Next Article in Journal
Body Composition and Dietary Intake of Women Attending an Infertility Clinic—Polish Observational Study
Next Article in Special Issue
Polyphenol Intervention Ameliorates Non-Alcoholic Fatty Liver Disease: An Updated Comprehensive Systematic Review
Previous Article in Journal
Omega-3 Fatty Acids and Muscle Strength—Current State of Knowledge and Future Perspectives
Previous Article in Special Issue
Nutritional Strategies for Chronic Craniofacial Pain and Temporomandibular Disorders: Current Clinical and Preclinical Insights
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 16
Issue 23
10.3390/nu16234076
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resveratrol Butyrate Esters Reduce Hypertension in a Juvenile Rat Model of Chronic Kidney Disease Exacerbated by Microplastics

by
Yi-Ning Huang
1,
Chien-Ning Hsu
2,3,
Chih-Yao Hou
4,
Shin-Yu Chen
5,* and
You-Lin Tain
1,6,7,*
1
Department of Pediatrics, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
2
Department of Pharmacy, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
3
School of Pharmacy, Kaohsiung Medical University, Kaohsiung 807, Taiwan
4
Department of Seafood Science, National Kaohsiung University of Science and Technology, Kaohsiung 811, Taiwan
5
Department of Food Science, National Pingtung University of Science and Technology, Pingtung 912, Taiwan
6
College of Medicine, Chang Gung University, Taoyuan 330, Taiwan
7
Institute for Translational Research in Biomedicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833, Taiwan
*
Authors to whom correspondence should be addressed.
Nutrients 2024, 16(23), 4076; https://doi.org/10.3390/nu16234076
Submission received: 3 November 2024 / Revised: 21 November 2024 / Accepted: 26 November 2024 / Published: 27 November 2024
(This article belongs to the Special Issue Nutraceuticals, Bioactive Compounds and Functional Foods: Their Role in Chronic Diseases)
Browse Figures
Versions Notes

Abstract

:
Background: Resveratrol is recognized as a promising nutraceutical with antihypertensive and prebiotic properties; however, its bioavailability in vivo is limited. To enhance its bioactivity, we developed resveratrol butyrate esters (RBEs). This study investigates whether RBEs can mitigate hypertension induced by chronic kidney disease (CKD) and exacerbated by microplastics (MPs) exposure in juvenile rats. Methods: Three-week-old male Sprague Dawley rats were fed either regular chow or 0.5% adenine chow for three weeks. The adenine-fed CKD rats (N = 8 per group) received either 5 μM MPs (10 mg/L) or MPs combined with RBE (25 mg/L) in their drinking water from weeks 3 to 9. Results: Our results indicate that MP exposure worsened CKD-induced hypertension, while RBE treatment resulted in a reduction in systolic BP by 15 mmHg (155 ± 2 mmHg vs. 140 ± 1 mmHg, p < 0.05). The combined exposure to adenine and MPs was associated with nitric oxide (NO) deficiency, which RBE treatment alleviated. Additionally, our findings revealed that RBE modulated both the classical and nonclassical renin–angiotensin system (RAS), contributing to its protective effects. We also observed changes in gut microbiota composition, increased butyric acid levels, and elevated renal GPR41 expression associated with RBE treatment. Conclusions: In conclusion, in this juvenile rat model of combined CKD and MP exposure, RBE demonstrates antihypertensive effects by modulating NO levels, the RAS, gut microbiota, and their metabolites.

1. Introduction

Phenolic compounds are abundantly found in plants and exhibit a variety of biological effects, including antioxidant, anti-inflammatory, anti-atherosclerotic, and anti-aging properties [1,2]. Resveratrol, a natural stilbene phenolic compound, is commonly utilized as a nutraceutical for the prevention of cardiovascular disease (CVD), type 2 diabetes mellitus, chronic kidney disease (CKD), and various other health conditions [3,4,5]. Recent research underscores the importance of understanding resveratrol’s bioefficacy and bioavailability to elucidate its role in human health [6]. Like many phenolic compounds, resveratrol has low bioavailability [7], which can be influenced by several factors [8]. For example, interactions between resveratrol and gut microbiota may affect its biological effects [9]. Notably, the limited in vivo bioactivity of resveratrol poses a significant challenge for its clinical applications. Recent evidence suggests that the esterification of resveratrol could enhance its bioactivity [10,11].
Previously, we developed esterified resveratrol-producing short-chain fatty acid (SCFA) products through Steglich reactions to enhance the bioactivity of resveratrol [12]. These resveratrol–SCFA esters exhibited antioxidant properties, with resveratrol butyrate esters (RBEs) demonstrating biological activity comparable to that of resveratrol but with improved bioavailability [13]. SCFAs, essential microbial metabolites, function as postbiotics and have been shown to positively influence human health [14,15].
In children, hypertension is often secondary to CKD, unlike in adults, where it is typically due to primary causes [16]. Despite treatment with antihypertensive medications, many children with CKD remain uncontrolled and may progress to end-stage kidney disease. Furthermore, CKD-related morbidity can be worsened by environmental pollutants, such as microplastics (MPs) [17]. Although research on the impact of MPs on kidney function is still in its early stages, there is growing concern that CKD patients may be especially vulnerable to the accumulation and damaging effects of these pollutants [18].
Resveratrol has demonstrated antihypertensive and renoprotective effects in several animal models [19], including those involving prenatal hypoxia combined with high-fat intake [20], spontaneously hypertensive rats [21], and a renovascular hypertensive two-kidney one-clip model [22]. However, these benefits have not consistently translated into positive outcomes in human populations. A meta-analysis of 10 randomized controlled trials found no significant effect of resveratrol supplementation on cardiovascular risk factors [23]. Another meta-analysis, which included 32 studies, suggested a mild renal protective effect of resveratrol in adults, though it was based on low-certainty evidence [24].
In our previous study using an adenine-induced juvenile rat model of CKD, we found that RBE supplementation improved kidney function and reduced hypertension by modulating the gut microbiota [25]. The beneficial effects of RBE on blood pressure (BP) are thought to stem from its ability to regulate key factors such as vasodilators, including nitric oxide (NO), and vasoconstrictors within the renin–angiotensin system (RAS). Building on this, the goal of our current study is to investigate whether exposure to MPs exacerbates hypertension in juvenile rats with adenine-induced CKD. Additionally, we aim to determine whether RBE treatment can mitigate these effects by influencing the gut microbiota, the NO signaling pathway, and the RAS.

2. Materials and Methods

2.1. Synthesis of Resveratrol Butyrate Esters

The RBEs were synthesized following our established protocol [11]. Initially, butyric acid (ACROS, Morris Plains, NJ, USA) was combined with resveratrol (TCI Development Co., Ltd., Shanghai, China) in tetrahydrofuran (Echo Chemical Co., Ltd., Miaoli County, Taiwan). Subsequently, 4-dimethylaminopyridine (Sigma-Aldrich, Saint Louis, MO, USA) and N-ethyl-N-(3-dimethylaminopropyl) carbodiimide (Sigma-Aldrich) were added to the mixture. The esterification reaction was conducted in the absence of light for 48 h. After the reaction was complete, the mixture was diluted with distilled water and filtered to isolate the precipitated RBEs. The final RBEs were then stored in a freezer at −20 °C for preservation.

2.2. Animals

The experimental protocol received approval from the Institutional Animal Ethics Committee (permit number: 2024022301, approval date: 27 March 2024). Sprague Dawley rats were allowed to acclimate in a temperature-controlled room (22 ± 1 °C), with 55 ± 5% humidity and a 12:12 light–dark cycle, in an AAALAC-International accredited animal facility. Pregnant rats were provided with unrestricted access to food and water until delivery, and the offspring were raised alongside their dams during the lactation period.
After weaning, two rats were housed per cage. Male rats aged three weeks were divided into two dietary groups: one group received regular chow, while the other received chow containing 0.5% adenine for three weeks to induce CKD. Only male juvenile rats were used due to their heightened susceptibility to developing hypertension at an earlier age compared to females [26]. The adenine dosage was selected based on our previously established pediatric CKD model [25]. Some of the rats were given MPs in their drinking water from week three to nine. The polystyrene MPs were procured from Magsphere (Pasadena, CA, USA), and the dosages of MPs and resveratrol were determined based on prior studies involving rats [27].
Figure 1 demonstrates the experimental protocol. The male rats were randomly assigned to five groups (n = 8 per group): a control group (CN), a CKD group receiving adenine chow (CK), an MP group receiving 5 μM microparticles (MPs) (10 mg/L), a CKD + MP group (CKMP) receiving both adenine and MPs, and a CKD + MP + RBE group (CKMPRBE) receiving adenine, MPs, and RBE at a dose of 25 mg/L in drinking water from weeks three to nine, as detailed in our previous work [25].
Non-invasive BP measurements were conducted on conscious, trained rats using the tail-cuff method (CODA, Kent Scientific Corp., Torrington, CT, USA). The rats were acclimatized to the restraint holders for one week prior to the recording sessions. Three consistent BP measurements were taken, and the average value was calculated. All rats were euthanized at nine weeks of age. Fecal samples were collected in the morning, before sacrifice, by gently lifting the tail and twisting it toward the back to induce defecation. The fecal samples were then stored at −80 °C until further extraction. The rats were anesthetized by an intraperitoneal injection of ketamine (50 mg/kg) and xylazine (10 mg/kg) and euthanized with an intraperitoneal injection of a pentobarbital (150 mg/kg) overdose. Both kidneys were excised and weighed, and plasma samples were collected, aliquoted, and stored at −80 °C.

2.3. Gut Microbiota Metagenomics

Microbial DNA was extracted from stool samples, and metagenomic analysis was performed using 16S ribosomal RNA genes [25]. The barcode primers designed for SMRTbell library preparation (Menlo Park, CA, USA) were employed to amplify the full-length 16S rRNA gene from the genomic DNA. We conducted downstream analyses of the sequences using the QIIME2 software package [28]. From the amplicon sequence variants (ASVs), we constructed a phylogenetic tree with FastTree version 2.1.10, and each cluster was taxonomically assigned. For α-diversity analysis, we assessed observed features and calculated the Shannon index. β-diversity was evaluated using the analysis of similarities (ANOSIM) in conjunction with Partial Least Squares Discriminant Analysis (PLSDA). We also utilized the linear discriminant analysis (LDA) effect size to identify bacterial taxa with significantly different abundances between the groups [29]. To assess statistical differences between the groups, we conducted a two-sided Welch’s t-test using the Statistical Analysis of Metagenomic Profiles (STAMP).

2.4. Determination of Plasma SCFAs

We assessed SCFA concentrations in plasma using a Gas Chromatograph–Mass Spectrometer (Agilent Technologies, Santa Clara, CA, USA), following previously established methods [25]. The SCFAs analyzed included acetic acid, propionic acid, butyric acid, isobutyric acid, isovaleric acid, and valeric acid. Chromatographic separation was achieved using a DB-FFAP column (30 cm × 0.25 mm, 0.25 µm; Agilent Technologies), with 2-ethylbutyric acid serving as the internal standard. A 1 µL injection volume was applied with a split ratio of 5:1 at an injection temperature of 240 °C.

2.5. Quantitative PCR

Total RNA was extracted from kidney cortex samples, followed by real-time quantitative PCR (qPCR), as previously described in our methods [25]. We analyzed the expression of SCFA receptors [30] and components of the RAS [31]. All samples were analyzed in duplicate, with 18S ribosomal RNA (18S rRNA) serving as the reference gene for normalizing the qPCR data. The comparative threshold cycle (Ct) method was employed for the relative quantification of gene expression. The primer sequences are listed in Table 1.

2.6. Measurement of NO-Related Parameters

Plasma levels of L-arginine and asymmetric dimethylarginine (ADMA), an inhibitor of nitric oxide synthase, were measured using high-performance liquid chromatography (HP Series 1100, Agilent Technologies, Inc., Santa Clara, CA, USA) with o-phthalaldehyde and 3-mercaptopropionic acid as the derivatization reagents [25]. L-homoarginine (Fluka, Neu Ulm, Germany) was used as the internal standard.

2.7. Statistical Analysis

Data are presented as the mean ± standard error of the mean (SEM). The data were analyzed using a one-way analysis of variance (ANOVA) followed by multiple comparisons with Tukey’s post hoc test. A p-value of less than 0.05 was considered statistically significant for all tests. The analysis was conducted using SPSS version 17.0 software.

3. Results

3.1. Anthropometrics and Blood Pressure

No mortality was observed among the five groups at nine weeks of age. The CKMPRBE group exhibited the lowest body weight (BW) (Figure 2A). The kidney weight (KW)-to-BW ratio was higher in the CK group compared to the CN and MP groups (Figure 2B). After seven weeks, adenine-exposed and MP-exposed juvenile rats demonstrated elevated systolic BP compared to the CN group (CK group: 134 ± 1 mmHg, MP group: 131 ± 1 mmHg, vs. CN group: 120 ± 1 mmHg, both p < 0.05), with a synergistic effect observed from their combined exposures (CKMP group: 145 ± 1 mmHg, p < 0.05) (Figure 2C). Importantly, the increase in systolic BP in the CKMP group was mitigated by RBE treatment (CKMPRBE group: 133 ± 1 mmHg, p < 0.05). At week 9, MP exposure exacerbated CKD-induced hypertension (CKMP group vs. CK group: 155 ± 2 mmHg vs. 140 ± 1 mmHg, p < 0.05), while RBE treatment reduced systolic BP by 15 mmHg (CKMPRBE group: 140 ± 1 mmHg, p < 0.05). Diastolic BP (Figure 2D) and mean arterial pressure (Figure 2E) showed similar trends as systolic BP.

3.2. Plasma SCFAs and SCFA Receptors

Adenine and MP exposure differentially affected plasma concentrations of SCFAs. Adenine exposure resulted in lower plasma levels of isobutyric acid (p = 0.042) and valeric acid (p = 0.02) in the CK group, while MP exposure led to reduced propionic acid levels in the MP group (p = 0.004) compared to the CN group (Table 2). Notably, combined adenine and MP exposures did not impact plasma SCFA concentrations. In contrast, RBE significantly increased butyric acid levels in the CKMPRBE group compared to the CKMP group (p = 0.002). Plasma concentrations of isovaleric acid were consistent across all five groups, showing no significant differences.
SCFAs can influence BP by interacting with SCFA receptors [30]. We analyzed the expression of four SCFA receptors, containing olfactory receptor 78 (OlfR78), G protein-coupled receptors 41 (GPR41), GPR43, and GPR109A. Figure 3 shows that renal Olfr78 expression was significantly higher in the CK and MP groups compared to the CN group. Additionally, combined adenine and MP exposures resulted in the lowest GPR41 expression in the CKMP group, but this reduction was restored with RBE treatment. No significant differences were observed in GPR43 and GPR109A expression between the CN and CK groups; however, both were induced by MP exposure.

3.3. Gut Microbiota Composition

Both α-diversity metrics—the Faith’s PD index and the Shannon index—assessing microbiome richness and evenness showed no significant differences among the five groups (Figure 4A,B). Additionally, β-diversity was visualized through a PLSDA plot, which revealed five distinct clusters (Figure 4C). ANOSIM analysis confirmed significant differences among nearly all the groups (all p < 0.05), except for the comparison between the CN and MP groups, which did not reach statistical significance.
The LEfSe analysis revealed significant differences in taxa abundance between the CKMP and CKMPRBE groups, as illustrated in Figure 5. Notably, Turicibacter sanguinis, along with its associated genus and family, was more abundant in the CKMP group (LDA > 3). Additionally, the genera Ruminococcus, Murimonas, and Robinsoniella were also enriched in the CKMP group. In contrast, the CKMPRBE group exhibited an increase in Ligilactobacillus murinus, along with its corresponding genus, order, and class, compared to the CKMP group.
To identify the differentially altered taxa at the genus level due to RBE treatment, we applied the two-sided Welch’s t-test in STAMP to establish statistical differences. Compared to the CKMP group, RBE treatment resulted in significant changes in microbial genera, including notable increases in Ruminococcus, Murimonas, Robinsoniella, Phocea, Ihubacter, Breznakia, and Flavonifractor, as well as decreases in Odoribacter, Emergencia, and Massilioclostridium (Figure 6).

3.4. NO and RAS

We next assessed NO and RAS as they play crucial roles in regulating BP. NO is a potent vasodilator, with L-arginine serving as the substrate for NO synthase to produce NO, while ADMA inhibits NO production. Our results showed that plasma concentrations of L-arginine were similar across all five groups (Figure 7A). Exposure to either adenine or MP resulted in increased plasma concentrations of ADMA (Figure 7B), but there was no synergistic effect between the two. The ratio of L-arginine to ADMA, which reflects NO bioavailability [32], was diminished by adenine, MP, or their combined exposures; however, this reduction was partially reversal by the RBE treatment (Figure 7C).
The RAS primarily raises BP through the action of angiotensin II (Ang II) as a potent vasoconstrictor. The binding of renin to the (pro)renin receptor (PRR) activates Ang-II-dependent and independent pathways to raise BP [31]. The classical RAS is characterized by the angiotensin-converting enzyme 1 (ACE1)-Angiotensin II type 1 receptor (AT1R) axis, which promotes vasoconstriction. In contrast, the nonclassical RAS, consisting of the ACE2-Ang-(1-7)-MAS axis and the Ang II/Ang III-AT2R pathway, counteracts the effects of the aberrant activation of the classical axis. We used qPCR to quantify changes in key RAS-related genes in rat kidneys. Figure 8 illustrates that exposure to adenine and MP tends to increase the expression of genes in the classical RAS axis, including renin and AT1R, while these increases were normalized by RBE treatment (Figure 8A). Compared to the CKMP group, RBE also reduced other components of the classical axis, such as PRR, AGT, and ACE1. Conversely, resveratrol treatment resulted in an increase in ACE2, MAS, and AT2R within the nonclassical RAS axis, which was inhibited by the combined exposure to adenine and MP (Figure 8B).

4. Discussion

In this study, we found that MP exposure exacerbated CKD-induced hypertension in young rats at nine weeks of age. Notably, we report for the first time that RBE can protect juvenile rats with CKD from hypertension exacerbated by MP exposure, resulting in a reduction in systolic BP by approximately 15 mmHg. Although the antihypertensive effect did not fully normalize BP, the 15 mm Hg reduction in systolic BP is considered clinically significant.
The key findings from our data are as follows: (1) juvenile rats exhibited heightened susceptibility to the detrimental effects of MPs, which exacerbated hypertension; (2) RBE treatments alleviated hypertension induced by the combined exposure to adenine and MP; (3) the beneficial effects of RBE were associated with increased levels of butyric acid and the elevated expression of renal GPR41; (4) combined adenine/MP-induced hypertension was linked to NO deficiency, which improved with RBE treatment; (5) RBE’s protective effect against hypertension in juvenile rats was correlated with a reduction in the renal expression of renin and AT1R in the classical RAS axis, along with an increase in ACE2, MAS, and AT2R in the nonclassical RAS axis; (6) combined exposure to adenine and MPs, as well as RBE treatment, differentially influenced distinct gut microbiota profiles; and (7) the protective effect of RBE was accompanied by alterations in several bacterial populations, including an increase in Ligilactobacillus murinus and a decrease in Turicibacter sanguinis.
In accordance with previous research on the antihypertensive effects of resveratrol [33,34], the treatment of young rats with RBE, a derivative of resveratrol, resulted in an approximate 15 mmHg reduction in SBP, effectively mitigating hypertension. The antihypertensive effects of RBE in the context of pediatric CKD align with our earlier report [25]. We expanded our investigation to explore its protective role in a juvenile rat model subjected to both adenine and MP exposure. Our study demonstrates that RBE protects young rats with CKD from hypertension exacerbated by MP exposure.
One beneficial effect of RBE on hypertension may be associated with improved NO bioavailability. Previous studies have indicated that NO deficiency is implicated in CKD and hypertension [35,36]. Conversely, the antihypertensive effects of resveratrol have been attributed to its ability to enhance NO levels [33]. The data support this notion, showing that RBE’s protective effect against hypertension aligns with an increased L-arginine to ADMA ratio, indicating enhanced NO bioavailability in the plasma.
Another protective effect of RBE is its regulation of the RAS. In aging mice, resveratrol has been shown to protect against arterial fibrosis by inhibiting the classical axis and stimulating the nonclassical axis [37]. In our young rat model of CKD-induced hypertension, RBE treatment decreased renin and AT1R levels in the classical RAS axis while increasing ACE2, MAS, and AT2R levels in the nonclassical axis. These findings suggest that RBE helps restore balance between the two RAS axes, promoting vasodilation and lowering BP.
Butyric acid is a crucial component of RBE and serves as a ligand for the SCFA receptors GPR41, GPR43, and GPR109A. It can influence BP by stimulating these receptors; GPR43 tends to elevate BP, while GPR41 and GPR109A can induce vasodilation. In our study, RBE treatment was found to increase plasma concentrations of butyric acid and the renal expression of GPR41 in the CKMPRBE group. These findings suggest that hypertension resulting from adenine and MP exposure may be mitigated by RBE’s modulation of SCFA receptors, shifting the balance from vasoconstriction toward vasodilation.
The protective mechanisms through which RBE treatment alleviates hypertension complicated by adenine and MP exposure are also associated with alterations in gut microbiota. Previous research indicates that the beneficial effects of resveratrol are closely linked to its prebiotic properties [38]. Although RBE treatment resulted in a distinct microbiome composition compared to the other groups, there was no significant difference in α-diversity among the five groups.
So far, data on the impact of MPs on the gut microbiota remain scarce [39]. A recent study revealed that MP exposure induces size-dependent multi-organ damage, including kidney injury in mice, accompanied by gut microbiota dysbiosis [40]. Although the gut-kidney axis plays a key role in CKD-induced hypertension [41], it remains unclear whether MPs contribute to CKD-induced hypertension through gut microbiota dysbiosis. Our findings indicate that MP exposure exacerbates CKD-induced hypertension, which is associated with an increase in Turicibacter sanguinis and its related genus and family. This aligns with previous research demonstrating that MPs can affect soil microbial communities, leading to an increase in the abundance of the genus Turicibacter [42]. Turicibacter sanguinis is the most predominant and well-studied species within the genus Turicibacter. This species has been identified in animal models with irritable bowel syndrome [43]. However, its potential role in the pathogenesis of hypertension has not yet been thoroughly investigated. We found that the species Ligilactobacillus murinus, along with its associated genus, order, and class, were enriched in the CKMPRBE group, correlating with the antihypertensive effects of RBE. This finding is consistent with previous research indicating that Ligilactobacillus murinus can have lower BP in spontaneously hypertensive rats [44].
In addition, STAMP analysis identified several bacterial taxa associated with hypertension, specifically the hypertension-depleted taxa Ruminococcus, Robinsoniella, and Flavonifractor [45]. Our findings indicated that the BP-lowering effect of RBE is correlated with an increase in the abundance of these taxa. Furthermore, RBE was found to decrease the proportion of the genus Emergencia, which is known to convert carnitine into trimethylamine N-oxide (TMAO) [46]. TMAO has been linked to the exacerbation of hypertension and kidney disease [47]. Further investigation is needed to determine if RBE’s protective effects against hypertension are linked to these specific microbial changes.
Our study has several limitations. First, using a single dose of RBE may not fully capture its effectiveness, and thus, further research with multiple dosing regimens is needed. Although we previously found that low-dose RBE (25 mg/L) and resveratrol (50 mg/L) similarly protected adenine-fed rats against hypertension and kidney damage [25], it remains unclear whether these protective effects are dose-dependent or may arise in a dose-independent manner, which warrants further investigation. Second, our focus on juvenile male rats highlights the need to explore potential sex differences in response to MPs and RBE. We concentrated RBE treatment on the CKMP group based on previous findings, but more research is required to assess RBE’s impact on BP in MP-exposed young rats. Lastly, RBE’s antihypertensive effects may involve other organs that regulate BP, necessitating further studies.

5. Conclusions

In conclusion, this study offers the first evidence that RBE may serve as a potential therapy targeting NO, the RAS, and gut microbiota to protect against hypertension induced by combined exposure to adenine and MP. Our findings provide novel mechanistic insights into the role of RBE in modulating these pathways and offer promising prospects for its application in managing hypertension. While our findings reveal novel mechanistic insights related to RBE, further investigation and clinical translation are essential to fully understand its therapeutic potential.

Author Contributions

Y.-N.H. contributed to drafting of the manuscript, concept generation, data collection, methodology, and approval of the article; C.-N.H. contributed to data analysis, concept generation, and methodology; C.-Y.H. contributed to methodology and data interpretation; S.-Y.C. contributed to drafting of the manuscript, data interpretation, critical revision of the manuscript, and approval of the article; Y.-L.T. contributed to data interpretation, funding application, concept generation, methodology, drafting of the manuscript, and approval of the article. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grant CORPG8P0011 from Kaohsiung Chang Gung Memorial Hospital, Taiwan.

Institutional Review Board Statement

All animal studies were approved by the Institutional Animal Ethics Committee of Kaohsiung Chang Gung Memorial Hospital, Taiwan (permit number: 2024022301, approval date: 27 March 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We would like to express thanks for the support received from the Center for Laboratory Animals, Kaohsiung Chang Gung Memorial Hospital, Taiwan.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Quideau, S.; Deffieux, D.; Douat-Casassus, C.; Pouységu, L. Plant polyphenols: Chemical properties, biological activities, and synthesis. Angew. Chem. Int. Ed. Engl. 2011, 50, 586–621. [Google Scholar] [CrossRef] [PubMed]
  2. Del Bo’, C.; Bernardi, S.; Marino, M.; Porrini, M.; Tucci, M.; Guglielmetti, S.; Cherubini, A.; Carrieri, B.; Kirkup, B.; Kroon, P.; et al. Systematic Review on Polyphenol Intake and Health Outcomes: Is there Sufficient Evidence to Define a Health-Promoting Polyphenol-Rich Dietary Pattern? Nutrients 2019, 11, 1355. [Google Scholar] [CrossRef] [PubMed]
  3. Petrovski, G.; Gurusamy, N.; Das, D.K. Resveratrol in cardiovascular health and disease. Ann. N. Y. Acad. Sci. 2011, 1215, 22–33. [Google Scholar] [CrossRef] [PubMed]
  4. Saldanha, J.F.; Leal Vde, O.; Stenvinkel, P.; Carraro-Eduardo, J.C.; Mafra, D. Resveratrol: Why is it a promising therapy for chronic kidney disease patients? Oxidative Med. Cell. Longev. 2013, 2013, 963217. [Google Scholar] [CrossRef]
  5. Tain, Y.L.; Hsu, C.N. Developmental Programming of the Metabolic Syndrome: Can We Reprogram with Resveratrol? Int. J. Mol. Sci. 2018, 19, 2584. [Google Scholar] [CrossRef]
  6. Walle, T.; Hsieh, F.; DeLegge, M.H.; Oatis, J.E., Jr.; Walle, U.K. High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab. Dispos. 2004, 32, 1377–1382. [Google Scholar] [CrossRef]
  7. Manach, C.; Williamson, G.; Morand, C.; Scalbert, A.; Rémésy, C. Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am. J. Clin. Nutr. 2005, 81, 230S–242S. [Google Scholar] [CrossRef]
  8. Bohn, T. Dietary factors affecting polyphenol bioavailability. Nutr. Rev. 2014, 72, 429–452. [Google Scholar] [CrossRef]
  9. Bird, J.K.; Raederstorff, D.; Weber, P.; Steinert, R.E. Cardiovascular and Antiobesity Effects of Resveratrol Mediated through the Gut Microbiota. Adv. Nutr. 2017, 8, 839–849. [Google Scholar] [CrossRef]
  10. Oh, W.Y.; Shahidi, F. Antioxidant activity of resveratrol ester derivatives in food and biological model systems. Food Chem. 2018, 261, 267–273. [Google Scholar] [CrossRef]
  11. Tain, Y.-L.; Jheng, L.-C.; Chang, S.K.C.; Chen, Y.-W.; Huang, L.-T.; Liao, J.-X.; Hou, C.-Y. Synthesis and Characterization of Novel Resveratrol Butyrate Esters That Have the Ability to Prevent Fat Accumulation in a Liver Cell Culture Model. Molecules 2020, 25, 4199. [Google Scholar] [CrossRef] [PubMed]
  12. Tain, Y.L.; Chang, S.K.C.; Liao, J.X.; Chen, Y.W.; Huang, H.T.; Li, Y.L.; Hou, C.Y. Synthesis of Short-Chain-Fatty-Acid Resveratrol Esters and Their Antioxidant Properties. Antioxidants 2021, 10, 420. [Google Scholar] [CrossRef] [PubMed]
  13. Shih, M.K.; Tain, Y.L.; Chen, Y.W.; Hsu, W.H.; Yeh, Y.T.; Chang, S.K.C.; Liao, J.X.; Hou, C.Y. Resveratrol butyrate esters inhibit obesity caused by perinatal exposure to bisphenol a in female offspring rats. Molecules 2021, 26, 4010. [Google Scholar] [CrossRef] [PubMed]
  14. Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef]
  15. Thorakkattu, P.; Khanashyam, A.C.; Shah, K.; Babu, K.S.; Mundanat, A.S.; Deliephan, A.; Deokar, G.S.; Santivarangkna, C.; Nirmal, N.P. Postbiotics: Current Trends in Food and Pharmaceutical Industry. Foods 2022, 11, 3094. [Google Scholar] [CrossRef]
  16. Robinson, C.H.; Chanchlani, R. High Blood Pressure in Children and Adolescents: Current Perspectives and Strategies to Improve Future Kidney and Cardiovascular Health. Kidney Int. Rep. 2022, 7, 954–970. [Google Scholar] [CrossRef]
  17. Kshirsagar, A.V.; Zeitler, E.M.; Weaver, A.; Franceschini, N.; Engel, L.S. Environmental Exposures and Kidney Disease. Kidney360 2022, 3, 2174–2182. [Google Scholar] [CrossRef]
  18. de Oliveira, R.B.; Pelepenko, L.E.; Masaro, D.A.; Lustosa, G.M.M.M.; de Oliveira, M.C.; Roza, N.A.V.; Marciano, M.A.; Dos Reis, L.M.; Kamel, S.; Louvet, L.; et al. Effects of microplastics on the kidneys: A narrative review. Kidney Int. 2024, 106, 400–407. [Google Scholar] [CrossRef]
  19. Hsu, C.N.; Hou, C.Y.; Tain, Y.L. Preventive Aspects of Early Resveratrol Supplementation in Cardiovascular and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2021, 22, 4210. [Google Scholar] [CrossRef]
  20. Rueda-Clausen, C.F.; Morton, J.S.; Dolinsky, V.W.; Dyck, J.R.; Davidge, S.T. Synergistic effects of prenatal hypoxia and postnatal high-fat diet in the development of cardiovascular pathology in young rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 303, R418–R426. [Google Scholar] [CrossRef]
  21. Care, A.S.; Sung, M.M.; Panahi, S.; Gragasin, F.S.; Dyck, J.R.; Davidge, S.T.; Bourque, S.L. Perinatal Resveratrol Supplementation to Spontaneously Hypertensive Rat Dams Mitigates the Development of Hypertension in Adult Offspring. Hypertension 2016, 67, 1038–1044. [Google Scholar] [CrossRef] [PubMed]
  22. Natalin, H.M.; Garcia, A.F.; Ramalho, L.N.; Restini, C.B. Resveratrol improves vasoprotective effects of captopril on aortic remodeling and fibrosis triggered by renovascular hypertension. Cardiovasc. Pathol. 2016, 25, 116–119. [Google Scholar] [CrossRef] [PubMed]
  23. Sahebkar, A.; Serban, C.; Ursoniu, S.; Wong, N.D.; Muntner, P.; Graham, I.M.; Mikhailidis, D.P.; Rizzo, M.; Rysz, J.; Sperling, L.S.; et al. Lack of efficacy of resveratrol on C-reactive protein and selected cardiovascular risk factors--Results from a systematic review and meta-analysis of randomized controlled trials. Int. J. Cardiol. 2015, 189, 47–55. [Google Scholar] [CrossRef]
  24. Abdollahi, S.; Vajdi, M.; Meshkini, F.; Vasmehjani, A.A.; Sangsefidi, Z.S.; Clark, C.C.T.; Soltani, S. Resveratrol may mildly improve renal function in the general adult population: A systematic review and meta-analysis of randomized controlled clinical trials. Nutr. Res. 2023, 113, 1–13. [Google Scholar] [CrossRef]
  25. Hsu, C.N.; Hou, C.Y.; Chang, C.I.; Tain, Y.L. Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut-Kidney Axis. Antioxidants 2021, 11, 83. [Google Scholar] [CrossRef]
  26. Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef]
  27. Zou, H.; Chen, Y.; Qu, H.; Sun, J.; Wang, T.; Ma, Y.; Yuan, Y.; Bian, J.; Liu, Z. Microplastics Exacerbate Cadmium-Induced Kidney Injury by Enhancing Oxidative Stress, Autophagy, Apoptosis, and Fibrosis. Int. J. Mol. Sci. 2022, 23, 14411. [Google Scholar] [CrossRef]
  28. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
  29. Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
  30. Pluznick, J.L. Microbial short-chain fatty acids and blood pressure regulation. Curr. Hypertens. Rep. 2017, 19, 25. [Google Scholar] [CrossRef]
  31. Te Riet, L.; van Esch, J.H.; Roks, A.J.; van den Meiracker, A.H.; Danser, A.H. Hypertension: Renin-Angiotensin-aldosterone system alterations. Circ. Res. 2015, 116, 960–975. [Google Scholar] [CrossRef] [PubMed]
  32. Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef] [PubMed]
  33. DiNatale, J.C.; Crowe-White, K.M. Effects of resveratrol supplementation on nitric oxide-mediated vascular outcomes in hypertension: A systematic review. Nitric Oxide 2022, 129, 74–81. [Google Scholar] [CrossRef] [PubMed]
  34. Mashhadi, F.D.; Salari, R.; Ghorbanzadeh, H. The Effect of Resveratrol dose and Duration of Treatment on Blood Pressure in Patients with Cardiovascular Disorders: A Systematic Review. Curr. Drug Discov. Technol. 2020, 17, 325–331. [Google Scholar] [CrossRef]
  35. Baylis, C. Nitric oxide synthase derangements and hypertension in kidney disease. Curr. Opin. Nephrol. Hypertens. 2012, 21, 1–6. [Google Scholar] [CrossRef]
  36. Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 89, R913–R915. [Google Scholar] [CrossRef]
  37. Kim, E.N.; Kim, M.Y.; Lim, J.H.; Kim, Y.; Shin, S.J.; Park, C.W.; Kim, Y.S.; Chang, Y.S.; Yoon, H.E.; Choi, B.S. The protective effect of resveratrol on vascular aging by modulation of the renin-angiotensin system. Atherosclerosis 2018, 270, 123–131. [Google Scholar] [CrossRef]
  38. Hou, C.Y.; Chen, Y.W.; Hazeena, S.H.; Tain, Y.L.; Hsieh, C.W.; Chen, D.Q.; Liu, R.Y.; Shih, M.K. Cardiovascular risk of dietary trimethylamine oxide precursors and the therapeutic potential of resveratrol and its derivatives. FEBS Open Bio 2024, 14, 358–379. [Google Scholar] [CrossRef]
  39. Niu, H.; Liu, S.; Jiang, Y.; Hu, Y.; Li, Y.; He, L.; Xing, M.; Li, X.; Wu, L.; Chen, Z.; et al. Are Microplastics Toxic? A Review from Eco-Toxicity to Effects on the Gut Microbiota. Metabolites 2023, 13, 739. [Google Scholar] [CrossRef]
  40. Zhang, Z.; Chen, W.; Chan, H.; Peng, J.; Zhu, P.; Li, J.; Jiang, X.; Zhang, Z.; Wang, Y.; Tan, Z.; et al. Polystyrene microplastics induce size-dependent multi-organ damage in mice: Insights into gut microbiota and fecal metabolites. J. Hazard. Mater. 2024, 461, 132503. [Google Scholar] [CrossRef]
  41. Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. The gut microbiota and the brain-gut-kidney axis in hypertension and chronic kidney disease. Nat. Rev. Nephrol. 2018, 14, 442–456. [Google Scholar] [CrossRef] [PubMed]
  42. Rong, L.; Zhao, L.; Zhao, L.; Cheng, Z.; Yao, Y.; Yuan, C.; Wang, L.; Sun, H. LDPE microplastics affect soil microbial communities and nitrogen cycling. Sci. Total Environ. 2021, 773, 145640. [Google Scholar] [CrossRef] [PubMed]
  43. Gryaznova, M.; Smirnova, Y.; Burakova, I.; Morozova, P.; Lagutina, S.; Chizhkov, P.; Korneeva, O.; Syromyatnikov, M. Fecal Microbiota Characteristics in Constipation-Predominant and Mixed-Type Irritable Bowel Syndrome. Microorganisms 2024, 12, 1414. [Google Scholar] [CrossRef]
  44. Mukohda, M.; Yano, T.; Matsui, T.; Nakamura, S.; Miyamae, J.; Toyama, K.; Mitsui, R.; Mizuno, R.; Ozaki, H. Treatment with Ligilactobacillus murinus lowers blood pressure and intestinal permeability in spontaneously hypertensive rats. Sci. Rep. 2023, 13, 15197. [Google Scholar] [CrossRef]
  45. Guo, Y.; Li, X.; Wang, Z.; Yu, B. Gut Microbiota Dysbiosis in Human Hypertension: A Systematic Review of Observational Studies. Front. Cardiovasc. Med. 2021, 8, 650227. [Google Scholar] [CrossRef]
  46. Halimulati, M.; Wang, R.; Aihemaitijiang, S.; Huang, X.; Ye, C.; Zhang, Z.; Li, L.; Zhu, W.; Zhang, Z.; He, L. Anti-Hyperuricemic Effect of Anserine Based on the Gut-Kidney Axis: Integrated Analysis of Metagenomics and Metabolomics. Nutrients 2023, 15, 969. [Google Scholar] [CrossRef]
  47. Tomlinson, J.A.P.; Wheeler, D.C. The role of trimethylamine N-oxide as a mediator of cardiovascular complications in chronic kidney disease. Kidney Int. 2017, 92, 809–815. [Google Scholar] [CrossRef]
Nutrients 16 04076 g001
Figure 1. Experimental protocol employed in the current study.
Figure 1. Experimental protocol employed in the current study.
Nutrients 16 04076 g001
Nutrients 16 04076 g002aNutrients 16 04076 g002b
Figure 2. (A) Body weight, (B) kidney weight-to-body weight ratio, (C) systolic blood pressure, (D) diastolic blood pressure, and (E) mean arterial pressure in rats receiving adenine chow (CK), microplastics (MP), or resveratrol butyrate esters (RBE). N = 8/group; * p < 0.05, compared with rats fed with regular chow (CN), # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MP); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Figure 2. (A) Body weight, (B) kidney weight-to-body weight ratio, (C) systolic blood pressure, (D) diastolic blood pressure, and (E) mean arterial pressure in rats receiving adenine chow (CK), microplastics (MP), or resveratrol butyrate esters (RBE). N = 8/group; * p < 0.05, compared with rats fed with regular chow (CN), # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MP); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Nutrients 16 04076 g002aNutrients 16 04076 g002b
Nutrients 16 04076 g003
Figure 3. Renal mRNA expression of olfactory receptor 78 (OlfR78); G protein-coupled receptor 41 (GPR41), GPR43, and GPR109A in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs). N = 8/group. * p < 0.05, compared with rats fed with regular chow (CN); # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MPs); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Figure 3. Renal mRNA expression of olfactory receptor 78 (OlfR78); G protein-coupled receptor 41 (GPR41), GPR43, and GPR109A in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs). N = 8/group. * p < 0.05, compared with rats fed with regular chow (CN); # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MPs); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Nutrients 16 04076 g003
Nutrients 16 04076 g004
Figure 4. For α-diversity analysis among the groups, we utilized (A) the Faith’s Phylogenetic Diversity (PD) index and (B) the Shannon index. For the β-diversity assessment, we performed (C) Partial Least Squares Discriminant Analysis (PLSDA). Each point represents the microbiota of an individual sample, with colors indicating the corresponding group. N = 8 per group. CN, rats fed with regular chow; CK, rats fed with adenine chow; MP, rats exposed to microplastics; CKMP, rats fed adenine chow and exposed to MP; and CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Figure 4. For α-diversity analysis among the groups, we utilized (A) the Faith’s Phylogenetic Diversity (PD) index and (B) the Shannon index. For the β-diversity assessment, we performed (C) Partial Least Squares Discriminant Analysis (PLSDA). Each point represents the microbiota of an individual sample, with colors indicating the corresponding group. N = 8 per group. CN, rats fed with regular chow; CK, rats fed with adenine chow; MP, rats exposed to microplastics; CKMP, rats fed adenine chow and exposed to MP; and CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Nutrients 16 04076 g004
Nutrients 16 04076 g005
Figure 5. Linear discriminant effect size (LEfSe) analysis revealed significant differences in bacterial taxa between the CKMP (blue) and CKMPRBE (orange) groups, with LDA scores exceeding 3.0. CKMP, rats fed adenine chow and exposed to MP; CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Figure 5. Linear discriminant effect size (LEfSe) analysis revealed significant differences in bacterial taxa between the CKMP (blue) and CKMPRBE (orange) groups, with LDA scores exceeding 3.0. CKMP, rats fed adenine chow and exposed to MP; CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Nutrients 16 04076 g005
Nutrients 16 04076 g006
Figure 6. Differentially abundant taxa between the CKMP and CKMPRBE groups as identified by STAMP analysis with 95% confidence intervals. N = 8/group. CKMP, rats fed adenine chow and exposed to MP; CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Figure 6. Differentially abundant taxa between the CKMP and CKMPRBE groups as identified by STAMP analysis with 95% confidence intervals. N = 8/group. CKMP, rats fed adenine chow and exposed to MP; CKMPRBE, rats fed adenine chow and exposed to both MP and resveratrol butyrate esters.
Nutrients 16 04076 g006
Nutrients 16 04076 g007
Figure 7. Plasma concentrations of (A) L-arginine, (B) asymmetric dimethylarginine (ADMA), and (C) their combined ratio (AAR) in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs). N = 8/group; * p < 0.05, compared with rats fed with regular chow (CN).
Figure 7. Plasma concentrations of (A) L-arginine, (B) asymmetric dimethylarginine (ADMA), and (C) their combined ratio (AAR) in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs). N = 8/group; * p < 0.05, compared with rats fed with regular chow (CN).
Nutrients 16 04076 g007
Nutrients 16 04076 g008
Figure 8. Renal mRNA expression of RAS-related genes in the (A) classical axis, which includes renin, pro(renin) receptor (PRR), angiotensinogen (AGT), ACE1, and AT1R; the (B) nonclassical axis, which includes ACE2, MAS, and AT2R in rats receiving adenine chow (CK), microplastics (MP), or resveratrol butyrate esters (RBE). N = 8/group. * p < 0.05, compared with rats fed with regular chow (CN); # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MP); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Figure 8. Renal mRNA expression of RAS-related genes in the (A) classical axis, which includes renin, pro(renin) receptor (PRR), angiotensinogen (AGT), ACE1, and AT1R; the (B) nonclassical axis, which includes ACE2, MAS, and AT2R in rats receiving adenine chow (CK), microplastics (MP), or resveratrol butyrate esters (RBE). N = 8/group. * p < 0.05, compared with rats fed with regular chow (CN); # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MP); and ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Nutrients 16 04076 g008
Table 1. Primers for PCR amplification of each gene studied.
Table 1. Primers for PCR amplification of each gene studied.
GeneSenseAnti-Sense
Olfr78GAGGAAGCTCACTTTTGGTTTGG CAGCTTCAATGTCCTTGTCACAG
GPR41TCTTCACCACCGTCTATCTCAC CACAAGTCCTGCCACCCTC
GPR43CTGCCTGGGATCGTCTGTG CATACCCTCGGCCTTCTGG
GPR109ACGGTGGTCTACTATTTCTCCCCCCTGGAATACTTCTGATT
ReninAACATTACCAGGGCAACTTTCACT ACCCCCTTCATGGTGATCTG
PRRGAGGCAGTGACCCTCAACAT CCCTCCTCACACAACAAGGT
AGTGCCCAGGTCGCGATGATTGTACAAGATGCTGAGTGAGGCAA
ACE1CACCGGCAAGGTCTGCTT CTTGGCATAGTTTCGTGAGGAA
AT1RGCTGGGCAACGAGTTTGTCT CAGTCCTTCAGCTGGATCTTCA
ACE2ACCCTTCTTACATCAGCCCTACTGTGTCCAAAACCTACCCCACATAT
MASCATCTCTCCTCTCGGCTTTGTGCCTCATCCGGAAGCAAAGG
AT2RCAATCTGGCTGTGGCTGACTTTGCACATCACAGGTCCAAAGA
R18SGCCGCGGTAATTCCAGCTCCA CCCGCCCGCTCCCAAGATC
Table 2. Plasma SCFA levels in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs).
Table 2. Plasma SCFA levels in rats receiving adenine chow (CK), microplastics (MPs), or resveratrol butyrate esters (RBEs).
GroupCNCKMPCKMPCKMPRBE
Acetic acid (μM)1163 ± 53.91148.6 ± 55.11080.8 ± 26.11053.3 ± 47.5966.2 ± 36.0 *#†
Propionic acid (μM)6.0 ± 0.75.3 ± 0.53.4 ± 0.4 *#4.8 ± 0.4 †6.0 ± 0.5 †
Isobutyric acid (μM)3.1 ± 0.32.4 ± 0.1 *3.3 ± 0.3 #2.6 ± 0.33.0 ± 0.4
Butyric acid (μM)16.1 ± 0.918.4 ± 0.815.8 ± 0.7 #17.6 ± 0.826.9 ± 2.3 *#†‡
Isovaleric acid (μM)4.8 ± 0.45.4 ± 0.44.5 ± 0.25.2 ± 0.55.3 ± 0.3
Valeric acid (μM)6.5 ± 0.24.9 ± 0.5 *6.3 ± 0.2 #5.7 ± 0.56.6 ± 0.3 #
N = 8/group. * p < 0.05, compared with rats fed with regular chow (CN); # p < 0.05, compared with rats fed with adenine chow (CK); † p < 0.05, compared with rats exposed to microplastics (MPs); ‡ p < 0.05, compared with rats fed adenine chow and exposed to MP (CKMP).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huang, Y.-N.; Hsu, C.-N.; Hou, C.-Y.; Chen, S.-Y.; Tain, Y.-L. Resveratrol Butyrate Esters Reduce Hypertension in a Juvenile Rat Model of Chronic Kidney Disease Exacerbated by Microplastics. Nutrients 2024, 16, 4076. https://doi.org/10.3390/nu16234076

AMA Style

Huang Y-N, Hsu C-N, Hou C-Y, Chen S-Y, Tain Y-L. Resveratrol Butyrate Esters Reduce Hypertension in a Juvenile Rat Model of Chronic Kidney Disease Exacerbated by Microplastics. Nutrients. 2024; 16(23):4076. https://doi.org/10.3390/nu16234076

Chicago/Turabian Style

Huang, Yi-Ning, Chien-Ning Hsu, Chih-Yao Hou, Shin-Yu Chen, and You-Lin Tain. 2024. "Resveratrol Butyrate Esters Reduce Hypertension in a Juvenile Rat Model of Chronic Kidney Disease Exacerbated by Microplastics" Nutrients 16, no. 23: 4076. https://doi.org/10.3390/nu16234076

APA Style

Huang, Y.-N., Hsu, C.-N., Hou, C.-Y., Chen, S.-Y., & Tain, Y.-L. (2024). Resveratrol Butyrate Esters Reduce Hypertension in a Juvenile Rat Model of Chronic Kidney Disease Exacerbated by Microplastics. Nutrients, 16(23), 4076. https://doi.org/10.3390/nu16234076

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop