Next Article in Journal
Indoor Radon Concentration and Risk Assessment in 27 Districts of a Public Healthcare Company in Naples, South Italy
Next Article in Special Issue
Sorghum’s Whole-Plant Transcriptome and Proteome Responses to Drought Stress: A Review
Previous Article in Journal
Effects of Schlemm’s Canal Expansion: Biomechanics and MIGS Implications
Previous Article in Special Issue
Arabidopsis Plant Natriuretic Peptide Is a Novel Interactor of Rubisco Activase
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 11
Issue 2
10.3390/life11020177
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Proteomic Insight into the Symbiotic Relationship of Pinus massoniana Lamb and Suillus luteus towards Developing Al-Stress Resistance

by
Haiyan Liu
1,2,
Houying Chen
1,
Guijie Ding
1,*,
Kuaifen Li
1 and
Yao Wang
2
1
Institute for Forest Resources & Environment of Guizhou, Guiyang 550025, China
2
Guizhou Botanical Garden, Guiyang 550004, China
*
Author to whom correspondence should be addressed.
Life 2021, 11(2), 177; https://doi.org/10.3390/life11020177
Submission received: 12 January 2021 / Revised: 18 February 2021 / Accepted: 20 February 2021 / Published: 23 February 2021
(This article belongs to the Special Issue Plant Proteomics)
Browse Figures
Versions Notes

Abstract

:
Global warming significantly impacts forest range areas by increasing soil acidification or aluminum toxicity. Aluminum (Al) toxicity retards plant growth by inhibiting the root development process, hindering water uptake, and limiting the bioavailability of other essential micronutrients. Pinus massoniana (masson pine), globally recognized as a reforestation plant, is resistant to stress conditions including biotic and abiotic stresses. This resistance is linked to the symbiotic relationship with diverse ectomycorrhizal fungal species. In the present study, we investigated the genetic regulators as expressed proteins, conferring a symbiotic relationship between Al-stress resistance and Suillus luteus in masson pine. Multi-treatment trials resulted in the identification of 12 core Al-stress responsive proteins conserved between Al stress conditions with or without S. luteus inoculation. These proteins are involved in chaperonin CPN60-2, protein refolding and ATP-binding, Cu-Zn-superoxide dismutase precursor, oxidation-reduction process, and metal ion binding, phosphoglycerate kinase 1, glycolytic process, and metabolic process. Furthermore, 198 Al responsive proteins were identified specifically under S. luteus-inoculation and are involved in gene regulation, metabolic process, oxidation-reduction process, hydrolase activity, and peptide activity. Chlorophyll a-b binding protein, endoglucanase, putative spermidine synthase, NADH dehydrogenase, and glutathione-S-transferase were found with a significant positive expression under a combined Al and S. luteus treatment, further supported by the up-regulation of their corresponding genes. This study provides a theoretical foundation for exploiting the regulatory role of ectomycorrhizal inoculation and associated genetic changes in resistance against Al stress in masson pine.

1. Introduction

Pinus massoniana Lamb., also known as masson pine, is native to South China and a pioneer species in the forest chain dominating the subtropical areas of East Asia [1]. Salient features, including resistance to environmental stress, ability to grow in marginal soils, and tolerance to metal contaminated soils, have enabled this species to be highly used for afforestation and reforestation in China [2,3]. P. massoniana accounts for 7.74% of the total arborical forest zone in China [4]. Masson pine has been widely adopted for its timber and pulp due to the fast-growing habit and the high yield advantages [5]. Besides its economic importance, the afforestation of this species has potentially contributed to improve the ecosystem productivity and carbon sequestration [1].
Pinus spp. have been widely used in different reforestation programs worldwide [6]. Their dependency on symbiosis, hosting a wide range of ectomycorrhizal fungal species [7,8,9], is advantageous for their optimal growth and development under various natural environmental conditions [10]. The symbiotic effect of ectomycorrhizal fungi is well known for improving the growth of the host plants [9] with enhanced tolerance towards environmental stresses [11,12,13,14]. Studies have shown that Pinus species inoculated with ectomycorrhizal fungi display improved photosynthesis, water uptake, nutrient utilization, and immune system [11,12].
The continuous decline in forest population is mainly attributed to soil acidification, resulting from air pollution and intensive fertilizer applications. Moreover, nutrient depletion coupled with an accumulation of toxic elements also causes adverse effects on the forest population. The acidification of soils associated to an increased level of Aluminum (Al), causes a substantial reduction in plant growth by inhibiting root development [15,16], water uptake [17,18], and translocation of nutrients [19,20]. A controlled inoculation of ectomycorrhizal fungi is a useful approach for enhancing the performance of out-planted seedlings [7,21]. Previous reports showed enhanced fitness in different Pinus species against toxic concentrations of heavy metals under mycorrhizal fungus inoculation [22,23,24,25,26]. Suillus luteus, an ectomycorrhizal fungus, is considered a symbiotic solution for heavy-metal toxicities, including Al3+ stress [27,28,29,30]. Another study described the positive growth regulation of P. massoniana under the inoculation of the mycorrhizal fungus, Pisolithus tinctorius [31].
Morphophysiological changes and cellular responses under Al-stress conditions are ascribed to the gene expression and cellular metabolism. Previous reports for Al stress resistance in different plants identified multiple pathways including, membrane transporters, oxidative stress pathways, primary metabolism, cell wall synthesis, and protein metabolism [32,33,34,35,36,37,38,39,40,41,42,43]. However, the genetic pathways for induced Al stress tolerance in P. massoniana are not well documented. In particular, clarifying the contribution of ectomycorrhizal fungi in P. massoniana resistance to abiotic stresses has been the focus of recent studies [44,45]
The goal of this study was to identify the key proteins underlying the alleviated Al toxicity in P. massoniana under ectomycorrhizal fungi inoculation. We employed a comparative proteomics approach to probe the symbiotic relationship of S. luteus and P. massoniana seedlings in response to Al toxicity. This study provides insight into the proteome variations induced by ectomycorrhizal fungi under Al toxicity in P. massoniana.

2. Materials and Methods

2.1. Plant Material and Ectomycorrhizal Fungus

The investigated tree species in this study was P. massoniana. The seeds were collected from the tree Huang 12 located in Duyun City, Guizhou Province, China. The ectomycorrhizal fungus species Suillus luteus (SL) was used for plant inoculation. The fruiting body was collected from the pine forest of Longli Forest Farm, Longli County, Guiyang City, Guizhou Province. The inoculum was prepared, followed by inoculation, according to the methods described by Yu et al. [44]. The seedlings inoculated with S. luteus were selected after six months of germination, and the control plants were kept without inoculation of SL.
The research was conducted in a greenhouse with a sand culture and parameters (light intensity of 600–800 μmol m−2s−1, relative humidity of 55%, photoperiod of 16 h, 25 °C, and 18 °C in the dark) were kept constant during the growth period. For sand culture, quartz-sand purchased from Kasper Building Materials Company (Potter, WI, USA) was used. Thoroughly rinsed quartz-sand was sterilized and then filled into nutrition bowls. Selected seedlings with consistent growth were transplanted into pots. Al stress treatment was applied to the selected seedlings after normal growth for two weeks [45].

2.2. Collection, Separation, and Purification of Suillus Luteus

The fruit-bodies of S. luteus were searched in the masson pine forest by trampling. The collected fruit-bodies were cleaned to get rid of any surface contamination. The cleaned fruit-bodies were individually numbered and placed in a Ziplock bag, placed in an icebox, and brought back to the laboratory. Young and tender fruit-bodies were selected for further experiment. Separation work was carried out on an ultra-clean workbench. The surface of the fruit-bodies was disinfected with 75% alcohol and rinse twice with sterile water. The fruit-bodies were then transferred to Pachlewski medium and placed in an incubator for dark culture at 25 °C with a 50% humidity level. Hyphae were collected after appearance and cultured in a new medium until the strain was purified [46]. To confirm the purity, mycelium was collected from the outer surface and transferred to the Pachlewski medium. Active mycelium was collected and transferred from the solid cultured colony to the Pachlewski medium and observed for ten days of cultivation. The samples with no contamination were stored in the refrigerator at 4 °C for later use [47].

2.3. Identification of Suillus Luteus Strain

The purified fungus was inoculated in Pachlewski medium and cultivated for 15 days. According to Fan Yongjun’s method, DNA extraction was performed, followed by PCR-based amplification. The amplified DNA was sequenced, and the ITS sequence was cut and uploaded to NCBI, and the Blastn comparison was performed in the NCBI database. The fungal strain was confirmed with 99% similarity, as formerly elaborated by Du et al. [48] and Feng et al. [49].

2.4. Stress Treatments

The test set included 4 treatments, namely 2 inoculated LB-0 (Al3+, 0 mmol L−1), LB-04 (Al3+, 0.4 mmol L−1) and two non-inoculated treatments CK-0 (Al3+, 0 mmol L−1), CK-04 (Al3+, 0.4 mmol L−1. AlCl3 (Tianjin Komiou Chemical Reagent Co., Ltd.) was added to Hoagland solution (complete nutrient solution), and pH of the Hoagland solution was adjusted to 4.1 ± 0.1 by adding 0.1 M diluted HCl or NaOH. The nutrient composition of Hoagland solution was as 5 mmol L−1 KNO3, 4.5 mmol L−1 Ca(NO3)·4H2O, 2 mmol L−1 MgSO4·7H2O, 1 mmol L−1 KH2PO4, and 25 μmol L−1 Fe-Na EDTA [50]. To maintain the quality, the treatment solution was changed after a week interval. Al activity was maintained by adding CaCl2 solution purchased from Xilong Chemical Co., Ltd., into the nutrient solution, a standard treatment acting as a buffer to avoid possible interface between Al ions and solution ions [51]. Due to the unstable Al ions, the high concentration of phosphorus in the nutrient solution can cause a reaction with Al ions and reduce the actual Al concentration of the treatment. Hence, after adding a low concentration of CaCl2, Ca2+ can preempt the binding site of Al3+, which ensures the target Al3+ concentration [52,53]. The proteome was determined from the needle samples collected 60 days after Al treatment.

2.5. Protein Extraction

The needles and samples of the same parts of P. massoniana seedlings with different treatments were selected for protein extraction by utilizing the phenol extraction method [54]. Tissue samples of pinus needles (stored at −80 °C before use) were weighed and ground into a fine powder. Phenol extraction buffer was added to the powdered samples, followed by sonication. The samples were centrifuged at 5500xg for ten minutes after adding Tris-balanced phenol. After centrifugation, methanol was added to supernatant and kept overnight. 8M urea was added to the overnight-kept samples to reconstitute the pallet. Later, protein concentration was estimated for each sample with a Bio-Rad protein assay kit (BCA kit, Bio-Rad, Hercules, CA, USA).

2.6. LC-MS/MS Analysis

To perform Liquid Chromatography with tandem mass spectrometry, HPLC was used to fractionate the tryptic peptides before mass spectrometry analysis. The parameters used for the step gradient were set to acetonitrile (pH 9.0); 8–32%. Later, we combined the peptides, followed by freeze-drying in a vacuum chamber. EASY-nLC 1200 UPLC system (Thermo Fisher Scientific, Waltham, MA, USA) was employed to separate dissolved peptides. The liquid phase gradient was set to B (Methanole %); 9–25% for 30 min; 25–35% for 22 min; 35–80% for 4 min; 80% for 4 min, while the flow rate was kept constant at 350 nL/min. Orbitrap Fusion LUMOS platform was utilized to perform Tandem mass spectrometry (MS/MS) with standard mass spectrometry parameters.
The MS raw data for each sample were searched using the MASCOT engine (Matrix Science, London, UK; version 2.2) embedded into Proteome Discoverer 1.4 software for the identification and quantitation analysis. Peak lists were searched against Green Plants (Viridiplantae) database in Oligo 7 using the following parameters: enzyme, trypsin; maximum missed cleavage, 2; fixed modification, carbamidomethylating (C); variable modification, oxidation (M) and TMT (protein N-terminus and K); mass tolerance at 20 ppm; MS/MS mass tolerance at 0.1 Da; false discovery rate (FDR) < 0.01. Significance was assessed by ratios of TMT reporter ion intensities in the MS/MS spectra.

2.7. Functional Classification of Proteins

The proteins were annotated to Gene Ontology (GO) using blast2go (https://www.blast2go.com (accessed on 12 January 2021)). Protein IDs were transformed to UniProt IDs to match the corresponding GO IDs, and the relative information was obtained. IDs with no information from UniProt were subjected to InterProScan to obtain predicted GO functions of the proteins. Fisher’s exact two-terminal test with a significance threshold of p  <  0.05 was used to test the proteins.

2.8. Protein Quantification and Differential Expressed Protein Analysis

For protein quantification, the proteins containing at least two unique peptides were enumerated for all labeled samples. The quantifiable proteins were listed first, and the abundance ratio (treated/control) was log2 transformed. The differentially expressed proteins (DEPs) between treatments were identified with fold change > 1.2 and p < 0.05, FDR < 0.01.

2.9. Expression Profile of Related Genes based on qRT-PCR

Expression profiles of genes governing differentially expressed proteins were estimated using Real-Time Quantitative Reverse Transcription PCR (qRT-PCR). Genes related to Al-responsive proteins were identified and selected, and specific primers for qRT-PCR, corresponding to the identified genes, were designed using Oligo 7 software (https://www.oligo.net/ (accessed on 12 January 2021)) (Table 1) before qRT-PCR. The primers of 9 selected genes were synthesized by Sangon Biotech (Shanghai, China). RNA was extracted from masson pine needles using Tiangen RNAprep Pure Plant kit (Tiangen Biotech, Beijing, China). A list of primers for the nine genes is presented in Table 1. The 2−△△Ct method was used to calculate the relative expression levels [55].

3. Results

3.1. Overview of the Proteome Profiling in Masson Pine Needle Samples

Proteome profiling resulted in 79,046 spectra, 18,737 peptides, 16,670 unique peptides, and 4312 proteins being identified in masson pine. The detailed information on mass spectrometry collection and identification are shown in Table S1. Most of the peptides were comprised of 7–20 amino acids, which is within the ranges of proteome quality requirements [54] (Figure S1).

3.2. Differentially Expressed Proteins Analysis and Functional Annotations

The differentially-expressed proteins (DEPs) were screened by a standard screening criterion [54]: fold change > 1.2-fold (up-regulated by more than 1.2-fold or down-regulated by less than 0.83-fold) and p-value < 0.05. The comparison of CK-04 vs. CK-0 group (effect of Al stress on masson pine seedlings without inoculation) showed 215 DEPs, including 137 up-regulated and 78 down-regulated proteins in CK-04 (Table S2). These DEPs were subjected to a gene ontology (GO) enrichment analysis. The GO enrichment (Figure 1a) showed that these DEPs were mainly involved in small molecule metabolic process, catalytic activity, and ion binding. The functions of these proteins were identified as catalytic activity, binding, structural molecule activity, transporter activity, and antioxidant activity.
Under Al-stress condition, the comparison of LB-04 vs. CK-04 groups (combined effects of Al stress and S. luteus inoculation on masson pine seedlings) showed 96 DEPs with 50 up-regulated and 46 down-regulated proteins in LB-04 (Table S3). GO annotation (Figure 1b) for these DEPs revealed that the proteins were associated with response to an organic substance, response to abiotic stimulus, and unfolded protein binding.
Similarly, when comparing LB-04 vs. LB-0 groups (effect of Al stress on S. luteus-inoculated masson pine seedlings), we identified 210 DEPs, including 82 up-regulated and 128 down-regulated proteins in LB-04 (Table S4). GO annotations (Figure 1c) identified the main functions of these DEPs as metabolic process, organic substance metabolic process, cellular metabolic process, and primary metabolic process. These DEPs were involved in response to a stimulus, cellular component organization or biology, and localization.

3.3. Identification and Analysis of the Core Al Responsive Proteins

The core Al responsive proteins were identified by comparing DEPs between Al stress and control conditions, independently of SL-inoculation. These comparisons include LB-04 vs. LB-0 and CK-04 vs. CK-0. Venn diagram analysis revealed only 12 conserved DEPs among the two groups (Figure 2 and Table S5). This indicates that the DEPs in LB-04 vs. LB-0 group were different from CK-04 vs. CK-0 group, depicting a differential pattern of expression under the inoculation of S. luteus.
Among the core Al responsive proteins, three proteins, TRINITY_DN51434_c0_g1; chaperonin CPN60-2, TRINITY_DN52787_c0_g1; phosphoglycerate kinase 1, and TRINITY-DN50533-c0-g8; unknown protein, were up-regulated under CK-04 vs. CK-0, while their expression was down-regulated in LB-04 vs. LB-0. The other proteins showed a similar regulation pattern in both groups, demonstrating the conserved roles of these proteins under Al-stress conditions independently of SL inoculation.

3.4. Identification and Analysis of Specific Proteins involved in Al Response under S. luteus Inoculation in Masson Pine Seedlings

The main goal of this study was to understand how S. luteus helps masson pine seedlings to tolerate Al stress. So, the specific DEPs identified in LB-04 vs. LB-0 are crucial components of this mechanism. In total, we identified 198 DEPs specific to LB-04 vs. LB-0 group (Table S4). Among these 198 proteins, 79 proteins were up-regulated, and 119 proteins showed a down-regulated expression pattern in LB-04 group. A total of 136 proteins were unknown function, providing interesting novel protein resources to further investigate Al-stress response in plants. The major GO terms associated with these proteins were: biological process (gene regulation, metabolic process, oxidation and reduction process, binding process, and response to oxidative stress), molecular functions (hydrolyze activity, peptide activity, catalytic activity, and binding), and cellular components (cytosol, membrane, plastids, mitochondrion, and chloroplast).
Among the 62 proteins with known functions, 43 proteins were up-regulated, while the remaining 19 proteins showed down-regulation in LB-04 (Table S4). We further explored the known DEPs for their associated functions and GO terms and identified 17 proteins potentially associated with response to stress-induced conditions. These differential proteins were identified as chlorophyll a-b binding protein (TRINITY_DN46586_c4_g5), endoglucanase (TRINITY_DN51146_c0_g2), putative spermidine synthase (TRINITY_DN44650_c0_g1), NADH dehydrogenase (TRINITY_DN48436_c0_g5), glutathione-S-transferase (TRINITY_DN47449_c0_g1), LRR receptor-like protein kinase (TRINITY_DN41128_c0_g2), aspartic proteinase (TRINITY_DN40732_c0_g1), soluble starch synthase 1 (TRINITY_DN43704_c3_g3), T-complex protein 1 (TRINITY_DN42434_c0_g1 and TRINITY_DN42941_c2_g2), purple acid phosphatase 1 (TRINITY_DN52089_c0_g2), NHL repeat (TRINITY_DN47063_c0_g1), glyceraldehyde-3-phosphate dehydrogenase (TRINITY_DN50857_c0_g6), SCF ubiquitin ligase (TRINITY_DN43846_c0_g1), ankyrin repeat domain-containing protein 2B (TRINITY_DN44530_c4_g9), HYL1 (TRINITY_DN38298_c0_g1), and AMP-dependent synthetase (TRINITY_DN43346_c0_g2). Identification of diverse proteins as DEPs suggests that SL-inoculation facilitates the regulation of an array of biological and molecular functions to enable masson pine to tolerate the induced Al stress.
Next, the corresponding genes of some up-regulated proteins were identified, and their expression profiles were compared between LB-04 and LB-0 (Figure 3). All assayed genes were up-regulated under LB-04, supporting the expression pattern of their related proteins. In particular, the genes governing putative spermidine synthase (TRINITY_DN44650_c0_g1) and chlorophyll a-b binding protein (TRINITY_DN46586_c4_g5) proteins showed significantly higher expression in LB-04 than LB-0. These results emphasize that the identified genes and their corresponding proteins have a positive regulatory role in Al stress response when masson pine is inoculated with S. luteus.

4. Discussion

Soil acidification with an increased Aluminum (Al) toxicity level is a major reason for forest dieback [15,16]. Based on previous reports, there are two main mechanisms, viz. the exclusion mechanism and tolerance mechanism, proposed for Al stress resistance in plants. The exclusion mechanism mainly minimizes the occurrence of harmful interaction in the apoplast by hindering the entry of Al into the cytosol [56]. The symbiotic role of ectomycorrhizal fungi in Pinus species is also well known to naturally cope with the different biotic and abiotic stresses and increase immune response towards Al toxicity [5,44,57,58,59,60]. S. luteus, an ectomycorrhizal fungus, is well-known for its growth habit in adverse soil conditions, i.e., saline soils, drought, and metal toxicity [27,44,61,62,63,64,65]. S. luteus has been previously described to actively stimulate resistance towards high concentrations of Al by facilitating plant growth through reduced reactive oxygen species and accumulation of antioxidants [66,67,68,69,70,71]. This study aimed at uncovering the role of S. luteus in developing resistance towards Al toxicity in P. massoniana at the proteome level.
As a result of differential expression analysis, we identified 12 core Al responsive proteins viz. chaperonin CPN60-2, Cu-Zn-superoxide dismutase precursor, drought response protein, phosphoglycerate kinase 1, and 8 unknown proteins. Abiotic stress causes enhanced protein misfolding. However, chaperones are reputed for their function in assisting protein folding under stress conditions [72,73,74]. Efficient protein repair systems and protein stability enable organisms to survive in stress conditions [75]. A study by Aremu et al. [76] described the substantial effects of chaperons on protein folding, as an adaptive strategy under Al stress. Thus, we speculated that chaperonin CPN60-2 is an important Al-responsive protein in masson pine. Another core Al-responsive protein, phosphoglycerate kinase-1, has been reported with its significant impact on plant and regulation of metabolic processes under different abiotic stress conditions [77,78]. Furthermore, Cu-Zn-superoxide dismutase precursor (CSD) gene is regulated under oxidative stress conditions [79,80] due to the downregulation of miRNA. CSD protein was up-regulated under induced Al stress conditions in this study. The antioxidant system controls oxidative cellular damage under abiotic stress conditions, specifically under Al-stress conditions [81]. Many studies have emphasized the positive regulation of oxidative stress by Al-induced genes in different plants [81,82,83,84].
Proteomics insights into induced Al stress under SL-inoculation identified 198 specific differentially expressed proteins (DEPs). GO term classified these proteins as BP: response to stress stimulus, polyamine metabolic process, cellulose catabolic process, MF: metal ion binding, chlorophyll-binding, metabolic process, and hydrolase activity, CC: photosystem I & II, and integral component of membrane. In Plants, the first steps of tolerance under stress conditions are the ability to promptly sense the stress and trigger appropriate biological responses [85]. Furthermore, stress signals and intercellular communication are vital to withstand the stress and activate the stress-related genes [85,86]. The identified DEPs include some well-known abiotic stress-responsive proteins such as chlorophyll a-b binding protein, laccase, endoglucanase, and spermidine synthase [87,88,89,90]. Differential regulation of chlorophyll a-b binding protein (TRINITY_DN46586_c4_g5) under LB-04 vs. LB-0 suggests its significant role in developing resistance in SL-inoculated Pinus against Al stress. Another protein, endoglucanase (TRINITY_DN51146_c0_g2), was also up-regulated under LB-04 vs. LB-0. Endoglucanase promotes cell wall development via carbohydrate binding and cellulase activity [91,92]. Remodeling of the cell wall in response to stress has been extensively studied [93,94,95,96]. The cell wall provides structural integrity, supports cell division and acts as the first defense line against stressful conditions such as Al stress [97,98]. Putative spermidine synthase protein was also identified as specific DEPs in LB-04 vs. LB0. Sang et al. [99] reported a positive effect of exogenous spermidine in tomato seedlings under abiotic stress conditions. Another report by Chen et al. [100] also suggested the involvement of spermidine in the tolerance towards abiotic stress conditions. Furthermore, NADH dehydrogenase [101,102], glutathione-S-transferase [103,104], LRR receptor-like protein kinase [105], aspartic proteinase [106,107], soluble starch synthase 1 [108,109], T-complex protein [73], purple acid phosphatase 1 [110,111], NHL repeat [112], glyceraldehyde-3-phosphate dehydrogenase [113,114], SCF ubiquitin ligase [115], ankyrin repeat domain-containing protein 2B [116], and HYL1 [117] were also identified as specific DEPs in response to Al stress under SL-inoculation in this study. These proteins have been reported for their direct or indirect regulatory roles in plant responses towards biotic and abiotic stress conditions, including Al stress. Interestingly, the expression of some of the DEPs identified in this study (i.e., chlorophyll a-b binding protein, glucanase, purple acid phosphatase) has been found regulated by methyl-jasmonate treatment in rice [118]. Likewise, Wang et al. [119] described jasmonate and aluminum crosstalk in tomato. Hence, Al sensing under S. luteus inoculation in masson pine might induce the activation of JA pathway. Further study is required to understand the relationship between Al stress and jasmonic acid pathways under SL inoculation in masson pine.
The up-regulation of several DEPs emphasized a network of regulatory processes to cope with the Al stress in SL-inoculated masson pine. Furthermore, the expression patterns of genes governing some of the above-mentioned proteins also confirmed the positive regulatory roles of these proteins. Our results are consistent with the various studies reporting the involvement of these genes in abiotic stress responses conditions in different plants [120,121,122,123,124,125,126]. However, we also identified several proteins, including ABI3-interacting protein 2, Tyrosine-tRNA ligase, water deficit stress-inducible protein LP3-2, serine/threonine-protein phosphatase 5, tripeptidyl-peptidase 2 isoform X1, and xyloglucan endotrans- glucosylase/hydrolase 1, which were down-regulated in LB-04 vs. LB-0. In contrast to our results, previous reports showed elevated expression of these proteins under abiotic stress conditions [17,127,128,129,130,131]. We suspect that a down-regulation of these proteins might be attributed to SL-inoculation.

5. Conclusions

We reported the proteomic profile changes in P. massoniana attributed to Al stress and examined the effect of S. luteus. As a result, we identified 12 core Al responsive proteins differentially expressed between different sets of treatments. Furthermore, we identified 198 specific proteins differentially expressed under SL-inoculated Al stress conditions. Further molecular characterizations of these proteins and their corresponding genes can provide deeper insights into the mechanisms underlying Al-stress resistance in P. massoniana under S. luteus inoculation.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-1729/11/2/177/s1, Figure S1: Proteome profiling of masson pine (a) Protein sequence coverage distribution (b) Peptide Ion score distribution (c) Protein ratio distribution for CK-04 vs. CK-0 (d) Protein ratio distribution for LB-04 vs. LB-0, Table S1: List of identified proteins and their quantification, Table S2: Differential protein expressed in CK-04 Vs CK-0 with corresponding GO annotations, Table S3: Differential protein expressed in LB-04 Vs CK-04 with corresponding GO annotations, Table S4: Differential protein expressed in LB-04 Vs LB-0 with corresponding GO annotations and KEGG pathways, Table S5: Differentially expressed proteins (DEPs) conserved between CK-04 vs. CK-0 and LB-04 vs. LB-0.

Author Contributions

Conceptualization, H.L. and G.D. Methodology H.L., H.C., K.L. and Y.W. conducted the experiment and data analysis. Validation, H.L. Original draft preparation, H.L. Funding acquisition, Y.W. supervision, G.D. Writing—review and editing, G.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Key Research and Development Program of China (No. 2017YFD06003002); the Science and Technology Foundation of Guizhou Province ([2016]1144).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org, accessed on 12 January 2021) via the iProX partner repository with the dataset identifier PXD023856.

Acknowledgments

Thanks to Shanghai Applied Protein Technology Co., Ltd. for the Proteomics analysis.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, L.-C.; Liang, M.-J.; Wang, S.-L. Carbon stock density in planted versus natural Pinus massoniana forests in sub-tropical China. Ann. For. Sci. 2016, 73, 461–472. [Google Scholar] [CrossRef] [Green Version]
  2. Dou, X.; Deng, Q.; Li, M.; Wang, W.; Zhang, Q.; Cheng, X. Reforestation of Pinus massoniana alters soil organic carbon and nitrogen dynamics in eroded soil in south China. Ecol. Eng. 2013, 52, 154–160. [Google Scholar] [CrossRef]
  3. Yi, W.; Guijie, D. Physiological responses of mycorrhizal Pinus massoniana seedlings to drought stress and drought resistance evaluation. Yingyong Shengtai Xuebao 2013, 24, 639–645. [Google Scholar]
  4. Meng, J.; Lu, Y.; Zeng, J. Transformation of a degraded Pinus massoniana plantation into a mixed-species irregular forest: Impacts on stand structure and growth in southern China. Forests 2014, 5, 3199–3221. [Google Scholar] [CrossRef]
  5. Zhang, T.; Wen, X.-P.; Ding, G.-J. Ectomycorrhizal symbiosis enhances tolerance to low phosphorous through expression of phosphate transporter genes in masson pine (Pinus massoniana). Acta Physiol. Plant. 2017, 39, 101. [Google Scholar] [CrossRef]
  6. Laganiere, J.; Angers, D.A.; Pare, D. Carbon accumulation in agricultural soils after afforestation: A meta-analysis. Glob. Chang. Biol. 2010, 16, 439–453. [Google Scholar] [CrossRef]
  7. Rincón, A.; Alvarez, I.F.; Pera, J. Inoculation of containerized Pinus pinea L. seedlings with seven ectomycorrhizal fungi. Mycorrhiza 2001, 11, 265–271. [Google Scholar] [CrossRef]
  8. Parladé, J.; Pera, J.; Alvarez, I.F. Inoculation of containerized Pseudotsuga menziesii and Pinus pinaster seedlings with spores of five species of ectomycorrhizal fungi. Mycorrhiza 1996, 6, 237–245. [Google Scholar] [CrossRef]
  9. Lu, N.; Yu, M.; Cui, M.; Luo, Z.; Feng, Y.; Cao, S.; Sun, Y.; Li, Y. Effects of different ectomycorrhizal fungal inoculates on the growth of Pinus tabulaeformis seedlings under greenhouse conditions. Forests 2016, 7, 316. [Google Scholar] [CrossRef] [Green Version]
  10. Rincón, A.; Álvarez, I.F.; Pera, J. Ectomycorrhizal fungi of Pinus pinea L. in northeastern Spain. Mycorrhiza 1999, 8, 271–276. [Google Scholar] [CrossRef]
  11. Luo, Z.-B.; Janz, D.; Jiang, X.; Goebel, C.; Wildhagen, H.; Tan, Y.; Rennenberg, H.; Feussner, I.; Polle, A. Upgrading root physiology for stress tolerance by ectomycorrhizas: Insights from metabolite and transcriptional profiling into reprogramming for stress anticipation. Plant Physiol. 2009, 151, 1902–1917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Hao, Z.; Xie, W.; Chen, B. Arbuscular mycorrhizal symbiosis affects plant immunity to viral infection and accumulation. Viruses 2019, 11, 534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Lehto, T.; Zwiazek, J.J. Ectomycorrhizas and water relations of trees: A review. Mycorrhiza 2011, 21, 71–90. [Google Scholar] [CrossRef]
  14. Kohler, J.; Hernández, J.A.; Caravaca, F.; Roldán, A. Induction of antioxidant enzymes is involved in the greater effectiveness of a PGPR versus AM fungi with respect to increasing the tolerance of lettuce to severe salt stress. Environ. Exp. Bot. 2009, 65, 245–252. [Google Scholar] [CrossRef]
  15. Magalhaes, J.V. Aluminum tolerance genes are conserved between monocots and dicots. Proc. Natl. Acad. Sci. USA 2006, 103, 9749–9750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Valle, S.R.; Carrasco, J.; Pinochet, D.; Calderini, D.F. Grain yield, above-ground and root biomass of Al-tolerant and Al-sensitive wheat cultivars under different soil aluminum concentrations at field conditions. Plant Soil 2009, 318, 299–310. [Google Scholar] [CrossRef]
  17. Duressa, D.; Soliman, K.; Taylor, R.; Senwo, Z. Proteomic analysis of soybean roots under aluminum stress. Int. J. Plant Genom. 2011, 2011. [Google Scholar] [CrossRef] [Green Version]
  18. Rout, G.; Samantaray, S.; Das, P. Aluminium toxicity in plants: A review. Agronomie 2001, 21, 3–21. [Google Scholar] [CrossRef]
  19. Roy, A.K.; Sharma, A.; Talukder, G. Some aspects of aluminum toxicity in plants. Bot. Rev. 1988, 54, 145–178. [Google Scholar] [CrossRef]
  20. Godbold, D.; Fritz, E.; Hüttermann, A. Aluminum toxicity and forest decline. Proc. Natl. Acad. Sci. USA 1988, 85, 3888–3892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Sousa, N.R.; Franco, A.R.; Oliveira, R.S.; Castro, P.M. Ectomycorrhizal fungi as an alternative to the use of chemical fertilisers in nursery production of Pinus pinaster. J. Environ. Manag. 2012, 95, S269–S274. [Google Scholar] [CrossRef]
  22. Dixon, R.; Buschena, C. Response of ectomycorrhizal Pinus banksiana and Picea glauca to heavy metals in soil. Plant Soil 1988, 105, 265–271. [Google Scholar] [CrossRef]
  23. Meharg, A.; Cairney, J.W. Co-evolution of mycorrhizal symbionts and their hosts to metal-contaminated environments. In Advances in Ecological Research; Elsevier: Amsterdam, The Netherlands, 1999; Volume 30, pp. 69–112. [Google Scholar]
  24. Jentschke, G.; Godbold, D. Metal toxicity and ectomycorrhizas. Physiol. Plant. 2000, 109, 107–116. [Google Scholar] [CrossRef] [Green Version]
  25. Van Tichelen, K.K.; Vanstraelen, T.; Colpaert, J.V. Nutrient uptake by intact mycorrhizal Pinus sylvestris seedlings: A diagnostic tool to detect copper toxicity. Tree Physiol. 1999, 19, 189–196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Adriaensen, K.; Van Der Lelie, D.; Van Laere, A.; Vangronsveld, J.; Colpaert, J.V. A zinc-adapted fungus protects pines from zinc stress. New Phytol. 2004, 161, 549–555. [Google Scholar] [CrossRef]
  27. Colpaert, J.V.; Vandenkoornhuyse, P.; Adriaensen, K.; Vangronsveld, J. Genetic variation and heavy metal tolerance in the ectomycorrhizal basidiomycete Suillus luteus. New Phytol. 2000, 147, 367–379. [Google Scholar] [CrossRef]
  28. Krznaric, E.; Verbruggen, N.; Wevers, J.H.; Carleer, R.; Vangronsveld, J.; Colpaert, J.V. Cd-tolerant Suillus luteus: A fungal insurance for pines exposed to Cd. Environ. Pollut. 2009, 157, 1581–1588. [Google Scholar] [CrossRef] [PubMed]
  29. Wang, M.; Yuan, L.; Zhou, Z.; Yang, H.; Huang, J. Efflux of oxalate and uptake of nitrogen, phosphorus and potassium by ectomycorrhizal fungal isolates in vitro in response to aluminum stress. Sci. Silvae Sin. 2012, 48, 82–88. [Google Scholar]
  30. Rudawska, M.; Kieliszewska-Rokicka, B.; Leski, T. Effect of aluminium on Pinus sylvestris seedlings mycorrhizal with aluminium-tolerant and aluminium-sensitive strains of Suillus luteus. Dendrobiology 2000, 45, 89–96. [Google Scholar]
  31. Kong, F.; Liu, Y.; Hu, W.; Shen, P.; Zhou, C.; Wang, L. Biochemical responses of the mycorrhizae in Pinus massoniana to combined effects of Al, Ca and low pH. Chemosphere 2000, 40, 311–318. [Google Scholar] [CrossRef]
  32. Chen, L.-S.; Qi, Y.-P.; Liu, X.-H. Effects of aluminum on light energy utilization and photoprotective systems in citrus leaves. Ann. Bot. 2005, 96, 35–41. [Google Scholar] [CrossRef] [PubMed]
  33. Basu, U.; Southron, J.; Stephens, J.; Taylor, G. Reverse genetic analysis of the glutathione metabolic pathway suggests a novel role of PHGPX and URE2 genes in aluminum resistance in Saccharomyces cerevisiae. Mol. Genet. Genom. 2004, 271, 627–637. [Google Scholar] [CrossRef]
  34. Shen, H.; He, L.F.; Sasaki, T.; Yamamoto, Y.; Zheng, S.J.; Ligaba, A.; Yan, X.L.; Ahn, S.J.; Yamaguchi, M.; Sasakawa, H. Citrate secretion coupled with the modulation of soybean root tip under aluminum stress. Up-regulation of transcription, translation, and threonine-oriented phosphorylation of plasma membrane H+-ATPase. Plant Physiol. 2005, 138, 287–296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Hamilton, C.A.; Good, A.G.; Taylor, G.J. Induction of vacuolar ATPase and mitochondrial ATP synthase by aluminum in an aluminum-resistant cultivar of wheat. Plant Physiol. 2001, 125, 2068–2077. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Larsen, P.B.; Geisler, M.J.; Jones, C.A.; Williams, K.M.; Cancel, J.D. ALS3 encodes a phloem-localized ABC transporter-like protein that is required for aluminum tolerance in Arabidopsis. Plant J. 2005, 41, 353–363. [Google Scholar] [CrossRef] [PubMed]
  37. Anoop, V.M.; Basu, U.; McCammon, M.T.; McAlister-Henn, L.; Taylor, G.J. Modulation of citrate metabolism alters aluminum tolerance in yeast and transgenic canola overexpressing a mitochondrial citrate synthase. Plant Physiol. 2003, 132, 2205–2217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Mao, C.; Yi, K.; Yang, L.; Zheng, B.; Wu, Y.; Liu, F.; Wu, P. Identification of aluminium-regulated genes by cDNA-AFLP in rice (Oryza sativa L.): Aluminium-regulated genes for the metabolism of cell wall components. J. Exp. Bot. 2004, 55, 137–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Brosché, M.; Strid, Å. Cloning, expression, and molecular characterization of a small pea gene family regulated by low levels of ultraviolet B radiation and other stresses. Plant Physiol. 1999, 121, 479–488. [Google Scholar] [CrossRef] [Green Version]
  40. Sivaguru, M.; Ezaki, B.; He, Z.-H.; Tong, H.; Osawa, H.; Baluška, F.; Volkmann, D.; Matsumoto, H. Aluminum-induced gene expression and protein localization of a cell wall-associated receptor kinase in Arabidopsis. Plant Physiol. 2003, 132, 2256–2266. [Google Scholar] [CrossRef] [Green Version]
  41. Yang, Q.; Wang, Y.; Zhang, J.; Shi, W.; Qian, C.; Peng, X. Identification of aluminum-responsive proteins in rice roots by a proteomic approach: Cysteine synthase as a key player in Al response. Proteomics 2007, 7, 737–749. [Google Scholar] [CrossRef]
  42. Zhou, S.; Sauve, R.; Thannhauser, T.W. Aluminum induced proteome changes in tomato cotyledons. Plant Signal. Behav. 2009, 4, 769–772. [Google Scholar] [CrossRef] [Green Version]
  43. Zhen, Y.; Qi, J.L.; Wang, S.S.; Su, J.; Xu, G.H.; Zhang, M.S.; Miao, L.; Peng, X.X.; Tian, D.; Yang, Y.H. Comparative proteome analysis of differentially expressed proteins induced by Al toxicity in soybean. Physiol. Plant. 2007, 131, 542–554. [Google Scholar] [CrossRef] [PubMed]
  44. Yu, P.; Sun, Y.; Huang, Z.; Zhu, F.; Sun, Y.; Jiang, L. The effects of ectomycorrhizal fungi on heavy metals’ transport in Pinus massoniana and bacteria community in rhizosphere soil in mine tailing area. J. Hazard. Mater. 2020, 381, 121203. [Google Scholar] [CrossRef] [PubMed]
  45. Haiyan, L.; Houying, C.; Guijie, D.; Kuaifen, L.; Qifei, R. Identification of candidate genes conferring tolerance to aluminum stress in Pinus massoniana inoculated with ectomycorrhizal fungus. BMC Plant Biol. 2020, 20, 1–13. [Google Scholar]
  46. Fuqiang, Y.; Dagan, J.; Peigui, L. Studies on pure culture of the ectomycorrhizal fungi associated with Pinus yunnanensis. Zhiwu Yanjiu 2003, 23, 66–71. [Google Scholar]
  47. Gu, J.; Li, R.; ShiGui, J. Recent advance of fungi preservation technology. Mycosystema 2007, 24, 12–25. [Google Scholar]
  48. Du, P.; Tu, H.; Jiang, J.; Cui, B.; Dai, Y. Molecular Identification and Biological Characteristics of Wild Paxillus ammoniavirescens Strain. For. Sci. Res. 2020, 33, 146–155. [Google Scholar]
  49. Feng, J.; Wang, M.; YAN, W. Study on Molecular Identification and Genetic Relationships of Ectomycorrhizal Strains of Suillus Gene. For. Res. 2008, 6, 825. [Google Scholar]
  50. Hothem, S.D.; Marley, K.A.; Larson, R.A. Photochemistry in Hoagland’s nutrient solution. J. Plant Nutr. 2003, 26, 845–854. [Google Scholar] [CrossRef]
  51. Ghanati, F.; Morita, A.; Yokota, H. Effects of aluminum on the growth of tea plant and activation of antioxidant system. Plant Soil 2005, 276, 133–141. [Google Scholar] [CrossRef]
  52. Guo, P.; Qi, Y.-P.; Yang, L.-T.; Lai, N.-W.; Ye, X.; Yang, Y.; Chen, L.-S. Root adaptive responses to aluminum-treatment revealed by RNA-Seq in two Citrus species with different aluminum-tolerance. Front. Plant Sci. 2017, 8, 330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Sun, Q.; Shen, R.; Zhao, X. Study of different parameters for evaluating Al tolerance in plants. Plant Nutr. Fertil. Sci. 2008, 5, 5. [Google Scholar]
  54. Xiao, S.; Liu, L.; Zhang, Y.; Sun, H.; Zhang, K.; Bai, Z.; Dong, H.; Liu, Y.; Li, C. Tandem mass tag-based (TMT) quantitative proteomics analysis reveals the response of fine roots to drought stress in cotton (Gossypium hirsutum L.). BMC Plant Biol. 2020, 20, 1–18. [Google Scholar] [CrossRef]
  55. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  56. Zhou, G.; Delhaize, E.; Zhou, M.; Ryan, P.R. Biotechnological solutions for enhancing the aluminium resistance of crop plants. Abiotic Stress Plants—Mech. Adapt. Brisb. Intech 2011, 1, 119–142. [Google Scholar]
  57. Zhu, J.-J.; Li, F.-Q.; Xu, M.-L.; Kang, H.-Z.; Wu, X.-Y. The role of ectomycorrhizal fungi in alleviating pine decline in semiarid sandy soil of northern China: An experimental approach. Ann. For. Sci. 2008, 65, 1. [Google Scholar] [CrossRef] [Green Version]
  58. Kipfer, T.; Wohlgemuth, T.; van der Heijden, M.G.; Ghazoul, J.; Egli, S. Growth response of drought-stressed Pinus sylvestris seedlings to single-and multi-species inoculation with ectomycorrhizal fungi. PLoS ONE 2012, 7, e35275. [Google Scholar] [CrossRef]
  59. Jie, W.; Huang, Y.; JIANG, X.-Y. Influence of ectomycorrhizal fungi on absorption and balance of essential elements of Pinus tabulaeformis seedlings in saline soil. Pedosphere 2011, 21, 400–406. [Google Scholar]
  60. Yin, D.; Halifu, S.; Song, R.; Qi, J.; Deng, X.; Deng, J. Effects of an ectomycorrhizal fungus on the growth and physiology of Pinus sylvestris var. mongolica seedlings subjected to saline–alkali stress. J. For. Res. 2020, 31, 781–788. [Google Scholar] [CrossRef]
  61. Kasuya, M.; Muchovej, R.; Muchovej, J. Influence of aluminum on in vitro formation of Pinus caribaea mycorrhizae. Plant Soil 1990, 124, 73–77. [Google Scholar] [CrossRef]
  62. Ahonen-Jonnarth, U.; Göransson, A.; Finlay, R.D. Growth and nutrient uptake of ectomycorrhizal Pinus sylvestris seedlings in a natural substrate treated with elevated Al concentrations. Tree Physiol. 2003, 23, 157–167. [Google Scholar] [CrossRef] [Green Version]
  63. Huang, J.; Han, Q.; Li, J. Soil propagule bank of ectomycorrhizal fungi associated with Masson pine (Pinus massoniana) grown in a manganese mine wasteland. PLoS ONE 2018, 13, e0198628. [Google Scholar] [CrossRef]
  64. Huang, J.; Nara, K.; Lian, C.; Zong, K.; Peng, K.; Xue, S.; Shen, Z. Ectomycorrhizal fungal communities associated with Masson pine (Pinus massoniana Lamb.) in Pb–Zn mine sites of central south China. Mycorrhiza 2012, 22, 589–602. [Google Scholar] [CrossRef] [PubMed]
  65. Huang, J.; Nara, K.; Zong, K.; Wang, J.; Xue, S.; Peng, K.; Shen, Z.; Lian, C. Ectomycorrhizal fungal communities associated with Masson pine (Pinus massoniana) and white oak (Quercus fabri) in a manganese mining region in Hunan Province, China. Fungal Ecol. 2014, 9, 1–10. [Google Scholar] [CrossRef]
  66. Thompson, G.W.; Medve, R.J. Effects of aluminum and manganese on the growth of ectomycorrhizal fungi. Appl. Environ. Microbiol. 1984, 48, 556–560. [Google Scholar] [CrossRef] [Green Version]
  67. Leski, T.; Rudawska, M.; Kieliszewska-Rokicka, B. Intraspecific aluminium response in Suillus luteus (L.) sf gray., an ectomycorrhizal symbiont of scots pine. Acta Soc. Bot. Pol. 1995, 64, 97–105. [Google Scholar] [CrossRef] [Green Version]
  68. Li, W.; Johnson, C.E. Relationships among pH, aluminum solubility and aluminum complexation with organic matter in acid forest soils of the Northeastern United States. Geoderma 2016, 271, 234–242. [Google Scholar] [CrossRef]
  69. Li, H.; Huang, J.-G.; Yuan, L. Influence of aluminum and manganese on the growth, nutrient uptake and the efflux by ectomycorrhizal fungi. Environ. Sci. 2013, 34, 315–320. [Google Scholar]
  70. Wang, M.; Yuan, L.; Huang, J.; Zhou, Z. Al3+ Absorption and Assimilation by Four Ectomycorrhizal Fungi. Environ. Sci. 2015, 36, 3479–3485. [Google Scholar]
  71. Yang, X.; Xia, X.; Zhang, Z.; Nong, B.; Zeng, Y.; Wu, Y.; Xiong, F.; Zhang, Y.; Liang, H.; Pan, Y. Identification of anthocyanin biosynthesis genes in rice pericarp using PCAMP. Plant Biotechnol. J. 2019, 17, 1700. [Google Scholar] [CrossRef] [Green Version]
  72. Glatz, A.; Horváth, I.; Varvasovszki, V.; Kovács, E.; Török, Z.; Vigh, L. Chaperonin Genes of theSynechocystisPCC 6803 Are Differentially Regulated under Light–Dark Transition during Heat Stress. Biochem. Biophys. Res. Commun. 1997, 239, 291–297. [Google Scholar] [CrossRef]
  73. Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef]
  74. Sharma, A.; Rustad, T.; Mahajan, G.; Kumar, A.; Rao, K.V.; Banerjee, S.; Sherman, D.R.; Mande, S.C. Towards understanding the biological function of the unusual chaperonin Cpn60. 1 (GroEL1) of Mycobacterium tuberculosis. Tuberculosis 2016, 97, 137–146. [Google Scholar] [CrossRef] [PubMed]
  75. Ortbauer, M.; Vahdati, K.; Leslie, C. Abiotic stress adaptation: Protein folding stability and dynamics. Abiotic Stress-Plant Responses Appl. Agric. 2013, 1, 3–25. [Google Scholar]
  76. Aremu, D.A.; Ezomo, O.F.; Meshitsuka, S. Gene expression in primary cultured astrocytes affected by aluminum: Alteration of chaperons involved in protein folding. Environ. Health Prev. Med. 2011, 16, 16–24. [Google Scholar] [CrossRef] [Green Version]
  77. Joshi, R.; Karan, R.; Singla-Pareek, S.L.; Pareek, A. Ectopic expression of Pokkali phosphoglycerate kinase-2 (OsPGK2-P) improves yield in tobacco plants under salinity stress. Plant Cell Rep. 2016, 35, 27–41. [Google Scholar] [CrossRef] [PubMed]
  78. Kosová, K.; Vítámvás, P.; Prášil, I.T.; Renaut, J. Plant proteome changes under abiotic stress—Contribution of proteomics studies to understanding plant stress response. J. Proteom. 2011, 74, 1301–1322. [Google Scholar] [CrossRef] [PubMed]
  79. Sunkar, R.; Kapoor, A.; Zhu, J.-K. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 2006, 18, 2051–2065. [Google Scholar] [CrossRef] [Green Version]
  80. Wang, Y.C.; Qu, G.Z.; Li, H.Y.; Wu, Y.J.; Wang, C.; Liu, G.F.; Yang, C.P. Enhanced salt tolerance of transgenic poplar plants expressing a manganese superoxide dismutase from Tamarix androssowii. Mol. Biol. Rep. 2010, 37, 1119. [Google Scholar] [CrossRef] [PubMed]
  81. Sharma, P.; Dubey, R. Involvement of oxidative stress and role of antioxidative defense system in growing rice seedlings exposed to toxic concentrations of aluminum. Plant Cell Rep. 2007, 26, 2027–2038. [Google Scholar] [CrossRef]
  82. Ezaki, B.; Gardner, R.C.; Ezaki, Y.; Matsumoto, H. Expression of aluminum-induced genes in transgenic Arabidopsis plants can ameliorate aluminum stress and/or oxidative stress. Plant Physiol. 2000, 122, 657–666. [Google Scholar] [CrossRef] [Green Version]
  83. Watt, D.A. Aluminium-responsive genes in sugarcane: Identification and analysis of expression under oxidative stress. J. Exp. Bot. 2003, 54, 1163–1174. [Google Scholar] [CrossRef] [Green Version]
  84. Boscolo, P.R.; Menossi, M.; Jorge, R.A. Aluminum-induced oxidative stress in maize. Phytochemistry 2003, 62, 181–189. [Google Scholar] [CrossRef]
  85. Hossain, Z.; Nouri, M.-Z.; Komatsu, S. Plant cell organelle proteomics in response to abiotic stress. J. Proteome Res. 2012, 11, 37–48. [Google Scholar] [CrossRef] [PubMed]
  86. Singh, S.; Parihar, P.; Singh, R.; Singh, V.P.; Prasad, S.M. Heavy metal tolerance in plants: Role of transcriptomics, proteomics, metabolomics, and ionomics. Front. Plant Sci. 2016, 6, 1143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Satoh, H.; Uchida, A.; Nakayama, K.; Okada, M. Water-soluble chlorophyll protein in Brassicaceae plants is a stress-induced chlorophyll-binding protein. Plant Cell Physiol. 2001, 42, 906–911. [Google Scholar] [CrossRef]
  88. La Roche, J.; Van der Staay, G.; Partensky, F.; Ducret, A.; Aebersold, R.; Li, R.; Golden, S.; Hiller, R.; Wrench, P.; Larkum, A. Independent evolution of the prochlorophyte and green plant chlorophyll a/b light-harvesting proteins. Proc. Natl. Acad. Sci. USA 1996, 93, 15244–15248. [Google Scholar] [CrossRef] [Green Version]
  89. Li, X.-W.; Zhu, Y.-L.; Chen, C.-Y.; Geng, Z.-J.; Li, X.-Y.; Ye, T.-T.; Mao, X.-N.; Du, F. Cloning and characterization of two chlorophyll A/B binding protein genes and analysis of their gene family in Camellia sinensis. Sci. Rep. 2020, 10, 4602. [Google Scholar] [CrossRef] [Green Version]
  90. Kong, F.; Zhou, Y.; Sun, P.; Cao, M.; Li, H.; Mao, Y. Identification of light-harvesting chlorophyll a/b-binding protein genes of Zostera marina L. and their expression under different environmental conditions. J. Ocean Univ. China 2016, 15, 152–162. [Google Scholar] [CrossRef]
  91. Park, Y.B.; Cosgrove, D.J. A revised architecture of primary cell walls based on biomechanical changes induced by substrate-specific endoglucanases. Plant Physiol. 2012, 158, 1933–1943. [Google Scholar] [CrossRef] [Green Version]
  92. Baig, M.A.; Ahmad, J.; Bagheri, R.; Ali, A.A.; Al-Huqail, A.A.; Ibrahim, M.M.; Qureshi, M.I. Proteomic and ecophysiological responses of soybean (Glycine max L.) root nodules to Pb and hg stress. BMC Plant Biol. 2018, 18, 1–21. [Google Scholar] [CrossRef] [PubMed]
  93. Houston, K.; Tucker, M.R.; Chowdhury, J.; Shirley, N.; Little, A. The plant cell wall: A complex and dynamic structure as revealed by the responses of genes under stress conditions. Front. Plant Sci. 2016, 7, 984. [Google Scholar] [CrossRef] [Green Version]
  94. Matern, U.; Grimmig, B.; Kneusel, R.E. Plant cell wall reinforcement in the disease-resistance response: Molecular composition and regulation. Can. J. Bot. 1995, 73, 511–517. [Google Scholar] [CrossRef]
  95. Chebli, Y.; Geitmann, A. Cellular growth in plants requires regulation of cell wall biochemistry. Curr. Opin. Cell Biol. 2017, 44, 28–35. [Google Scholar] [CrossRef]
  96. Tenhaken, R. Cell wall remodeling under abiotic stress. Front. Plant Sci. 2015, 5, 771. [Google Scholar] [CrossRef] [Green Version]
  97. Scheller, H.V.; Ulvskov, P. Hemicelluloses. Annu. Rev. Plant Biol. 2010, 4, 61. [Google Scholar] [CrossRef]
  98. Tucker, M.R.; Koltunow, A.M. Traffic monitors at the cell periphery: The role of cell walls during early female reproductive cell differentiation in plants. Curr. Opin. Plant Biol. 2014, 17, 137–145. [Google Scholar] [CrossRef]
  99. Sang, Q.; Shan, X.; An, Y.; Shu, S.; Sun, J.; Guo, S. Proteomic analysis reveals the positive effect of exogenous spermidine in tomato seedlings’ response to high-temperature stress. Front. Plant Sci. 2017, 8, 120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  100. Chen, L.; Liu, Y.; Wu, G.; Zhang, N.; Shen, Q.; Zhang, R. Beneficial rhizobacterium Bacillus amyloliquefaciens SQR9 induces plant salt tolerance through spermidine production. Mol. Plant-Microbe Interact. 2017, 30, 423–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  101. Peng, L.; Shikanai, T. Supercomplex formation with photosystem I is required for the stabilization of the chloroplast NADH dehydrogenase-like complex in Arabidopsis. Plant Physiol. 2011, 155, 1629–1639. [Google Scholar] [CrossRef] [Green Version]
  102. Ueda, M.; Kuniyoshi, T.; Yamamoto, H.; Sugimoto, K.; Ishizaki, K.; Kohchi, T.; Nishimura, Y.; Shikanai, T. Composition and physiological function of the chloroplast NADH dehydrogenase-like complex in Marchantia polymorpha. Plant J. 2012, 72, 683–693. [Google Scholar] [CrossRef]
  103. Townsend, D.M.; Manevich, Y.; He, L.; Hutchens, S.; Pazoles, C.J.; Tew, K.D. Novel role for glutathione S-transferase π regulator of protein S-glutathionylation following oxidative and nitrosative stress. J. Biol. Chem. 2009, 284, 436–445. [Google Scholar] [CrossRef] [Green Version]
  104. Roxas, V.P.; Smith, R.K.; Allen, E.R.; Allen, R.D. Overexpression of glutathione S-transferase/glutathioneperoxidase enhances the growth of transgenic tobacco seedlings during stress. Nat. Biotechnol. 1997, 15, 988–991. [Google Scholar] [CrossRef]
  105. Park, S.; Moon, J.-C.; Park, Y.C.; Kim, J.-H.; Kim, D.S.; Jang, C.S. Molecular dissection of the response of a rice leucine-rich repeat receptor-like kinase (LRR-RLK) gene to abiotic stresses. J. Plant Physiol. 2014, 171, 1645–1653. [Google Scholar] [CrossRef] [PubMed]
  106. Timotijević, G.S.; Milisavljević, M.D.; Radović, S.R.; Konstantinović, M.M.; Maksimović, V.R. Ubiquitous aspartic proteinase as an actor in the stress response in buckwheat. J. Plant Physiol. 2010, 167, 61–68. [Google Scholar] [CrossRef] [PubMed]
  107. Simões, I.; Faro, C. Structure and function of plant aspartic proteinases. Eur. J. Biochem. 2004, 271, 2067–2075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  108. Wang, S.; Liu, L.; Chen, C.; Chen, L. Regulations of granule-bound starch synthase I gene expression in rice leaves by temperature and drought stress. Biol. Plant. 2006, 50, 537–541. [Google Scholar] [CrossRef]
  109. Chen, H.-J.; Chen, J.-Y.; Wang, S.-J. Molecular regulation of starch accumulation in rice seedling leaves in response to salt stress. Acta Physiol. Plant. 2008, 30, 135–142. [Google Scholar] [CrossRef]
  110. Hurley, B.A.; Tran, H.T.; Marty, N.J.; Park, J.; Snedden, W.A.; Mullen, R.T.; Plaxton, W.C. The dual-targeted purple acid phosphatase isozyme AtPAP26 is essential for efficient acclimation of Arabidopsis to nutritional phosphate deprivation. Plant Physiol. 2010, 153, 1112–1122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  111. Wang, L.; Li, Z.; Qian, W.; Guo, W.; Gao, X.; Huang, L.; Wang, H.; Zhu, H.; Wu, J.-W.; Wang, D. The Arabidopsis purple acid phosphatase AtPAP10 is predominantly associated with the root surface and plays an important role in plant tolerance to phosphate limitation. Plant Physiol. 2011, 157, 1283–1299. [Google Scholar] [CrossRef] [Green Version]
  112. Liu, C.; Peang, H.; Li, X.; Liu, C.; Lv, X.; Wei, X.; Zou, A.; Zhang, J.; Fan, G.; Ma, G. Genome-wide analysis of NDR1/HIN1-like genes in pepper (Capsicum annuum L.) and functional characterization of CaNHL4 under biotic and abiotic stresses. Hortic. Res. 2020, 7, 1–15. [Google Scholar] [CrossRef]
  113. Grant, C.M.; Quinn, K.A.; Dawes, I.W. Differential protein S-thiolation of glyceraldehyde-3-phosphate dehydrogenase isoenzymes influences sensitivity to oxidative stress. Mol. Cell. Biol. 1999, 19, 2650–2656. [Google Scholar] [CrossRef] [Green Version]
  114. Yang, Y.; Kwon, H.-B.; Peng, H.-P.; Shih, M.-C. Stress responses and metabolic regulation of glyceraldehyde-3-phosphate dehydrogenase genes in Arabidopsis. Plant Physiol. 1993, 101, 209–216. [Google Scholar] [CrossRef] [Green Version]
  115. Baudouin-Cornu, P.; Labarre, J. Regulation of the cadmium stress response through SCF-like ubiquitin ligases: Comparison between Saccharomyces cerevisiae, Schizosaccharomyces pombe and mammalian cells. Biochimie 2006, 88, 1673–1685. [Google Scholar] [CrossRef]
  116. Becerra, C.; Jahrmann, T.; Puigdomènech, P.; Vicient, C.M. Ankyrin repeat-containing proteins in Arabidopsis: Characterization of a novel and abundant group of genes coding ankyrin-transmembrane proteins. Gene 2004, 340, 111–121. [Google Scholar] [CrossRef]
  117. Pyo, Y.; Kim, G.M.; Choi, S.W.; Song, C.Y.; Yang, S.W.; Jung, I.L. Strontium stress disrupts miRNA biogenesis by reducing HYL1 protein levels in Arabidopsis. Ecotoxicol. Environ. Saf. 2020, 204, 111056. [Google Scholar] [CrossRef]
  118. Bertini, L.; Palazzi, L.; Proietti, S.; Pollastri, S.; Arrigoni, G.; Polverino de Laureto, P.; Caruso, C. Proteomic analysis of MeJa-induced defense responses in rice against wounding. Int. J. Mol. Sci. 2019, 20, 2525. [Google Scholar] [CrossRef] [Green Version]
  119. Wang, Z.; Liu, L.; Su, H.; Guo, L.; Zhang, J.; Li, Y.; Xu, J.; Zhang, X.; Guo, Y.-D.; Zhang, N. Jasmonate and aluminum crosstalk in tomato: Identification and expression analysis of WRKYs and ALMTs during JA/Al-regulated root growth. Plant Physiol. Biochem. 2020, 154, 409–418. [Google Scholar] [CrossRef]
  120. Le Roy, J.; Blervacq, A.-S.; Créach, A.; Huss, B.; Hawkins, S.; Neutelings, G. Spatial regulation of monolignol biosynthesis and laccase genes control developmental and stress-related lignin in flax. BMC Plant Biol. 2017, 17, 1–20. [Google Scholar] [CrossRef]
  121. Hu, Q.; Min, L.; Yang, X.; Jin, S.; Zhang, L.; Li, Y.; Ma, Y.; Qi, X.; Li, D.; Liu, H. Laccase GhLac1 modulates broad-spectrum biotic stress tolerance via manipulating phenylpropanoid pathway and jasmonic acid synthesis. Plant Physiol. 2018, 176, 1808–1823. [Google Scholar] [CrossRef] [Green Version]
  122. Liang, M.; Haroldsen, V.; Cai, X.; Wu, Y. Expression of a putative laccase gene, ZmLAC1, in maize primary roots under stress. Plant Cell Environ. 2006, 29, 746–753. [Google Scholar] [CrossRef]
  123. Lakra, N.; Nutan, K.K.; Das, P.; Anwar, K.; Singla-Pareek, S.L.; Pareek, A. A nuclear-localized histone-gene binding protein from rice (OsHBP1b) functions in salinity and drought stress tolerance by maintaining chlorophyll content and improving the antioxidant machinery. J. Plant Physiol. 2015, 176, 36–46. [Google Scholar] [CrossRef]
  124. Li, J.; Hu, L.; Zhang, L.; Pan, X.; Hu, X. Exogenous spermidine is enhancing tomato tolerance to salinity–alkalinity stress by regulating chloroplast antioxidant system and chlorophyll metabolism. BMC Plant Biol. 2015, 15, 1–17. [Google Scholar] [CrossRef]
  125. Kasukabe, Y.; He, L.; Nada, K.; Misawa, S.; Ihara, I.; Tachibana, S. Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress-regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol. 2004, 45, 712–722. [Google Scholar] [CrossRef] [Green Version]
  126. Wen, X.-P.; Pang, X.-M.; Matsuda, N.; Kita, M.; Inoue, H.; Hao, Y.-J.; Honda, C.; Moriguchi, T. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers. Transgenic Res. 2008, 17, 251–263. [Google Scholar] [CrossRef]
  127. Zeng, Y.; Zhao, T.; Kermode, A.R. A conifer ABI3-interacting protein plays important roles during key transitions of the plant life cycle. Plant Physiol. 2013, 161, 179–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  128. Zhang, X.; Garreton, V.; Chua, N.-H. The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev. 2005, 19, 1532–1543. [Google Scholar] [CrossRef] [Green Version]
  129. Carrie, C.; Small, I. A reevaluation of dual-targeting of proteins to mitochondria and chloroplasts. Biochim. Biophys. Acta Mol. Cell Res. 2013, 1833, 253–259. [Google Scholar] [CrossRef] [Green Version]
  130. Lecoy, J.; García-Gil, M. Evolutionary analysis of LP3 gene family in conifers: An ASR homolog. bioRxiv 2020. [Google Scholar] [CrossRef] [Green Version]
  131. Park, J.H.; Lee, S.Y.; Kim, W.Y.; Jung, Y.J.; Chae, H.B.; Jung, H.S.; Kang, C.H.; Shin, M.R.; Kim, S.Y.; Su’udi, M. Heat-induced chaperone activity of serine/threonine protein phosphatase 5 enhances thermotolerance in Arabidopsis thaliana. New Phytol. 2011, 191, 692–705. [Google Scholar] [CrossRef]
Life 11 00177 g001 550
Figure 1. Gene ontology enrichment analysis for (a) LB-0 vs. CK-0 (b) LB-04 vs. CK-04 (c) LB-04 vs. CK-0. BP = Biological processes MF = molecular Functions CC = cellular components. The number on each column represents the corresponding rich factor.
Figure 1. Gene ontology enrichment analysis for (a) LB-0 vs. CK-0 (b) LB-04 vs. CK-04 (c) LB-04 vs. CK-0. BP = Biological processes MF = molecular Functions CC = cellular components. The number on each column represents the corresponding rich factor.
Life 11 00177 g001
Life 11 00177 g002 550
Figure 2. (a) Venn diagram representing differentially expressed proteins conserved between LB-04 vs. LB-0 and CK-04 vs. CK-0, (b) Differential expression pattern of proteins conserved between LB-04 vs. LB-0 & CK-04 vs. CK-0. Deep blue color shows lower intensity, and deep red color displays higher intensity. Different samples (LB-04/LB-0 and CK-04/CK-0) are represented as columns.
Figure 2. (a) Venn diagram representing differentially expressed proteins conserved between LB-04 vs. LB-0 and CK-04 vs. CK-0, (b) Differential expression pattern of proteins conserved between LB-04 vs. LB-0 & CK-04 vs. CK-0. Deep blue color shows lower intensity, and deep red color displays higher intensity. Different samples (LB-04/LB-0 and CK-04/CK-0) are represented as columns.
Life 11 00177 g002
Life 11 00177 g003 550
Figure 3. Relative expression profile of genes governing differential proteins under LB-04 (SL-inoculated Al stress condition) and LB-0 (SL inoculation condition without Al stress). Blue bars indicate gene expression levels under SL-inoculated conditions without Al treatment (LB-0), while red bars indicate gene expression levels under SL-inoculated Al stress conditions (LB-04). The error bars represent technical variations.
Figure 3. Relative expression profile of genes governing differential proteins under LB-04 (SL-inoculated Al stress condition) and LB-0 (SL inoculation condition without Al stress). Blue bars indicate gene expression levels under SL-inoculated conditions without Al treatment (LB-0), while red bars indicate gene expression levels under SL-inoculated Al stress conditions (LB-04). The error bars represent technical variations.
Life 11 00177 g003
Table
Table 1. Specific forward and reverse primers used for qRT-PCR.
Table 1. Specific forward and reverse primers used for qRT-PCR.
Gene IDForward Primer SequenceReverse Primer SequenceE Value (%)R2
TRINITY_DN51949_c0_g2CCGTCATCGCTCCAGTCACAGTTCGCCCTTCA93.20.94
TRINITY_DN44650_c0_g1GGAAAGTGGGTGGTCTAGGAGTTCGTGGGATT91.50.86
TRINITY_DN50464_c0_g3ATTGATAGGAGGCTGATGAGGGAACTACGAGA89.60.95
TRINITY_DN39799_c0_g2GAGACAATGTGGTGGCTTTGGCAGTGTAAGCA940.91
TRINITY_DN39005_c0_g1GCTACACCCTCGCAGTAGCACGACCAGGAAAC87.60.88
TRINITY_DN43045_c0_g9CCTTGAACCCAAATACAACGGGCTTACCAGTCT91.30.92
TRINITY_DN43345_c2_g1AACAAGCCGTTGGACTGGGAACAAAGGATGGG92.40.95
TRINITY_DN47656_c0_g2CCTGTATTGCCTGATGGACGAGATGGTGGAGT88.50.93
TRINITY_DN47910_c0_g1TCACCTGCCATACAAATCCAGCATCAAAGAAA910.93
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Liu, H.; Chen, H.; Ding, G.; Li, K.; Wang, Y. Proteomic Insight into the Symbiotic Relationship of Pinus massoniana Lamb and Suillus luteus towards Developing Al-Stress Resistance. Life 2021, 11, 177. https://doi.org/10.3390/life11020177

AMA Style

Liu H, Chen H, Ding G, Li K, Wang Y. Proteomic Insight into the Symbiotic Relationship of Pinus massoniana Lamb and Suillus luteus towards Developing Al-Stress Resistance. Life. 2021; 11(2):177. https://doi.org/10.3390/life11020177

Chicago/Turabian Style

Liu, Haiyan, Houying Chen, Guijie Ding, Kuaifen Li, and Yao Wang. 2021. "Proteomic Insight into the Symbiotic Relationship of Pinus massoniana Lamb and Suillus luteus towards Developing Al-Stress Resistance" Life 11, no. 2: 177. https://doi.org/10.3390/life11020177

APA Style

Liu, H., Chen, H., Ding, G., Li, K., & Wang, Y. (2021). Proteomic Insight into the Symbiotic Relationship of Pinus massoniana Lamb and Suillus luteus towards Developing Al-Stress Resistance. Life, 11(2), 177. https://doi.org/10.3390/life11020177

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop