Effect of a Yeast β-Glucan on the Performance, Intestinal Integrity, and Liver Function of Broiler Chickens Fed a Diet Naturally Contaminated with Fusarium Mycotoxins
1
Phileo by Lesaffre, 137 Rue Gabriel Péri, 59700 Marcq en Baroeul, France
2
Department of Research and Development, Schothorst Feed Research, Meerkoetenweg 26, 8218 NA Lelystad, The Netherlands
*
Author to whom correspondence should be addressed.
Toxins 2025, 17(2), 51; https://doi.org/10.3390/toxins17020051
Submission received: 14 December 2024
/
Revised: 10 January 2025
/
Accepted: 21 January 2025
/
Published: 23 January 2025
(This article belongs to the Special Issue Occurrence, Toxicity, Metabolism, Analysis and Control of Mycotoxins)
Abstract
:This study evaluated the effect of a yeast β-glucan on the performance, gut health, liver function, and bacterial translocation of broiler chickens fed a diet contaminated with Fusarium mycotoxins. One-day-old male Ross broilers (n = 234) were divided into three treatments with six replicates each, and a cage containing 13 birds was the experimental unit. The animals were fed a maize–soybean-based control diet or maize–soybean diets naturally contaminated with Fusarium mycotoxins, where deoxynivalenol (DON) was the major mycotoxin (~3 mg/kg), followed by zearalenone (ZEN) (~0.5 mg/kg). The Fusarium-contaminated diet was either supplemented or not with a yeast β-glucan over 28 days. Dietary exposure to Fusarium mycotoxins did not affect production performance. On the other hand, Fusarium mycotoxin exposure significantly decreased jejunum villus height (VH) and crypt depth (CD) on d13, and this effect was counteracted by the yeast β-glucan. On d28, the jejunum VH:CD ratio was significantly higher in the broiler chickens that were fed the Fusarium-contaminated diet with yeast β-glucan (125 mg/kg diet) added to it. The ileal villus area was significantly decreased in the broiler chickens fed Fusarium-contaminated diet, regardless of the supplementation with yeast β-glucan. Dietary contamination caused intestinal oxidative stress and inflammation, probably affecting nutrient absorption on d28, and resulted in a significant increase in the translocation of Escherichia coli to the liver. Dietary supplementation with yeast β-glucan minimized these negative effects.
Keywords:
Fusarium; mycotoxins; intestine; liver; oxidative stress; inflammation; bacterial translocation; poultryKey Contribution: Dietary supplementation with yeast β-glucan can effectively mitigate the negative impacts of Fusarium mycotoxin contamination on the gut health, liver function, and nutrient absorption of broiler chickens. Additionally, this study shows that dietary exposure to Fusarium mycotoxins, in which a level of around 3 mg/kg DON was achieved, damages the gut structure as well as causes oxidative stress, inflammation, and bacterial translocation in broilers.
1. Introduction
Poultry diet contamination with mycotoxins is an unavoidable problem. Among the several mycotoxins that may be found in the final feed of broiler chickens, Fusarium mycotoxins such as deoxynivalenol (DON), zearalenone (ZEN), and fumonisin (FUM) are frequently detected [1,2,3]. Despite the uncommon clinical signs associated with these mycotoxins, most studies on broiler chickens have focused on how chronic exposure to low levels of DON results in impaired growth performance [1,4,5], subclinical alterations [6], economic losses, and a negative impact on animal welfare.
Exposure to a wheat-based diet containing 2.3 mg/kg DON did not increase mortality, but the broiler chickens were 100 g lighter than those fed a 0.9 mg/kg DON diet [5]. Exposure to DON impairs intestinal function due to an increase in apoptosis as well as decreases in enterocyte proliferation [7], weakened tight junctions [8,9], and bacterial translocation to the liver [10]. Intestinal damage is characterized by morphologic alterations like decreased villus height [5,11], which results in a diminished nutrient absorption area and subsequently requires energy during intestinal morphological and functional adaptation during chronic exposure [12]. Damage to the tight junctions favors increases intestinal permeability and the risk of the translocation of enteric microorganisms like Escherichia coli [10] and Enterobacteriaceae in general, as these bacteria naturally belong to the intestinal microbiota. In addition, the suboptimally absorbed nutrients are used as a substrate for pathogenic microorganisms and may induce secondary diseases like subclinical necrotic enteritis [13].
Unfortunately, dietary contamination with a single mycotoxin is a rare event; the rule is multi-contamination with several mycotoxins [14]. Diets naturally contaminated with Fusarium mycotoxins commonly present not only DON but also its acetylated forms 3- and 15-Acetyl-DON (3- and 15-ADON) as well as DON-3-glucoside (DON-3G) [6]. Other Fusarium mycotoxins commonly found in poultry diets are FUM [2] and ZEN [3].
Broiler chickens fed a maize–soybean-based diet artificially contaminated with 1.5 mg/kg DON and 20 mg/kg FUM gained less body weight than expected [15]. However, the tested FUM contamination level was far higher than that observed in practice. Another maize–soybean-based diet containing 3.2–3.9 mg/kg DON and negligible levels of FUM (0.1 mg/kg) increased the feed conversion ratio (FCR) in broiler chickens [16]. Due to a LOAEL of 30 mg/kg BW per day and a NOAEL of 7.5 mg/kg BW per day, and the ability to convert most ingested ZEN into β-zearalenol (5-fold less potent than ZEN), broiler chickens are considered very resistant to this mycotoxin, and the risk of adverse effects is very low in these animals [17].
Preventive measures can decrease feed contamination but are not effective to completely prevent the presence of mycotoxins in animal diets. An approach involves using feed additives that may deactivate mycotoxins, preventing their absorption in the intestine or enhancing gut health during exposure to mitigate the detrimental effects of mycotoxins. To reduce the intestinal and liver injuries caused by Fusarium mycotoxins, it is necessary to tackle oxidative stress, inflammation, and support nutrient absorption. Yeast β-glucan, a polysaccharide comprising a β-1,3-linked D-glucopyranosil backbone with β-1,6-linked side chains, has health-promoting functions, such as immune modulation, anti-inflammatory, antioxidative, and antibacterial activities, as well as beneficial effects on intestinal barrier function [18,19,20].
The aim of our study was to assess the effects of 28 days of dietary exposure to Fusarium mycotoxins on the production performance, small intestine morphology and function, liver function, and bacterial translocation of broiler chickens. To this end, broiler chickens were fed a control diet that was marginally or naturally Fusarium-contaminated, either supplemented or not with yeast β-glucan. Growth performance was assessed on days 13 and 28. Also, intestinal integrity and function were analyzed via histological and qRT-PCR analyses, which were conducted to study if the intestinal morphology was affected and if genes coding for oxidative stress, inflammation response, tight junctions, and nutrient absorption were influenced by DON and the additive intervention. The liver was analyzed for oxidative stress, inflammation, and metabolic function via qRT-PCR, and bacterial translocation to the liver was assessed.
2. Results
2.1. Production Performance
The average body weight of the birds at the start of the trial was 41.5 g (41.1–41.9 g) for all treatments. No differences in growth performance or mortality were observed (Table 1).
2.2. Jejunum and Ileum Morphometry and Morphological Scores
The villus height (VH) and crypt depth (CD) of the jejunum of 13-day-old broiler chickens were significantly decreased when the birds were fed the Fusarium-contaminated diet. Adding yeast β-glucan to the Fusarium-contaminated diet was able to counteract this negative effect. On day 28, the jejunum VH:CD was significantly increased in the broiler chickens fed the Fusarium-contaminated diet supplemented with yeast β-glucan. The jejunum morphologic scores remained unaffected (Table 2). No morphometric changes were observed in the ileum, except on day 28, where the villus area was significantly decreased in the ileum of the broiler chickens fed the Fusarium-contaminated diet with or without yeast β-glucan. The ileum morphologic scores remained unaffected (Table 3). Illustrative images of the jejunum and ileum from the broiler chickens fed the experimental diets are given in Figure 1.
2.3. mRNA Expression of Markers of Gut Integrity and Liver Function
On day 13, a significant upregulation of liver-expressed antimicrobial peptide 2 (LEAP2) and significant downregulation of peptide transporter 1 (PEPT1) were observed in the jejunum of the broiler chickens fed the Fusarium-contaminated diet, and this effect was no longer observed when the Fusarium-contaminated diet was supplemented with yeast β-glucan. Furthermore, a significant upregulation of glucose transporter 1 (GLUT1) was observed in the broiler chickens fed the Fusarium-contaminated diet supplemented with yeast β-glucan (Figure 2).
On day 28, the jejunum of the broiler chickens fed a Fusarium-contaminated diet showed a significant upregulation of xanthine oxidoreductase (XOR); interferon gamma (IFNg); interleukins (IL)-8, -10, and -12; PEPT1; and claudin 1 (CLDN1). This effect was no longer observed when the Fusarium-contaminated diet was supplemented with yeast β-glucan (Figure 2).
The expressions of the evaluated markers in the liver such as heme oxygenase (HMOX), XOR, IFNg, IL-8, IL-10, IL-12, carnitine palmitoyltransferase 1 (CPT1), LEAP2, and sterol regulatory element binding transcription factor 2 (SREBP2) were not affected by the dietary treatments, except by a significant upregulation of inducible nitric oxide synthase (iNOS) (1.2-fold increase) in the liver of the broiler chickens fed the Fusarium-contaminated diet, and this effect was not observed when the Fusarium-contaminated diet was supplemented with yeast β-glucan. Furthermore, the expression of IL-6 in the liver was negligible.
2.4. Bacterial Translocation
No differences in bacterial colony counts were observed on day 13. On day 28, broiler chickens fed the Fusarium-contaminated diet showed a significant increase in the colonies of Escherichia coli in the liver. When yeast β-glucan was added to the Fusarium-contaminated diet, the number of E. coli colonies was similar to that in the control group (Table 4). The translocation of Enterobacteriaceae and E. coli to the liver was characterized by regularly shaped gas colonies (Figure 3). Irregularly shaped gas areas or bubbles were considered artifacts.
2.5. Macroscopic Findings
The post mortem analysis revealed some alterations in the liver (Figure 4). On both days 13 and 28, the group fed the Fusarium-contaminated diet had a higher number of broiler chickens displaying blood spots or pale areas in their livers. Table 5 depicts the number of broiler chickens exhibiting alterations and the total number of evaluated broiler chickens per treatment, i.e., 18 (six cages with three birds per cage). A sum of the number of broiler chickens presenting alterations higher than the total number of chickens indicates that the same chicken presented two or more alterations.
3. Discussion
In the present study, we evaluated the effects of a diet naturally contaminated with Fusarium mycotoxins, where the main mycotoxin was DON at a concentration of approximately 3 mg/kg. The dietary levels of ZEN and FUM were extremely low when considering the LOAEL of 30 mg/kg BW per day and 2.5 mg/kg feed, respectively [9,21]. The levels of 3+15-ADON and DON-3G were comparable in the contaminated diets. Furthermore, different from pigs, the oral bioavailability of DON-3G in poultry is very low (3.8%), and presystemic hydrolysis and conversion into DON do not occur [22]. Therefore, the results are discussed regarding the effects of DON exposure on growth performance, intestinal and liver function, and bacterial translocation in broiler chickens. Furthermore, the impact of yeast β-glucan supplementation of the Fusarium-contaminated diet was evaluated.
Although broiler chickens fed the Fusarium-contaminated diet had a BWG 23 g lower than those fed the control diet, no significant differences were observed in growth performance. The trial was performed under highly controlled climate conditions, and the birds were kept in cages and not in floor pens like in other studies [8]. Impaired growth performance was reported in broiler chickens exposed to 2.3 mg/kg DON via a wheat-based diet, which is a source of nonstarch polysaccharides (NSPs), responsible for increasing intestinal viscosity in poultry and acting as an extra dietary challenge [5]. In the present trial, birds were housed in low density, and they were not submitted to the same risks observed in a commercial large farm, e.g., extra viral and bacterial exposure. When performance was assessed in 18 trials in a longitudinal study performed in commercial poultry farms, a significant loss in growth performance was observed when the dietary DON levels were close to 2.6 mg/kg [4].
Regarding the morphological alterations in the intestines, at d13, the VH and CD of the jejunum were significantly decreased when broiler chickens were fed the Fusarium-contaminated diet, except when yeast β-glucan was added to the diet. This effect was expected and already observed in previous trials with broiler chickens [6,23]. Deoxynivalenol induces apoptosis and inhibits cell proliferation [7]. The VH:CD was increased in the jejunum of 28-day-old chickens fed the Fusarium-contaminated diet supplemented with yeast β-glucan because of an increase in the villus height. These findings are in agreement with previous research, which showed that birds fed β-glucans had increased villus height [24,25] but also indicated that the yeast β-glucan can help recover some of the villus loss or damage caused by Fusarium challenge. It was observed that yeast β-glucans enhanced intestinal health by increasing immune-response-stimulating macrophages [25]. Furthermore, dietary supplementation with yeast β-glucans decreased the intestinal lesions caused by necrotic enteritis, demonstrating its healing capacity [26]. Exposure to Fusarium mycotoxins during 28 days decreased the ileum villus area, but neither the villus height nor the crypt depth changed along with this decrease. The decrease in villi surface area could be attributed to a reduction in their density, the atrophy of microvilli, changes in their shape, or tissue damage, even if their height and the depth of the crypts remained unchanged. No increase in the degree of intestinal damage in relation to the control was observed, but it was remarkable that, at d28, the damage degree in all groups was above two. The trial was performed during the summer, and between d20 and d28, the temperature in the house was higher than the target, probably resulting in heat stress. As previously demonstrated, the jejunum is more sensitive to heat stress than the ileum [27], so no increase in damage was observed in the ileum during the present trial. The absence of significant differences among the treatments suggests that this period of heat stress did not increase the negative impact of the mycotoxins or increase mortality. None of the selected markers were altered in the liver, except for the upregulation of iNOS in the liver of 13-day-old broiler chickens. Exposure to DON may activate proinflammatory-inducible enzymes like iNOS at the site of inflammation [28]. However, no other cytokine was activated in the liver, indicating that this process was limited, and the broiler chickens were able to adapt to the condition of chronic exposure to mycotoxins on day 28.
Most of the alterations in gene expression were observed in the jejunum of the broiler chickens. On d13, broiler chickens fed the Fusarium-contaminated diet showed a downregulation of PEPT1, an upregulation of GLUT1, and an upregulation of LEAP2. Previous studies have reported the downregulation of PEPT1 in the jejunum of broiler chickens fed a DON-contaminated diet [29,30]. PEPT1 is expressed in the brush border membrane of enterocytes and plays a role in the transport of most amino acids [31,32]. The downregulation of PEPT1 is the result of an adaptation mechanism due to the decreased protein use in the first two weeks of dietary exposure to DON or to a direct negative impact of DON, which decreases brush border function [33]. This later hypothesis is supported by the decreased villus height in the present trial, consequently interfering with the nutrient absorption area. PEPT1 downregulation was concomitant with GLUT1 upregulation, which may act as a compensatory response [6] because this glucose transporter is essential for cellular growth and development [34]. In the present trial, the antimicrobial peptide LEAP2 was upregulated in the jejunum of 13-day-old broiler chickens fed the DON-contaminated diet. The expression of LEAP2 can be upregulated as a response to bacterial and protozoan infections as a direct systemic response [35,36]. When the contaminated diet was supplemented with yeast β-glucan, GLUT1 upregulation remained present, but no downregulation of PEPT1 was observed.
The broiler chickens fed the DON-contaminated diet showed an upregulation of PEPT1 in their jejunum on d28, potentially as a response to the decreased nutrient absorption caused by the long-term exposure to DON. The 28-day exposure resulted in oxidative stress and inflammation, as measured by the upregulation of XOR, IFNg, IL8, IL10, and IL12. The upregulation of XOR in the intestine of broiler chickens fed a DON-contaminated diet was previously shown [8]. This enzyme plays a role in the synthesis of reactive oxygen species as a cellular defence [37]. DON has proinflammatory properties and causes persistent intestinal inflammation [38]. Chronic inflammation caused by DON negatively impacts the immune system and decreases disease resistance in poultry [39]. It is known that β-glucans are not able to degrade or bind DON but act to improve gut health and bird immunity [40]. In the present study, it seems that yeast β-glucan was able to counteract jejunum inflammation. Supplementation with β-glucan has been demonstrated to modify the cytokine profiles of broiler chickens [41]. Exposure to high levels of DON, i.e., 10 mg/kg, resulted in the downregulation of the tight junction CLDN1 [42]. In the present trial, exposure to 3 mg/kg DON resulted in the upregulation of CLDN1. Disease conditions, including intestinal inflammation, likely increase the expression of this tight junction complex protein as a protective reaction [43]. The increase in the expression of CLDN1, however, did not prevent E. coli translocation in 28-day-old chickens fed the DON-contaminated diet. DON-facilitated bacterial translocation was demonstrated in in vitro studies with intestinal organoids [44] and in broiler chickens coexposed to DON and infectious agents [10]. The exposure of broiler chickens via their diet to 5 mg/kg DON resulted in an increase in the load of E. coli in the liver [9], as confirmed by our present findings. In the present trial, infection was not induced, and management was performed under strict hygienic conditions.
4. Conclusions
Exposure to a diet naturally contaminated with Fusarium mycotoxins, where the major contaminant was DON at a concentration of approximately 3 mg/kg, impaired jejunum villus height, crypt depth, and villus area as well as led to intestinal oxidative stress and inflammation with bacterial translocation. Supplementing the contaminated diet with yeast β-glucan counteracted this negative impact.
5. Materials and Methods
5.1. Experimental Design
One-day-old male Ross 308 broilers were purchased from a local commercial hatchery and divided into three experimental groups of 234 chicks each (divided among six replicate cages with 13 chicks each). The birds were housed in 18 cages with wood shavings as the bedding material and were kept until 28 days of age. Housing and management were performed following EU legislation [6]. The control diet was prepared with a maize batch marginally contaminated with mycotoxins. The other two diets were prepared with a maize batch naturally contaminated with Fusarium mycotoxins. All diets met the nutritional requirements of broiler chickens (Table 6). The contaminated diets were divided into two sub-batches, and one of them was supplemented with a yeast β-glucan (enriched yeast β-glucan, Phileo by Lesaffre, Marcq-en-Baroeul, France) at a dosage of 125 mg/kg diet. Treatments were randomly allocated per block to cages, where each treatment was repeated six times. The cage was the experimental unit, and each cage contained 13 broilers. On d13 and d28, three broiler chickens per cage were randomly selected and euthanized using gasification followed by exsanguination. Subsequently, jejunum and ileum samples from each of the three birds were immediately collected and prepared for histological analysis, while jejunum and liver samples were processed for mRNA expression analysis. Additionally, liver samples were collected under sterile conditions and subjected to a bacterial translocation test. Simultaneously, a post mortem examination of the broiler chickens was conducted.
The mycotoxin levels in each diet are presented in Table 7. In brief, the control diets contained negligible amounts of the Fusarium mycotoxins DON, DON-3G, nivalenol, and ZEN. In the Fusarium-contaminated diets, DON was the major mycotoxin, followed by DON-3G, ZEN, with negligible levels of FB1 + FB2, and 3+15-ADON. All diets were analyzed in an independent and accredited (BELAC 057-TEST/ISO17025) laboratory (Primoris Holding, Gent, Belgium) via liquid chromatography with tandem mass spectrometry (LC-MS/MS).
The analyzed mycotoxins with their respective limit of quantification (LOQ) were aflatoxin B1 (1 µg/kg), aflatoxin B2 (1 µg/kg), aflatoxin G1 (1 µg/kg), aflatoxin G2 (1 µg/kg), alternariol (2 µg/kg), alternariol monomethyl ether (2 µg/kg), beauvericin (5 µg/kg), citrinin (10 µg/kg), cytochalasine E (2 µg/kg), deoxynivalenol (20 µg/kg), 3 + 15 acetyl-deoxynivalenol (3 + 15 ADON; 20 µg/kg), deoxynivalenol-3-glucoside (DON-3G; 20 µg/kg), diacetoxyscirpenol (5 µg/kg), enniatin A (5 µg/kg), enniatin A1 (5 µg/kg), enniatin B (5 µg/kg), enniatin B1 (5 µg/kg), fumonisins B1 + B2 (20 µg/kg), moniliformin (5 µg/kg), nivalenol (50 µg/kg), ochratoxin A (1 µg/kg), roquefortine C (5 µg/kg), sterigmatocystin (1 µg/kg), T-2/HT-2 toxin (10 µg/kg), and zearalenone (15 µg/kg).
5.2. Production Performance
Broilers were weighed per cage on d0, d13, and d28, and mortality was recorded throughout the experimental period. BWG, FI, and FCR were determined in the periods from d0 to 13 and d13 to 28, and the complete experimental period, i.e., d0-28.
5.3. Histological Analysis
Samples of the jejunum and ileum from each three of the birds per cage on d13 and d28 were collected and fixed in buffered formalin for histological analysis. In brief, histological slides (periodic acid–Schiff (PAS) counterstained with hematoxylin staining) from the jejunum were scanned with a NanoZoomer-XR (Hamamatsu Photonics KK, Hamamatsu, Japan). The scanned slides were viewed through viewer software (NDP.view2; Hamamatsu) and analyzed using analysis software (NDP.analyze; Hamamatsu). VH, CD, and villus area (µm2) from each individual bird were measured (15 villi per intestinal segment). The measurements of VH and CD were used to calculate the VH:CD ratio. Only intact villi were measured. To evaluate the degree of mucosal damage, the Chiu/Park scale was applied [45]. In brief, the mucosa was classified as normal if presenting an intact structure with no visible damage (degree 0) to severely damaged (degree 6) [27]. The mean damage degree per treatment was calculated, as previously described [46].
5.4. mRNA Expression of Markers of Gut Integrity and Liver Function
From each of the three birds per cage, samples of the jejunum and liver were collected for RNA isolation using an SV Total RNA Isolation System (Promega, Madison, WI, USA) according to the manufacturer’s instructions, and total RNA was quantified with a spectrophotometer (Nanodrop ND-1000, Thermo Scientific, Wilmington, DE, USA). Subsequently, 1 µg of extracted total RNA was reverse-transcribed with an iScriptTM cDNA Synthesis kit (BIO-RAD, Hercules, CA, USA). The cDNA was diluted to a final concentration of 30 ng/µL. Primers, as presented in Table 8, were commercially produced (Eurogentec, Maastricht, The Netherlands). qPCR was performed as previously described [6], and data were analyzed using the efficiency-corrected DeltaDelta-Ct method [47]. The fold-change values of the genes of interest were normalized using the geometric mean of the fold-change values of two housekeeping genes: hypoxanthine-guanine phosphoribosyl transferase (HPRT) and b-actin (ACTB). The mRNA expression of the markers in the jejunum and ileum were selected based on their role, i.e., oxidative stress, inflammation, nutrient transporters, villus crypt function, tight junctions, and intestinal damage. The markers in the liver were based on their role, i.e., oxidative stress, inflammation, and metabolism.
5.5. Bacterial Translocation
To evaluate the degree of bacteria that moved from the gut to the liver, bacterial translocation was determined. From each of the three birds per cage, the right half of the liver was removed, collected in sterile bags, and homogenized with sterile 0.9% saline [54]. After mixing the tissue well in saline, 1 mL of each sample was plated on two 3M Petri films (3M, Delft, The Netherlands) with specificity for E. coli and Enterobacteriaceae. Measurements of colony growth were performed after 24 h incubation at 37 °C. Translocation was determined by counting the number of bacterial colonies per plate.
5.6. Statistical Analysis
The cage was the experimental unit for all data. The experimental data were analyzed with ANOVA (GenStat Version 19.0, 2018, Hemel Hempstead, UK). Treatment means were compared using the least significant difference (LSD). Values with p ≤ 0.05 were considered statistically significant.
5.7. Declaration of AI-Assisted Technology in the Writing Process
During the preparation of this work, the authors used QuillBot in order to improve readability and language. The AI tool was not used to replace key researcher tasks such as interpreting data or drawing scientific conclusions. After using this tool, the authors reviewed and edited the content as needed and take full responsibility for the content of this publication.
Author Contributions
Conceptualization, V.M. and R.R.S.; methodology, J.S.; formal analysis, R.R.S.; investigation, V.M., J.S., F.M. and R.R.S.; resources, F.M. and R.R.S.; data curation, R.R.S.; writing—original draft, V.M. and R.R.S.; writing—review and editing, F.M. and R.R.S.; funding acquisition, V.M. and F.M. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
This experiment was conducted according to the guidelines of the Animal and Human Welfare Codes/Laboratory practice codes in The Netherlands. The protocol was approved by the Ethics Review Committee: Body of Animal Welfare at SFR (AVD246002016450), approval date: 6 June 2020.
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Acknowledgments
The authors thank the project office, caretakers, and analysts from SFR for their technical support. The authors acknowledge the QuillBot AI tool used for editing and improving our writing via grammar checking.
Conflicts of Interest
Authors Virginie Marquis and Julie Schulthess were employed by the company Phileo by Lesaffre. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Abbreviations
| 3-ADON | 3-Acetyl-deoxynivalenol |
| 15-DON | 15-Acetyl-deoxynivalenol |
| ACTB | Beta actin |
| ANOVA | Analysis of variance |
| BW | Body weight |
| BWG | Body weight gain |
| CD | Crypt depth |
| CLDN1 | Claudin 1 |
| CLDN5 | Claudin 5 |
| CPT1 | Carnitine palmitoyltransferase 1 |
| DON | Deoxynivalenol |
| DON-3G | Deoxynivalenol-3-glucoside |
| EU | European union |
| FCR | Feed conversion ratio |
| FI | Feed intake |
| FUM | Fumonisin |
| GLUT1 | Glucose transporter 1 |
| GOI | Gene of interest |
| HKG | Housekeeping gene |
| HMGCR | 3-Hydroxy-3-methylglutaryl-CoA reductase |
| HMOX | Heme oxygenase |
| HPRT | Hypoxanthine phosphoribosyltransferase |
| IFNg | Interferon gamma |
| IL-10 | Interleukin 10 |
| IL-12 | Interleukin 12 |
| IL-6 | Interleukin 6 |
| IL-8 | Interleukin 8 |
| iNOS | Inducible nitric oxide synthase |
| LC-MS/MS | Liquid chromatography with tandem mass spectrometry |
| LEAP2 | Liver-expressed antimicrobial peptide 2 |
| LOAEL | Lowest observed adverse effect level |
| LSD | Least significant difference |
| MUC2 | Mucin 2 |
| NOAEL | No observable adverse effect level |
| PAS | Periodic acid–Schiff |
| PEPT1 | Peptide transporter 1 |
| qRT-PCR | Quantitative reverse-transcription polymerase chain reaction |
| SREBP2 | Sterol regulatory element binding transcription factor 2 |
| VH | Villus height |
| VH:CD ratio | Villus height:crypt depth ratio |
| VIL1 | Villin 1 |
| XOR | Xanthine oxidoreductase |
| ZEN | Zearalenone |
References
- Adugna, C.; Wang, K.; Du, J.; Li, C. Deoxynivalenol mycotoxin dietary exposure on broiler performance and small intestine health: A comprehensive meta-analysis. Poult. Sci. 2024, 103, 104412. [Google Scholar] [CrossRef] [PubMed]
- Sousa, M.C.S.; Galli, G.M.; Alba, D.F.; Griss, L.G.; Gebert, R.R.; Souza, C.F.; Baldissera, M.D.; Gloria, E.M.; Mendes, R.E.; Zanelato, G.O.; et al. Pathogenic effects of feed intake containing of fumonisin (Fusarium verticillioides) in early broiler chicks and consequences on weight gain. Microb. Pathog. 2020, 147, 104247. [Google Scholar] [CrossRef]
- Liu, J.; Applegate, T. Zearalenone (ZEN) in livestock and poultry: Dose, toxicokinetics, toxicity and estrogenicity. Toxins 2020, 12, 377. [Google Scholar] [CrossRef] [PubMed]
- Kolawole, O.; Graham, A.; Donaldson, C.; Owens, B.; Abia, W.A.; Meneely, J.; Alcorn, M.J.; Connolly, L.; Elliott, C.T. Low doses of mycotoxin mixtures below EU regulatory limits can negatively affect the performance of broiler chickens: A longitudinal study. Toxins 2020, 12, e433. [Google Scholar] [CrossRef] [PubMed]
- Santos, R.R.; van Eerden, E. Impaired performance of broiler chickens fed diets naturally contaminated with moderate levels of deoxynivalenol. Toxins 2021, 13, 170. [Google Scholar] [CrossRef]
- Santos, R.R.; Oosterveer-van der Doelen, M.A.M.; Tersteeg-Zijderveld, M.H.G.; Molist, F.; Mezes, M.; Gehring, R. Susceptibility of broiler chickens to deoxynivalenol exposure via artificial or natural dietary contamination. Animals 2021, 11, 989. [Google Scholar] [CrossRef]
- Pinton, P.; Tsybulskyy, D.; Lucioli, J.; Laffitte, J.; Callu, P.; Lyazhri, F.; Grosjean, F.; Bracarense, A.P.; Kolf-Clauw, M.; Oswald, I.P. Toxicity of deoxynivalenol and its acetylated derivatives on the intestine: Differential effects on morphology, barrier function, tight junction proteins, and mitogen-activated protein kinases. Toxicol. Sci. 2012, 130, 180–190. [Google Scholar] [CrossRef] [PubMed]
- Osselaere, A.; Santos, R.; Hautekiet, V.; De Backer, P.; Chiers, K.; Ducatelle, R.; Croubels, S. Deoxynivalenol Impairs Hepatic and Intestinal Gene Expression of Selected Oxidative Stress, Tight Junction and Inflammation Proteins in Broiler Chickens, but Addition of an Adsorbing Agent Shifts the Effects to the Distal Parts of the Small Intestine. PLoS ONE 2013, 8, e69014. [Google Scholar] [CrossRef] [PubMed]
- Awad, W.A.; Ruhnau, D.; Hess, C.; Doupovec, B.; Schatzmayr, D.; Hess, M. Feeding of deoxynivalenol increases the intestinal paracellular permeability of broiler chickens. Arch. Toxicol. 2019, 93, 2057–2064. [Google Scholar] [CrossRef]
- Ruhnau, D.; Hess, C.; Grenier, B.; Doupovec, B.; Schatzmayr, D.; Hess, M.; Awad, W.A. The mycotoxin deoxynivalenol (DON) promotes Campylobacter jejuni multiplication in the intestine of broiler chickens with consequences on bacterial translocation and gut integrity. Front. Vet. Sci. 2020, 7, 573894. [Google Scholar] [CrossRef]
- Azizi, T.; Daneshyar, M.; Allymehr, M.; Jalali, A.S.; Behroozyar, H.K.; Tukmechi, A. The impact of deoxynivalenol contaminated diet on performance, immune response, intestine morphology and jejunal gene expression in broiler chicken. Toxicon 2021, 199, 72–78. [Google Scholar] [CrossRef]
- Yunus, A.W.; Blajet-Kosicka, A.; Kosicki, R.; Khan, M.Z.; Rehman, H.; Böhm, J. Deoxynivalenol as a contaminant of broiler feed: Intestinal development, absorptive functionality, and metabolism of the mycotoxin. Poult. Sci. 2012, 91, 852–861. [Google Scholar] [CrossRef]
- Antonissen, G.; Immerseel, F.V.; Pasmans, F.; Ducatelle, R.; Haesebrouck, F.; Timbermont, L.; Verlinden, M.; Jules Janssens, G.P.; Eeckhaut, V.; Eeckhout, M.; et al. The Mycotoxin deoxynivalenol predisposes for the development of Clostridium perfringens-induced necrotic enteritis in broiler chickens. PLoS ONE 2014, 9, e108775. [Google Scholar] [CrossRef] [PubMed]
- Kovalsky, P.; Kos, G.; Nährer, K.; Schwab, C.; Jenkins, T.; Schatzmayr, G.; Sulyok, M.; Krska, R. Co-occurrence of regulated, masked and emerging mycotoxins and secondary metabolites in finished feed and maize—An extensive survey. Toxins 2016, 8, 363. [Google Scholar] [CrossRef]
- Liu, J.D.; Doupovec, B.; Schatzmayr, D.; Murugesan, G.R.; Bortoluzzi, C.; Villegas, A.M.; Applegate, T.J. The impact of deoxynivalenol, fumonisins, and their combination on performance, nutrient, and energy digestibility in broiler chickens. Poult. Sci. 2020, 99, 272–279. [Google Scholar] [CrossRef]
- Santos, R.R.; Molist, F. Effect of different dietary levels of corn naturally contaminated with DON and its derivatives 3 + 15 Ac-DON and DON-3-glucoside on the performance of broilers. Heliyon 2020, 6, e05257. [Google Scholar] [CrossRef] [PubMed]
- EFSA CONTAM Panel (EFSA Panel on Contaminants in the Food Chain); Knutsen, H.-K.; Alexander, J.; Barregård, L.; Bignami, M.; Brüschweiler, B.; Ceccatelli, S.; Cottrill, B.; Dinovi, M.; Edler, L.; et al. Scientific opinion on the risks for animal health related to the presence of zearalenone and its modified forms in feed. EFSA J. 2017, 15, e04851. [Google Scholar] [PubMed]
- Stier, H.; Ebbeskotte, V.; Gruenwald, J. Immune-modulatory effects of dietary Yeast Beta-1,3/1,6-D-glucan. Nutr. J. 2014, 13, 38. [Google Scholar] [CrossRef]
- Lee, C.; Verma, R.; Byun, S.; Jeun, E.J.; Kim, G.C.; Lee, S.; Kang, H.J.; Kim, C.J.; Sharma, G.; Lahiri, A.; et al. Structural specificities of cell surface β-glucan polysaccharides determine commensal yeast mediated immune-modulatory activities. Nat. Comm. 2021, 12, 3611. [Google Scholar] [CrossRef]
- Ganda Mall, J.P.; Casado-Bedmar, M.; Winberg, M.E.; Brummer, R.J.; Schoultz, I.; Keita, A.V. A β-glucan-based dietary fiber reduces mast cell-induced hyperpermeability in ileum from patients with crohn’s disease and control subjects. Inflamm. Bowel Dis. 2017, 24, 166–178. [Google Scholar] [CrossRef] [PubMed]
- Broekaert, N.; Devreese, M.; van Bergen, T.; Schauvliege, S.; De Boevre, M.; De Saeger, S.; Vanhaecke, L.; Berthiller, F.; Michlmayr, H.; Malachová, A.; et al. In vivo contribution of deoxynivalenol-3-β-D-glucoside to deoxynivalenol exposure in broiler chickens and pigs: Oral bioavailability, hydrolysis and toxicokinetics. Arch. Toxicol. 2017, 91, 699–712. [Google Scholar] [CrossRef]
- EFSA CONTAM Panel (EFSA Panel on Contaminants in the Food Chain); Schrenk, D.; Bignami, M.; Bodin, L.; Chipman, J.K.; del Mazo, J.; Grasl-Kraupp, B.; Hogstranc, C.; Leblanc, J.C.; Nielsen, E.; et al. Scientific Opinion on the assessment of information as regards the toxicity of fumonisins for pigs, poultry and horses. EFSA J. 2022, 20, e07534. [Google Scholar]
- Wan, S.; Sun, N.; Li, H.; Khan, A.; Zheng, X.; Sun, Y.; Fan, R. Deoxynivalenol damages the intestinal barrier and biota of the broiler chickens. BMC Vet. Res. 2022, 18, 311. [Google Scholar] [CrossRef]
- Ding, B.; Zheng, J.; Wang, X.; Zhang, L.; Sun, D.; Xing, Q.; Pirone, A.; Fronte, B. Effects of dietary yeast beta-1,3-1,6-glucan on growth performance, intestinal morphology and chosen immunity parameters changes in Haidong chicks. Asian-Australas. J. Anim. Sci. 2019, 32, 1558–1564. [Google Scholar] [CrossRef] [PubMed]
- Bar-Dagan, H.; Gover, O.; Cohen, N.A.; Vetvicka, V.; Rozenboim, I.; Schwartz, B. Beta-glucans induce cellular immune training and changes in intestinal morphology in poultry. Front. Vet. Sci. 2023, 9, 2022. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Shao, Y.; Wang, Z.; Guo, Y. Effects of dietary yeast -glucans supplementation on growth performance, gut morphology, intestinal Clostridium perfringens population and immune response of broiler chickens challenged with necrotic enteritis. Anim. Feed Sci. Technol. 2016, 215, 144–155. [Google Scholar] [CrossRef]
- Santos, R.R.; Awati, A.; Roubos-van den Hil, P.; Tersteeg-Zijderveld, M.H.G.; Koolmees, P.A.; Fink-Gremmels, J. Quantitative histo-morphometric Analysis of Heat Stress Related Damage in the Small Intestines of Broiler Chickens. Avian Pathol. 2015, 44, 19–22. [Google Scholar] [CrossRef]
- Adesso, S.; Autore, G.; Quaroni, A.; Popolo, A.; Severino, L.; Marzocco, S. The food contaminants nivalenol and deoxynivalenol induce inflammation in intestinal epithelial cells by regulating reactive oxygen species release. Nutrients 2017, 9, 1343. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Liu, Y.; Duan, Y.; Wang, F.; Guo, F.; Yan, F.; Yang, X.; Yang, X. Intestinal toxicity of deoxynivalenol is limited by supplementation with Lactobacillus plantarum JM113 and consequentially altered gut microbiota in broiler chickens. J. Anim. Sci. Biotechnol. 2018, 9, 74. [Google Scholar] [CrossRef] [PubMed]
- Riahi, I.; Marquis, V.; Ramos, A.J.; Brufau, J.; Esteve-Garcia, E.; Pérez-Vendrell, A.M. Effects of deoxynivalenol-contaminated diets on productive, morphological, and physiological indicators in broiler chickens. Animals 2020, 10, 1795. [Google Scholar] [CrossRef]
- Goel, A.; Ncho, C.M.; Choi, Y.H. Regulation of gene expression in chickens by heat stress. J. Anim. Sci. Biotechnol. 2021, 12, 11. [Google Scholar] [CrossRef]
- Daniel, H. Molecular and integrative physiology of intestinal peptide transport. Annu. Rev. Physiol. 2004, 66, 361–384. [Google Scholar] [CrossRef]
- Pinton, P.; Oswald, I.P. Effect of deoxynivalenol and other type B trichothecenes on the intestine: A review. Toxins 2014, 6, 1615–1643. [Google Scholar] [CrossRef]
- Kono, T.; Nishida, M.; Nishiki, Y.; Seki, Y.; Sato, K.; Akiba, Y. Characterisation of glucose transporter (GLUT) gene expression in broiler chickens. Br. Poult. Sci. 2005, 46, 510–515. [Google Scholar] [CrossRef] [PubMed]
- Townes, C.L.; Michailidis, G.; Nile, C.J.; Hall, J. Induction of cationic chicken liver-expressed antimicrobial peptide 2 in response to Salmonella enterica infection. Infect. Immun. 2004, 72, 6987–6993. [Google Scholar] [CrossRef] [PubMed]
- Milanova, A.; Santos, R.R.; Lashev, L.; Koinarski, V.; Fink-Gremmels, J. Influence of experimentally induced Eimeria tenella infection on gene expression of some host response factors in chickens. Bulg. J. Vet. Med. 2016, 19, 47–56. [Google Scholar] [CrossRef]
- Harrison, R. Structure and function of xanthine oxidoreductase: Where are we now? Free Radical. Biol. Med. 2002, 33, 774–797. [Google Scholar] [CrossRef] [PubMed]
- Cano, P.M.; Seeboth, J.; Meurens, F.; Cognie, J.; Abrami, R.; Oswald, I.P. Deoxynivalenol as a new factor in the persistence of intestinal inflammatory diseases: An emerging hypothesis through possible modulation of Th17-mediated response. PLoS ONE 2013, 8, e53647. [Google Scholar] [CrossRef]
- Ghareeb, K.; Awad, W.A.; Soodoi, C.; Sasgary, S.; Strasser, A.; Böhm, J. Effects of feed contaminant deoxynivalenol on plasma cytokines and mRNA expression of immune genes in the intestine of broiler chickens. PLoS ONE 2013, 8, e71492. [Google Scholar] [CrossRef]
- Teng, P.Y.; Kim, W.K. Review: Roles of prebiotics in intestinal ecosystem of broilers. Front. Vet. Sci. 2018, 5, 245. [Google Scholar] [CrossRef]
- Schwartz, B.; Vetvicka, V. Review: β-glucans as effective antibiotic alternatives in poultry. Molecules 2021, 26, 3560. [Google Scholar] [CrossRef]
- Zhai, X.; Qiu, Z.; Wang, L.; Luo, Y.; He, W.; Yang, J. Possible toxis mechanisms of deoxynivalenol (DON) exposure to intestinal barrier damage and dysbiosis of the gut microbiota in laying hens. Toxins 2022, 14, 682. [Google Scholar] [CrossRef] [PubMed]
- Gharib-Naseri, K.; Kheravii, S.; Keergin, C.; Swick, R.A.; Choct, M.; Wu, S.B. Differential expression of intestinal genes in necrotic enteritis challenged broiler chickens with 2 different Clostridium perfringens strains. Poult. Sci. 2021, 100, 100886. [Google Scholar] [CrossRef]
- Guan, X.; Martinez, A.R.; Fernandez, M.; Molist, F.; Wells, J.M.; Santos, R.R. The Mycotoxins T-2 and Deoxynivalenol Facilitate the Translocation of Streptococcus suis across Porcine Ileal Organoid Monolayers. Toxins 2024, 16, 382. [Google Scholar] [CrossRef] [PubMed]
- Quaedackers, J.S.; Beuk, R.J.; Bennet, L.; Charlton, A.; Oude Egbrink, M.G.; Gunn, A.J.; Heineman, E. An evaluation of methods for grading histologic injury following ischemia/reperfusion of the small bowel. Transplant. Proc. 2000, 32, 1307–1310. [Google Scholar] [CrossRef]
- Santos, R.R.; Awati, A.; Roubos-van den Hil, P.J.; van Kempen, T.A.T.G.; Tersteg-Zijderveld, M.H.G.; Koolmees, P.A.; Smits, C.; Fink-Gremmels, J. Effects of a feed additive blend on broilers challenged with heat stress. Avian Pathol. 2019, 48, 582–601. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Varasteh, S.; Braber, S.; Akbari, P.; Garssen, J.; Fink-Gremmels, J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS ONE 2015, 10, e0138975. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Scheenstra, M.R.; van Harten, R.M.; Haagsman, P.; Veldhuizen, E.J.A. The immunomodulatory effect of cathelicidin-B1 on chicken macrophages. Vet. Res. 2020, 51, 122. [Google Scholar] [CrossRef]
- Haritova, A.M.; Stanilova, S.A. Enhanced expression of IL-10 in contrast to IL-12B mRNA in poultry with experimental coccidiosis. Exp. Parasitol. 2012, 132, 378–382. [Google Scholar] [CrossRef] [PubMed]
- Forder, R.E.; Nattrass, G.S.; Geier, M.S.; Hughes, R.J.; Hynd, P.I. Quantitative analyses of genes associated with mucin synthesis of broiler chickens with induced necrotic enteritis. Poult. Sci. 2012, 91, 1335–1341. [Google Scholar] [CrossRef] [PubMed]
- Dridi, S.; Decuypere, E.; Buyse, J. Cerulenin upregulates heat shock protein-70 gene expression in chicken muscle. Poult. Sci. 2013, 92, 2745–2753. [Google Scholar] [CrossRef]
- Hu, Y.; Feng, Y.; Ding, Z.; Lv, L.; Sui, Y.; Sun, Q.; Abobaker, H.; Cai, D.; Zhao, R. Maternal betaine supplementation decreases hepatic cholesterol deposition in chicken offspring with epigenetic modulation of SREBP2 and CYP7A1 genes. Poult. Sci. 2020, 99, 3111–3120. [Google Scholar] [CrossRef]
- Galarza-Seeber, R.; Latorre, J.D.; Bielke, L.R.; Kuttappan, V.A.; Wolfenden, A.D.; Hernandez-Velasco, X.; Merino-Guzman, R.; Vicente, J.L.; Donoghue, A.; Cross, D.; et al. Leaky gut and mycotoxins: Aflatoxin B1 does not increase gut permeability in broiler chickens. Front. Vet. Sci. 2016, 3, 10. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Illustrative images of PAS-hematoxylin-stained sections of jejunum and ileum from broiler chickens fed experimental diets. Arrows indicate damage in villus tips (score 1), and arrowheads indicate extension of subepithelial space with moderate to massive lifting of villi (scores 2 and 3).
Figure 1.
Illustrative images of PAS-hematoxylin-stained sections of jejunum and ileum from broiler chickens fed experimental diets. Arrows indicate damage in villus tips (score 1), and arrowheads indicate extension of subepithelial space with moderate to massive lifting of villi (scores 2 and 3).
Figure 2.
Effect of the experimental diets on the mRNA expression of the markers of oxidative stress, inflammation, nutrient absorption, and gut integrity. * Indicates significant difference from control (p < 0.05).
Figure 2.
Effect of the experimental diets on the mRNA expression of the markers of oxidative stress, inflammation, nutrient absorption, and gut integrity. * Indicates significant difference from control (p < 0.05).
Figure 3.
Representative images of Petri films specific for E. coli and Enterobacteriaceae after 24 h in vitro culture of liver samples from broiler chickens after being fed different experimental diets for 13 or 28 days. Inserts show typical colonies of Enterobacteriaceae (regularly shaped gas colonies) and E. coli (regularly shaped blue colony with gas).
Figure 3.
Representative images of Petri films specific for E. coli and Enterobacteriaceae after 24 h in vitro culture of liver samples from broiler chickens after being fed different experimental diets for 13 or 28 days. Inserts show typical colonies of Enterobacteriaceae (regularly shaped gas colonies) and E. coli (regularly shaped blue colony with gas).
Figure 4.
Representative images of normal liver (A), liver with signs of bleeding (B), pale areas (C), combination of bleeding and pale areas (D), and pale liver (E).
Figure 4.
Representative images of normal liver (A), liver with signs of bleeding (B), pale areas (C), combination of bleeding and pale areas (D), and pale liver (E).
Table 1.
Mean BW (g), BWG (g), FI (g), FCR (g/g), and mortality rate (%) of broiler chickens fed the experimental diets.
Table 1.
Mean BW (g), BWG (g), FI (g), FCR (g/g), and mortality rate (%) of broiler chickens fed the experimental diets.
| Control | Fusarium Mycotoxins | p-Value | LSD | ||
|---|---|---|---|---|---|
| No Additive | Yeast β-Glucan | ||||
| d0-13 | |||||
| BW d13 | 382 | 385 | 389 | 0.81 | 23.2 |
| BWG (g) | 339 | 341 | 356 | 0.22 | 20.9 |
| FI (g) | 417 | 415 | 424 | 0.54 | 18.3 |
| FCR (g/g) | 1.232 | 1.218 | 1.193 | 0.49 | 0.0681 |
| Mortality (%) | 1.3 | 0.0 | 1.3 | NA | NA |
| d13-28 | |||||
| BW d28 | 1322 | 1319 | 1344 | 0.72 | 69.6 |
| BWG (g) | 928 | 937 | 955 | 0.61 | 57.2 |
| FI (g) | 1338 | 1329 | 1389 | 0.12 | 61.0 |
| FCR (g/g) | 1.442 | 1.420 | 1.455 | 0.28 | 0.0454 |
| Mortality (%) | 1.3 | 0.0 | 0.0 | NA | NA |
| d0-28 | |||||
| BWG (g) | 1279 | 1256 | 1307 | 0.28 | 64.8 |
| FI (g) | 1776 | 1751 | 1819 | 0.26 | 85.0 |
| FCR (g/g) | 1.389 | 1.394 | 1.392 | 0.97 | 0.0376 |
| Mortality (%) | 2.6 | 0.0 | 1.3 | 0.14 | 2.94 |
BW: body weight; BWG: body weight gain; FI: feed intake; FCR: feed conversion ratio; NA: not applicable.
Table 2.
Mean villus height (µm), crypt depth (µm), VH:CD (µm:µm), villus area (mm2), and damage score in the jejunum of the broiler chickens fed the experimental diets.
Table 2.
Mean villus height (µm), crypt depth (µm), VH:CD (µm:µm), villus area (mm2), and damage score in the jejunum of the broiler chickens fed the experimental diets.
| Control | Fusarium Mycotoxins | p-Value | LSD | ||
|---|---|---|---|---|---|
| No Additive | Yeast β-Glucan | ||||
| d13 | |||||
| Villus height (µm) | 826 b | 742 a | 795 ab | 0.048 | 66.3 |
| Crypt depth (µm) | 192 b | 159 a | 203 b | <0.001 | 14.1 |
| VH:CD | 4.6 | 4.2 | 4.2 | 0.38 | 0.67 |
| Villus area (mm2) | 0.13 | 0.08 | 0.12 | 0.07 | 0.040 |
| Score | 0.16 | 0.31 | 0.12 | 0.47 | 0.342 |
| d28 | |||||
| Villus height (µm) | 822 | 926 | 951 | 0.48 | 235.5 |
| Crypt depth (µm) | 238 | 231 | 229 | 0.94 | 55.5 |
| VH:CD | 3.6 a | 4.1 ab | 4.5 b | 0.02 | 0.58 |
| Villus area (mm2) | 0.16 | 0.12 | 0.14 | 0.57 | 0.080 |
| Score | 2.53 | 2.86 | 2.37 | 0.63 | 1.086 |
a,b Values without a common letter within a column differ significantly (p < 0.05).
Table 3.
Mean villus height (µm), crypt depth (µm), VH:CD (µm:µm), villus area (mm2), and damage score in the ileum of the broiler chickens fed the experimental diets.
Table 3.
Mean villus height (µm), crypt depth (µm), VH:CD (µm:µm), villus area (mm2), and damage score in the ileum of the broiler chickens fed the experimental diets.
| Control | Fusarium Mycotoxins | p-Value | LSD | ||
|---|---|---|---|---|---|
| No Additive | Yeast β-Glucan | ||||
| d13 | |||||
| Villus height (µm) | 469 | 522 | 520 | 0.13 | 58.0 |
| Crypt depth (µm) | 163 | 172 | 167 | 0.81 | 0.40 |
| VH:CD | 2.9 | 3.2 | 3.3 | 0.14 | 0.40 |
| Villus area (mm2) | 0.05 | 0.05 | 0.05 | 0.25 | 0.010 |
| Score | 1.43 | 1.52 | 1.19 | 0.16 | 0.358 |
| d28 | |||||
| Villus height (µm) | 594 | 623 | 645 | 0.70 | 125.9 |
| Crypt depth (µm) | 192 | 193 | 202 | 0.76 | 31.2 |
| VH:CD | 3.4 | 3.3 | 3.3 | 0.87 | 0.47 |
| Villus area (mm2) | 0.13 b | 0.10 a | 0.08 a | <0.001 | 0.020 |
| Score | 0.51 | 0.41 | 0.28 | 0.53 | 0.433 |
a,b Values without a common letter within a column differ significantly (p < 0.05).
Table 4.
The mean number of bacterial colonies recovered in the liver of the broiler chickens fed the experimental diets.
Table 4.
The mean number of bacterial colonies recovered in the liver of the broiler chickens fed the experimental diets.
| Control | Fusarium Mycotoxins | p-Value | LSD | ||
|---|---|---|---|---|---|
| No Additive | Yeast β-Glucan | ||||
| d13 | |||||
| Enterobacteriaceae | 2.81 | 3.11 | 3.22 | 0.97 | 4.287 |
| E. coli | 4.28 | 2.17 | 3.00 | 0.60 | 4.430 |
| d28 | |||||
| Enterobacteriaceae | 0.61 | 2.11 | 0.93 | 0.48 | 2.686 |
| E. coli | 0.28 a | 3.87 b | 2.11 ab | 0.049 | 2.802 |
a,b Values without a common letter within a column differ significantly (p < 0.05).
Table 5.
Macroscopical alterations in the liver of the broiler chickens fed the experimental diets.
| Control | Fusarium Mycotoxins | ||
|---|---|---|---|
| No Additive | Yeast β-Glucan | ||
| d13 | |||
| Blood spots | 2/18 | 10/18 | 4/18 |
| Pale areas | 1/18 | 10/18 | 1/18 |
| Pale liver | 0/18 | 3/18 | 0/18 |
| Total | 3/18 | 11/18 | 5/18 |
| d28 | |||
| Blood spots | 0/18 | 11/18 | 0/18 |
| Pale areas | 1/18 | 9/18 | 2/18 |
| Pale liver | 0/18 | 0/18 | 0/18 |
| Total | 1/18 | 11/18 | 2/18 |
Table 6.
Composition of the experimental diets.
| Starter (d0-13) | Grower (d13-28) | |
|---|---|---|
| Ingredient (%) | ||
| Maize | 45.00 | 45.00 |
| Soybean meal | 34.91 | 30.73 |
| Wheat | 13.79 | 17.39 |
| Soybean oil | 0.00 | 0.76 |
| Poultry fat | 2.79 | 3.00 |
| Salt | 0.33 | 0.24 |
| Limestone | 0.83 | 0.83 |
| Monocalcium phosphate | 1.26 | 0.89 |
| Sodium bicarbonate | 0.00 | 0.10 |
| Lysine HCl | 0.23 | 0.22 |
| DL-methionine | 0.30 | 0.27 |
| Threonine | 0.06 | 0.07 |
| Valine | 0.01 | 0.00 |
| Vitamin and mineral premix | 0.50 | 0.50 |
| Nutrients | ||
| Energy (kcal/kg) | 2900 | 3000 |
| DM, g/kg | 878 | 878 |
| Ash, g/kg | 53.99 | 47.63 |
| Crude protein, g/kg | 222 | 206 |
| Crude fat, g/kg | 57.9 | 67.1 |
| Crude fiber, g/kg | 21.9 | 21.3 |
| Ca, g/kg | 6.46 | 5.72 |
| P, g/kg | 6.46 | 5.47 |
| K, g/kg | 9.69 | 8.92 |
| Na, g/kg | 1.40 | 1.30 |
| Cl, g/kg | 3.00 | 2.43 |
Table 7.
Mycotoxin composition of the experimental diets.
| Mycotoxin (mg/kg) | Control | DON | DON + Yeast β-Glucan |
|---|---|---|---|
| d0-13 | |||
| DON | 0.136 | 3.38 | 3.64 |
| 3+15 ADON | 0.042 | 0.046 | |
| DON-3G | 0.022 | 0.550 | 0.610 |
| Nivalenol | 0.066 | ||
| Zearalenone | 0.040 | 0.440 | 0.480 |
| d13-28 | |||
| DON | 0.089 | 3.24 | 3.34 |
| 3+15 ADON | 0.065 | 0.061 | |
| DON-3G | 0.023 | 0.570 | 0.820 |
| Nivalenol | 0.108 | ||
| FB1+FB2 | 0.077 | 0.113 | |
| Zearalenone | 0.540 | 0.600 |
Table 8.
Primers used for the quantification of gene of interest (GOI) and housekeeping gene (HKG) expression.
Table 8.
Primers used for the quantification of gene of interest (GOI) and housekeeping gene (HKG) expression.
| Genes | Primer Sequence | Annealing T° | Role | Reference |
|---|---|---|---|---|
| HKG | ||||
| HPRT | F:CGTTGCTGTCTCTACTTAAGCAG R:GATATCCCACACTTCGAGGAG | 65 | - | [46] |
| ACTB | F:ATGTGGATCAGCAAGCAGGAGTA R:TTTATGCGCATTTATGGGTTTTGT | 61 | - | [48] |
| GOI | ||||
| Jejunum and liver | ||||
| HMOX | F:CTTGGCACAAGGAGTGTTAAC R:CATCCTGCTTGTCCTCTCAC | 63 | Oxidative stress | [46] |
| iNOS | F:GGACAAGGGCCATTGCACCA R:TCCATCAGCGCTGCGCACAA | 61 | Oxidative stress | [36] |
| XOR | F:GTGTCGGTGTACAGGATACAGAC R:CCTTACTATGACAGCATCCAGTG | 61 | Oxidative stress | [46] |
| IFNg | F:CAAGCTCCCGATGAACGAC R:GCAATTGCATCTCCTCTGAGAC | 64 | Inflammation | [36] |
| IL-6 | F:GCTCGCCGGCTTCGA R:GGTAGGTCTGAAAGGCGAACAG | 59 | Inflammation | [48] |
| IL-8 | F:CACGTTCAGCGATTGAACTC R:GACTTCCACATTCTTGCAGTG | 64 | Inflammation | [36] |
| IL-10 | F:CATGCTGCTGGGCCTGAA R:CGTCTCCTTGATCTGCTTGATG | 60 | Inflammation | [49] |
| IL-12 | F:TCAAGGAGATGTAACCTGCAG R:CTTCGGCAAATGGACAGTAG | 60 | Inflammation | [50] |
| LEAP2 | F:CTCAGCCAGGTGTACTGTGCTT R:CGTCATCCGCTTCAGTCTCA | 65 | Metabolism | [36] |
| GLUT | F:TTGCTGGCTTTGGGTTGTG R:GGAGGTTGAGGGCCAAAGTC | 57 | Nutrient transporters | [48] |
| PEPT1 | F:CCCCTGAGGAGGATCACTGTT R:CAAAAGAGCAGCAGCAACGA | 59 | Nutrient transporters | [46] |
| CLDN1 | F:CTGATTGCTTCCAACCAG R:CAGGTCAAACAGAGGTACAAG | 58 | Tight junctions | [46] |
| CLDN5 | F:CATCACTTCTCCTTCGTCAGC R:GCACAAAGATCTCCCAGGTC | 58 | Tight junctions | [46] |
| MUC-2 | F:ATGCGATGTTAACACAGGACTC R:GTGGAGCACAGCAGACTTTG | 61 | Intestinal damage | [51] |
| VIL-1 | F:GGCACCAACGAGTACAACACCA R:CAATTGCATCTCCTCTGAGAC | 61 | Intestinal damage | [48] |
| Liver | ||||
| CPT-1 | F:AAGGGTACAGCAAAGAAGATCCA R:CCACAGGTGTCCAACAATAGGAG | 61 | Metabolism | [52] |
| HMGCR | F:TTGGATAGAGGGAAGAGGGAAG R:CTCGTAGTTGTATTCGGTAA | 61 | Metabolism | [53] |
| SREBP2 | F:CCCAGAACAGCAAGCAAGG R:GCGAGGACAGGAAAGAGAGTG | 61 | Metabolism | [53] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Marquis, V.; Schulthess, J.; Molist, F.; Santos, R.R. Effect of a Yeast β-Glucan on the Performance, Intestinal Integrity, and Liver Function of Broiler Chickens Fed a Diet Naturally Contaminated with Fusarium Mycotoxins. Toxins 2025, 17, 51. https://doi.org/10.3390/toxins17020051
AMA Style
Marquis V, Schulthess J, Molist F, Santos RR. Effect of a Yeast β-Glucan on the Performance, Intestinal Integrity, and Liver Function of Broiler Chickens Fed a Diet Naturally Contaminated with Fusarium Mycotoxins. Toxins. 2025; 17(2):51. https://doi.org/10.3390/toxins17020051
Chicago/Turabian StyleMarquis, Virginie, Julie Schulthess, Francesc Molist, and Regiane R. Santos. 2025. "Effect of a Yeast β-Glucan on the Performance, Intestinal Integrity, and Liver Function of Broiler Chickens Fed a Diet Naturally Contaminated with Fusarium Mycotoxins" Toxins 17, no. 2: 51. https://doi.org/10.3390/toxins17020051
APA StyleMarquis, V., Schulthess, J., Molist, F., & Santos, R. R. (2025). Effect of a Yeast β-Glucan on the Performance, Intestinal Integrity, and Liver Function of Broiler Chickens Fed a Diet Naturally Contaminated with Fusarium Mycotoxins. Toxins, 17(2), 51. https://doi.org/10.3390/toxins17020051
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
