2B1B2
S22-01-012DIET 1 (C)<0.4<0.4<0.4<0.4<1.6<16<64<40<40<9.6<9.6
S22-01-013DIET 2
(Z)		<0.4<0.4<0.4<0.4<1.6<16<64<40<40<9.6<9.6
S22-01-014DIET 3
(T)		31.67Feb 45<0.4<0.4<1.653.48145405124<9.6<9.6
S22-01-015DIET 4
(M)		35.85Feb 41<0.4<0.4<1.651.39148421137<9.6<9.6
Table 2. Waters parameters from the 14th to the 57th day. C—control group; T—a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Table 2. Waters parameters from the 14th to the 57th day. C—control group; T—a mixture of mycotoxins was added to the basal diet; M—basal diet was mixed with Minazel Plus® 2 g/kg and mycotoxin mixture; Z—basal diet was mixed with Minazel Plus®.
Water ParametersCTMZ
AverageSDAverageSDAverageSDAverageSD
DO (mg/L)8.140.017.740.017.850.507.860.11
Temperature (°C)27.160.5027.160.5027.160.5127.170.50
NO2 (mg/L)0.010.010.020.010.020.010.010.01
NO3 (mg/L)1.000.000.900.300.800.001.000.00
KH (°dH)14.362.3114.201.9914.301.4313.881.96
Table 3. Proportion of qPCR mix.
Table 3. Proportion of qPCR mix.
ComponentVolume Per 10 μL Reaction
SsoAdvanced™ Universal SYBR® Green Supermix5 μL
Forward and reverse primers1 μL (0.8 μM)
DNA template2 μL (0.04–0.015 × 10−4)
Nuclease–free water2 μL
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hussein, W.; Cholewińska, P.; Wojnarowski, K.; Szeligowska, N.; Hu, F.; Greguła-Kania, M.; Rojtinnakorn, J.; Palić, D. Dietary Mycotoxins Effects on Nile Tilapia (Oreochromis niloticus) Microbiomes Can Be Mitigated with Addition of Organically Modified Clinoptilolites. Microbiol. Res. 2024, 15, 2232-2246. https://doi.org/10.3390/microbiolres15040149

AMA Style

Hussein W, Cholewińska P, Wojnarowski K, Szeligowska N, Hu F, Greguła-Kania M, Rojtinnakorn J, Palić D. Dietary Mycotoxins Effects on Nile Tilapia (Oreochromis niloticus) Microbiomes Can Be Mitigated with Addition of Organically Modified Clinoptilolites. Microbiology Research. 2024; 15(4):2232-2246. https://doi.org/10.3390/microbiolres15040149

Chicago/Turabian Style

Hussein, Wanvisa, Paulina Cholewińska, Konrad Wojnarowski, Natalia Szeligowska, Fangyuan Hu, Monika Greguła-Kania, Jiraporn Rojtinnakorn, and Dušan Palić. 2024. "Dietary Mycotoxins Effects on Nile Tilapia (Oreochromis niloticus) Microbiomes Can Be Mitigated with Addition of Organically Modified Clinoptilolites" Microbiology Research 15, no. 4: 2232-2246. https://doi.org/10.3390/microbiolres15040149

APA Style

Hussein, W., Cholewińska, P., Wojnarowski, K., Szeligowska, N., Hu, F., Greguła-Kania, M., Rojtinnakorn, J., & Palić, D. (2024). Dietary Mycotoxins Effects on Nile Tilapia (Oreochromis niloticus) Microbiomes Can Be Mitigated with Addition of Organically Modified Clinoptilolites. Microbiology Research, 15(4), 2232-2246. https://doi.org/10.3390/microbiolres15040149

Article Metrics

Back to TopTop