Next Article in Journal
Effects of Intra-Articular Stromal Vascular Fraction Injection on Clinical Symptoms and Cartilage Health in Osteoarthritic Knees: A Single-Center Pilot Study
Next Article in Special Issue
Pharmacological Activity of Cha-Miang (Camellia sinensis var. assamica) in High Fat Diet-Induced Insulin-Resistant Rats
Previous Article in Journal
Ectopic Kidney, a Challenging First Trimester Diagnosis—Case Report and Literature Review
Previous Article in Special Issue
Phytochemical Investigation and Biological Activities of Desmodium heterocarpon Extract as Anti-Tyrosinase: Isolation of Natural Compounds, In Vitro and In Silico Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 14
Issue 11
10.3390/life14111467
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ginsenoside-Enriched Extract from Black Ginseng Anti-Fatigue Effects by Improving Antioxidant Capacity and Mitochondrial Function

by
Shunji Ge
1,†,
Jiating Li
2,†,
Xueyue Tai
1,3,
Kuo Wang
1,3,
Liyan Huang
1,4,
Weixin Su
1,5,
Guoqi Zhang
1,3,
Bao Zhong
1,* and
Fenglin Li
1,*
1
College of Food Science and Nutritional Engineering, Jilin Agriculture Science and Technology University, Jilin 132101, China
2
School of Public Health, Jilin Medical University, Jilin 132013, China
3
College of Food Science and Engineering, Changchun University, Changchun 130022, China
4
School of Food Science and Engineering, Jilin Agricultural University, Changchun 130118, China
5
College of Forestry, Beihua University, Jilin 132013, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Life 2024, 14(11), 1467; https://doi.org/10.3390/life14111467
Submission received: 13 October 2024 / Revised: 5 November 2024 / Accepted: 8 November 2024 / Published: 12 November 2024
(This article belongs to the Special Issue Green Medicine: Unraveling the Medicinal Effects of Plant Extracts and Functional Foods)
Browse Figures
Versions Notes

Abstract

:
In this study, we investigated the anti-fatigue effects of black ginseng ginsenosides using exercise performance tests, serum analyses, and gene expression profiling. No significant differences in dietary intake or body weight were observed between groups. The low-dose black ginseng (LBG) group showed no significant improvements in swimming and rotating rod tests. In contrast, the medium (MBG)- and high-dose (HBG) groups showed notable increases in swimming time and significant improvements in the rotating rod test. All treatment groups exhibited longer running times, particularly the HBG group. Serum analysis revealed increased muscle and hepatic glycogen, catalase, and lactate dehydrogenase levels in the MBG and HBG groups, whereas lactate, lipid peroxide, and superoxide dismutase levels were decreased. Additionally, gene expression analysis showed significant upregulation of key antioxidant and mitochondrial function genes, including those encoding cationic amino acid transporter 2, stearoyl-CoA desaturase-2, nuclear respiratory factor 1, nuclear factor erythroid 2-related factor 2, mitochondrial transcription factor A, cytochrome c oxidase II, and NADH–ubiquinone oxidoreductase core subunit 1, particularly in the HBG group, indicating enhanced antioxidant capacity and improved mitochondrial function. These findings suggested that black ginseng ginsenosides effectively mitigated fatigue.

1. Introduction

Ginseng (Panax ginseng C. A. Meyer) is a slow-growing herbaceous plant belonging to the Araliaceae family and the Panax genus. The genus name “Panax” is derived from the Greek word “panacea”, meaning “a remedy for all diseases”. There are 200 types of saponins in ginseng, which can be divided into three categories: protopanaxadiol, protopanaxatriol, and oleanane [1]. Ginsenosides exert pharmacological effects in anti-inflammation, anti-cancer, cardiovascular protection, immune regulation, neuroprotection, anti-diabetes, anti-fatigue, anti-allergy, anti-aging, and antioxidant aspects [2]. The potential reason why ginsenoside solution can counteract fatigue is because it regulates the expression of liver glycogen, muscle glycogen, hepatocyte malondialdehyde (MDA), and hepatocyte superoxide dismutase (SOD) in the blood [3]. 20 (R)-ginsenoside Rg3 exhibits a regulatory effect on fatigue by regulating the expression of serum urea nitrogen (SUN), lactate dehydrogenase (LDH), SOD, MDA, blood lactic acid (LA), and liver glycogen [4].
Unlike its conventional counterpart, black ginseng is a new product formed by ginseng undergoing a unique processing method, involving steaming and drying that causes extensive changes in the type and amount of secondary metabolites [5]. Black ginseng has garnered significant attention in herbal medicine because of its diverse pharmacological properties. There are abundant chemical components in black ginseng, including ginsenosides, polysaccharides, amino acids, polyphenols, and flavonoids [6]. Among these, ginsenosides, polysaccharides, and phenolic compounds are the main ingredients making the health benefits of black ginseng stronger than those of other ginseng products. Research has shown that black ginseng contains rarer ginsenosides, such as Rg3, Rk1, and Rg5, than white ginseng [7]. These unique compounds are believed to contribute to the health benefits of black ginseng. Furthermore, some Maillard reaction products, such as maltol, have also been reported [8]. Black ginseng is associated with a noticeable superiority over white and red ginseng in most comparative biological studies due to its enhanced bioactive components, particularly ginsenosides [9]. Thus, the distinct preparation method of black ginseng is believed to improve its efficacy and alter the pharmacokinetics of its bioactive constituents, resulting in enhanced therapeutic potential [10]. The efficacy of black ginseng has been the subject of numerous studies, which have shown that black ginseng enhances immune function by promoting the proliferation of immune cells and increasing the production of cytokines, thereby bolstering defense mechanisms [11]. Moreover, it improves cognitive performance and exerts anti-fatigue effects [12]. Additionally, its antioxidant properties play a crucial role in reducing the oxidative stress associated with various chronic diseases [13]. Fatigue is a complex syndrome affecting both physical and cognitive function [14]. Fatigue is characterized by decreased physical and mental performance, often resulting from prolonged exertion or stress [15]. A significant body of research has specifically addressed the anti-fatigue properties of black ginseng. The mechanisms underlying these benefits are attributed to the modulation of various biological pathways, including the regulation of oxidative stress and inflammation, which are critical factors in fatigue development [16]. Studies have demonstrated that black ginseng can alleviate fatigue through multiple mechanisms. It enhances energy metabolism by increasing ATP production in muscle tissues [17]. Additionally, ginseng exhibits potent antioxidant activity, which helps mitigate oxidative damage induced by physical exertion, thereby improving endurance and recovery [18]. In animal models, supplementation with black ginseng results in improved exercise performance and reduced lactate levels and muscle damage and other biomarkers of fatigue [19,20].
The CAT-2 (cationic amino acid transporter 2) and Scd-2 (stearoyl-CoA desaturase-2) signaling pathways have emerged as crucial mediators in various physiological processes, including the regulation of oxidative stress and energy metabolism, both of which are critical in the context of fatigue [21]. CAT-2 plays a significant role in the transport of amino acids, particularly arginine, which is vital for the synthesis of nitric oxide (NO) [22]. NO is a key signaling molecule involved in various physiological processes, including vasodilation and the modulation of mitochondrial function. Enhanced NO production can improve blood flow and oxygen delivery to muscles during physical activity, thereby reducing fatigue [23,24]. Scd-2, on the other hand, is involved in lipid metabolism, particularly in the synthesis of monounsaturated fatty acids from saturated fatty acids [25]. This process is crucial for maintaining cellular membrane integrity and function and can be compromised by prolonged exercise or stress. By promoting the synthesis of monounsaturated fatty acids, Scd-2 can improve mitochondrial function and energy production, contributing to increased stamina and reduced fatigue [26]. NRF1 (nuclear respiratory factor 1) and NRE2L2 (nuclear factor erythroid 2–related factor 2) are key regulators of mitochondrial biogenesis and oxidative stress responses [27,28]. NRF1 primarily facilitates the transcription of genes involved in mitochondrial respiration and biogenesis, including those that encode components of the electron transport chain. Enhanced NO production from the CAT-2 pathway can stimulate mitochondrial biogenesis via NRF1, supporting energy production and reducing fatigue [29,30]. In contrast, NRE2L2 is crucial for the cellular antioxidant response by promoting the expression of antioxidant enzymes that protect against oxidative damage [31]. Together, these factors help maintain mitochondrial health and function, which are vital for sustaining energy levels during physical exertion. TFAM (mitochondrial transcription factor A) is a critical transcription factor that directly regulates the expression of mitochondrial DNA, including genes essential for oxidative phosphorylation [32,33]. By promoting mitochondrial DNA replication and transcription, TFAM ensures the production of key mitochondrial proteins, including mitochondrial cytochrome c oxidase II (MtCOX2) and mitochondrial NADH–ubiquinone oxidoreductase core subunit 1 (MtND1), which are involved in the electron transport chain [34]. Additionally, lipid profiles regulated by Scd-2 may influence mitochondrial function and are essential for the optimal expression of NRF1, NRE2L2, and TFAM.
Given the increasing prevalence of fatigue-related diseases in modern society, it is crucial to understand the mechanisms by which black ginseng exerts its anti-fatigue effects. This study aimed to elucidate the specific pathways involved in the anti-fatigue effects of black ginseng ginsenosides and their mechanism(s) of action.

2. Materials and Methods

2.1. Preparation of Freeze-Dried Black Ginseng Ginsenoside Powder

Fresh ginseng (Fusong County, Jilin Province, China), approximately 1.5 cm in diameter, was thoroughly washed and drained. The roots were dried at 60 °C for 8 h, followed by steaming at 121 °C for 2 h and simmering for 1 h. The ginseng was dried again at 60 °C to produce black ginseng. To prepare the extract, black ginseng powder was mixed with a 70% ethanol solution at a solid-to-liquid ratio of 1:40 (g/mL). The mixture was subjected to ultrasonic treatment for 30 min with ultrasonic power exceeding 500 W (XH-300A Ultrasonic Extractor, Beijing Xianghu Technology Development Co., Ltd., Beijing, China). Following sonication, the mixture was centrifuged, and the supernatant was collected. Finally, the supernatant was freeze-dried to obtain black ginseng ginsenoside powder.

2.2. Determination of Black Ginseng Ginsenoside Components by High-Performance Liquid Chromatography

Stock solutions of ginsenoside standards, mixtures including Rg1, Re, Rb1, RC, Rb2, S-Rg2, R-Rg2, Rh1, Rd, S-Rg3, R-Rg3, RK1, and Rg5 were prepared to assess the retention time and content of saponins. High-performance liquid chromatography (HPLC) analysis was conducted at a flow rate of 0.8 mL/min, a column temperature of 35 °C, and a detection wavelength of 203 nm, with acetonitrile and water serving as the mobile phases. The saponin components of black ginseng were analyzed via HPLC. The chromatographic conditions included a C18 column (4.6 mm × 150 mm), a UV detector set to a detection wavelength of 203 nm, an acetonitrile mobile phase, a flow rate of 0.3 mL/min, and an injection volume of 10 µL. A gradient elution program was established, starting with 90% A (water) and 10% B (acetonitrile), which was gradually transitioned to 50% A and 50% B over 30 min, followed by a return to the initial conditions for re-equilibration. The flow rate during the analysis was set to 1.0 mL/min, allowing the determination of saponin content.

2.3. Animal Experiment

A total of 60 male ICR mice (weighing approximately 20 ± 2 g, sourced from Changchun Yisi Experimental Animal Technology Co., Ltd., Changchun, China) were used in this study. The mice were housed in an environment maintained at a temperature of 23 ± 2 °C and a humidity of 55 ± 5%, with a 12 h light/dark cycle. They were provided with a standard diet and had free access to water. After a 7-day acclimatization period, the mice were randomly assigned to one of four groups based on their body weight: a control group, low-dose black ginseng ginsenosides (LBG, 300 mg/kg), medium-dose black ginseng ginsenosides (MBG, 400 mg/kg), and high-dose black ginseng ginsenosides (HBG, 500 mg/kg) groups. The mice received daily gavage administration for 21 d, with body weights and other data recorded every 2 d. The daily food intake was also monitored. Starting on day 15, the mice underwent adaptation training, which included treadmill running, swimming, and rotating rod exercises (Jiangsu Saiangsi Biotechnology Co., Ltd., Taizhou, China). On day 21, the mice were fasted before being subjected to the treadmill, swimming, and rotating rod tests. The running time, swimming endurance time, and rotating rod duration were recorded. Following these experiments, the mice were euthanized, and blood samples (from which serum was obtained following blood clotting via centrifugation), muscle tissue, and liver were collected and stored at −80 °C for further analysis.

2.4. Determination of Blood Biochemical Parameters

Serum biochemical parameters were determined following the instructions provided with the respective assay kits. The analysis included the measurement of muscle glycogen (MG), hepatic glycogen (HG), lactate, lactate dehydrogenase (LDH), catalase, lipid peroxides, and total superoxide dismutase (T-SOD) levels. All test kits were obtained from the Nanjing Jiancheng Bioengineering Institute.

2.5. Anti-Fatigue Gene PCR Expression

Total RNA was extracted from the liver using a TRIzol reagent, and the extracted RNA was quantified using a NanoDrop (Thermo Fisher, Waltham, MA, USA). The cDNA was synthesized using the FastKing cDNA First Strand Synthesis Kit, and quantitative PCR (qPCR) was performed using SYBR Green qPCR mixture (Tiangen Biochemical Technology Co. Beijing, China). PCR thermocycling conditions were denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 35 s, with a final extension at 72 °C for 35 s for a total of 45 cycles. The Primer sequences for the genes are listed in Table 1.

2.6. Statistical Analysis

All values are presented as mean ± standard deviation. The differences between the groups were assessed using Duncan’s multiple comparison test with SPSS ANOVA software (SPSS Statistics 23; IBM Corp., Armonk, NY, USA; p < 0.05). Significant results among the groups are indicated by the letters a, b, c, and d, with the relationship: a > b > c > d.

3. Results

3.1. HPLC Analysis of Black Ginseng Ginsenoside Content

The determination of black ginseng ginsenoside content is presented in Figure 1 and Table 2. Thirteen ginsenosides were identified based on their retention times compared to standards. The concentrations of these ginsenosides in black ginseng (values in brackets in μg/mL) were as follows: Rg1 (41.22), Re (61.80), Rb1 (122.03), Rc (50.14), Rb2 (55.49), S-Rg2 (45.90), R-Rg2 (14.44), Rh1 (9.59), Rd (24.25), S-Rg3 (158.84), R-Rg3 (63.97), RK1 (98.89), and Rg5 (92.69).

3.2. Impact on Exercise Training in Mice

The weight, food intake, and exercise test results of the mice during the experiment are summarized in Table 3. No significant differences were observed in the dietary intake or weight between the groups throughout this study. However, variations in exercise performance were observed with different doses of black ginseng ginsenoside supplementation. In the swimming test, the LBG did not show a significant effect compared to the control group, whereas both the MBG and HBG groups exhibited a notable increase in swimming time. In the rotating rod test, no significant differences were found between the LBG and control groups. In contrast, the MBG and HBG groups demonstrated a significant improvement in rod performance compared with the control group. The results of the running experiment indicated that the LBG, MBG, and HBG groups had significantly increased running times compared with the control group, with high-dose black ginseng ginsenoside supplementation producing the most pronounced effect on enhancing running endurance.

3.3. Serum Index Biological Parameters

The effects of black ginseng ginsenosides on biomarkers of fatigue in mice are shown in Figure 2. Compared with the control group, muscle and hepatic glycogen levels increased significantly in the MBG and HBG groups but not in the LBG group. Compared with the control group, serum lactate levels decreased significantly in each of the black ginseng ginsenoside doses tested. Conversely, serum LDH activity significantly increased in the MBG and HBG groups compared to that in the control group. Serum catalase activity was significantly increased at all three black ginseng saponin doses tested. Compared to the control group, the MBG and HBG groups showed significant regulatory effects on lipid peroxide levels in serum. Compared with the control group, the LBG, MBG, and HBG groups showed significantly decreased serum T-SOD levels, with the effect being larger in the MBG and HBG groups.

3.4. Real-Time PCR Analysis

The results of the gene analysis are shown in Figure 3. Compared to the control group, the expression levels of CAT-2 and Scd-2 in the LBG, MBG, and HBG groups were significantly increased, with the greatest effects occurring in the HBG. Compared to the control group, the expression levels of NRF1, NRE2L2, TFAM, MtCOX2, and MtND1 in the LBG, MBG, and HBG groups were significantly increased. The HBG group exhibited a more significant effect on the regulation of NRF1, NRE2L2, TFAM, MtCOX2, and MtND1 than the LBG and MBG groups.

4. Discussion

This study evaluated the effects of black ginseng ginsenosides on exercise performance through swimming, running, and rotating rod experiments. Notably, while the group did not demonstrate significant differences in swimming performance compared to the control group, both the MBG and HBG groups showed marked improvements in swimming time. This aligns with previous research suggesting that saponins may enhance endurance by increasing energy metabolism and reducing fatigue [35,36]. In the rotating rod test, the LBG group did not differ significantly from the control group, whereas the MBG and HBG groups performed significantly better. This finding indicates that higher doses of black ginseng ginsenosides may be necessary to effectively enhance motor coordination and resistance to fatigue [37]. Similarly, the running experiment revealed that all three doses of black ginseng ginsenosides significantly increased running times relative to the control group, with the HBG group demonstrating the most pronounced effect. This suggests a dose-dependent relationship between the fatigue-reducing properties of black ginseng ginsenosides, supporting the notion that higher concentrations may optimize athletic performance. Overall, these results indicate that black ginseng ginsenosides, particularly at medium-to-high doses, can effectively enhance exercise performance across different modalities.
Serum biochemical analysis highlighted the regulatory effects of black ginseng ginsenosides on various indicators of fatigue in mice. Notably, while the LBG group did not show significant changes in muscle and hepatic glycogen levels compared with the control group, both the MBG and HBG groups demonstrated substantial increases in these parameters. Elevated glycogen levels suggest enhanced energy availability during exercise, which potentially improves endurance [38].
Furthermore, serum lactate levels significantly decreased in the LBG, MBG, and HBG groups, indicating a reduction in anaerobic metabolism and muscle fatigue [39,40]. LDH is a marker of metabolic stress and was notably increased in the MBG and HBG groups, reinforcing the protective effects of black ginseng ginsenosides against exercise-induced fatigue [32,41,42]. Additionally, the significant increase in catalase levels across all black ginseng ginsenoside-treated groups suggests an enhanced antioxidant defense mechanism, which is crucial for mitigating the oxidative stress associated with prolonged physical activity [43]. The regulation of lipid peroxide levels by MBG and HBG indicates a reduction in oxidative damage, further supporting the protective role of black ginseng ginsenosides against fatigue. Finally, T-SOD levels were significantly improved in all treatment groups, with MBG and HBG exhibiting the most pronounced effects. This indicates that the upregulation of antioxidant enzymes contributes to the overall reduction in oxidative stress and fatigue during exercise [44]. Collectively, these findings suggest that black ginseng ginsenosides effectively enhance exercise performance and reduce fatigue through multiple biochemical pathways.
NO levels are critical during skeletal muscle contraction. Changes in NO levels play a role in muscle fatigue [45]. Studies have shown that CAT-2 plays an important role in inhibiting NO production [46]. Scd-2 plays essential roles in regulating lipid metabolism and maintaining mitochondrial function, both of which are vital for energy production. The observed increase in CAT-2 and Scd-2 expression in the LBG, MBG, and HBG groups suggests that black ginseng ginsenosides enhance cellular antioxidant capacity and improve mitochondrial function, which may reduce oxidative damage during strenuous exercise [47,48]. Notably, the HBG group exhibited the most pronounced effect, indicating a dose-dependent relationship that aligns with enhanced anti-fatigue properties. NRF1 and NRE2L2 are transcription factors that regulate the expression of genes involved in antioxidant defense and mitochondrial biogenesis. The activation of NRE2L2 leads to the upregulation of various antioxidant enzymes, thereby enhancing the cellular response to oxidative stress [49,50]. TFAM is essential for mitochondrial DNA replication and transcription, whereas MtCOX2 and MtND1 are critical components of the mitochondrial respiratory chain that play key roles in ATP synthesis. Our results showed that black ginseng ginsenosides significantly increased the expression of NRF1, NRE2L2, TFAM, MtCOX2, and MtND1 in all treatment groups, with the HBG group showing the most substantial regulatory effects. This suggests that ginseng saponins promote mitochondrial biogenesis and enhance oxidative phosphorylation, leading to improved energy production and reduced fatigue [51,52]. The enhanced antioxidant capacity of CAT-2 and Scd-2 contributes to a favorable environment for mitochondrial function, which is further supported by the activation of NRF1 and NRE2L2. This synergy ensures that cellular energy production is optimized, oxidative stress is minimized, and the overall muscle performance is improved. In conclusion, the anti-fatigue effects of black ginseng ginsenosides are mediated by the activation of both the CAT-2/Scd-2 and NRF1/NRE2L2/TFAM/MtCOX2/MtND1 signaling pathways. These findings provide valuable insights into the biochemical mechanisms underlying the health benefits of black ginseng ginsenosides and highlight their potential as therapeutic agents to enhance physical performance and combat fatigue.
The results from animal model studies provide valuable insights into potential implications for human metabolism. While there are inherent differences between species, animal studies often serve as a preliminary platform for understanding complex biological mechanisms. In the context of our research on black ginseng ginsenosides, the demonstrated anti-fatigue effects, coupled with improvements in antioxidant capacity and mitochondrial function, suggest several relevant implications for human health. Animal models have shown that oxidative stress plays a significant role in fatigue and metabolic disorders [53]. By improving antioxidant capacity, black ginseng ginsenosides may mitigate oxidative damage, reducing fatigue in humans, especially in conditions of physical stress or chronic fatigue syndrome. Mitochondria are crucial for energy production and metabolic health. Enhancements in mitochondrial function observed in our animal studies may indicate similar benefits for human subjects. For instance, improved mitochondrial biogenesis and function can lead to better energy metabolism, potentially aiding in exercise performance and recovery [54].

5. Conclusions

This study examined the anti-fatigue effects of black ginseng ginsenosides using exercise performance tests, serum analyses, and gene expression profiling. In the exercise tests, no significant differences in dietary intake or body weight were observed between the groups. The LBG group did not show significant improvements in the swimming test compared to the control group, whereas both the MBG and HBG groups demonstrated notable increases in swimming time. There were significant improvements in the MBG and HBG groups compared to the control group in the rotating rod test. The LBG, MBG, and HBG groups showed significantly longer running times, with the HBG group showing the most pronounced effect on endurance. Serum analysis indicated significant increases in muscle and hepatic glycogen levels in the MBG and HBG groups compared to those in the control group, along with decreased lactate, lipid peroxides, and T-SOD levels. Additionally, the MBG and HBG groups showed significantly increased LDH and catalase levels, highlighting the enhanced antioxidant activity. Gene expression analysis revealed a significant upregulation of CAT-2, Scd-2, NRF1, NRE2L2, TFAM, MtCOX2, and MtND1 in all treatment groups, with the HBG group exhibiting the strongest regulatory effects, indicating improved mitochondrial function and antioxidant capacity. While this study presents compelling evidence for the anti-fatigue effects of black ginseng ginsenosides through enhanced antioxidant capacity and improved mitochondrial function, several limitations must be acknowledged. The reliance on animal models may restrict the generalizability of our findings, underscoring the need for future clinical trials. Additionally, although this research concentrated on biochemical and physiological parameters, the potential impact of black ginseng ginsenosides on cognitive fatigue and psychological well-being warrants further exploration. Incorporating subjective assessments of fatigue and quality of life in future studies could yield a more comprehensive understanding of the effects of ginsenosides.

Author Contributions

Methodology resources, formal analysis, investigation, writing original draft: S.G. Writing review and editing: J.L. Formal analysis, conceptualization: X.T. Investigation, editing: K.W. Conceptualization, investigation: L.H. Formal analysis, investigation: W.S. Resources, data curation: G.Z. Resources, supervision, funding acquisition: B.Z. Project administration, supervision, funding acquisition: F.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the earmarked fund for the Jilin Province University Student Science and Technology Innovation Project (GJ202411439014), Jilin Provincial Science and Technology Department Development Plan Project (20240303045NC), Jilin City Science and Technology Innovation Development Plan Project (20240503011), National Key R&D Projects (2021YFD1600903), and Jilin Agricultural Science and Technology University—Key Discipline of Food Science and Engineering.

Institutional Review Board Statement

This study was approved by the Animal Ethics Committee of Jilin Agriculture Science and Technology University (Approval Number: LLSC202305001).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The author declares that there are no conflicts of interest.

References

  1. Yu, W.; Cai, S.; Zhao, J.; Hu, S.; Zang, C.; Xu, J.; Hu, L. Beyond genome: Advanced omics progress of Panax ginseng. Plant Sci. 2024, 341, 112022. [Google Scholar] [CrossRef] [PubMed]
  2. Xu, W.; Lyu, W.; Duan, C.; Ma, F.; Li, X.; Li, D. Preparation and bioactivity of the rare ginsenosides Rg3 and Rh2: An updated review. Fitoterapia 2023, 167, 105514. [Google Scholar] [CrossRef] [PubMed]
  3. Zhao, W.; Zhang, X.; Wang, W.; Zhang, L. Experimental study for the anti-fatigue effect of ginseng general ginsenosides P.E. in vivo. Wei Sheng Yan Jiu 2009, 38, 184–187. [Google Scholar] [PubMed]
  4. Tang, W.; Zhang, Y.; Gao, J.; Ding, X.; Gao, S. The anti-fatigue effect of 20(R)-ginsenoside Rg3 in mice by intranasally administration. Biol. Pharm. Bull. 2008, 31, 2024–2027. [Google Scholar] [CrossRef]
  5. Metwaly, A.M.; Zhu, L.; Huang, L.; Dou, D. Black Ginseng and Its Saponins: Preparation, Phytochemistry and Pharmacological Effects. Molecules 2019, 24, 1856. [Google Scholar] [CrossRef]
  6. Huang, L.; Li, H.J.; Wu, Y.C. Processing technologies, phytochemistry, bioactivities and applications of black ginseng-a novel manufactured ginseng product: A comprehensive review. Food Chem. 2023, 407, 134714. [Google Scholar] [CrossRef]
  7. Wei, W.; Liu, X.; Tao, Y.; Wang, Y.; Gong, J.; Liu, S. Saponin composition comparison of black ginseng and white ginseng by liquid chromatography-mass spectrometry combined with multivariate statistical analysis. Nat. Prod. Res. 2023, 37, 3297–3301. [Google Scholar] [CrossRef]
  8. Wang, C.Z.; Zhang, C.F.; Zhang, Q.H.; Yuan, C.S. Phytochemistry of Red Ginseng, a Steam-Processed Panax ginseng. Am. J. Chin. Med. 2024, 52, 35–55. [Google Scholar] [CrossRef]
  9. Fan, W.; Fan, L.; Wang, Z.; Mei, Y.; Liu, L.; Li, L.; Yang, L.; Wang, Z. Rare ginsenosides: A unique perspective of ginseng research. J. Adv. Res. 2024, 01, 003. [Google Scholar] [CrossRef]
  10. Yoo, S.; Park, B.I.; Kim, D.H.; Lee, S.; Lee, S.H.; Shim, W.S.; Seo, Y.K.; Kang, K.; Lee, K.T.; Yim, S.V.; et al. Ginsenoside Absorption Rate and Extent Enhancement of Black Ginseng (CJ EnerG) over Red Ginseng in Healthy Adults. Pharmaceutics 2021, 13, 487. [Google Scholar] [CrossRef]
  11. Huo, R.; Wang, M.; Wei, X.; Qiu, Y. Research Progress on Anti-Inflammatory Mechanisms of Black Ginseng. Chem. Biodivers. 2023, 20, e202200846. [Google Scholar] [CrossRef] [PubMed]
  12. Lee, D.K.; Park, S.; Long, N.P.; Min, J.E.; Kim, H.M.; Yang, E.; Lee, S.J.; Lim, J.; Kwon, S.W. Research Quality-Based Multivariate Modeling for Comparison of the Pharmacological Effects of Black and Red Ginseng. Nutrients 2020, 12, 2590. [Google Scholar] [CrossRef] [PubMed]
  13. Song, J.H.; Kim, K.J.; Chei, S.; Seo, Y.J.; Lee, K.; Lee, B.Y. Korean Red Ginseng and Korean black ginseng extracts, JP5 and BG1, prevent hepatic oxidative stress and inflammation induced by environmental heat stress. J. Ginseng Res. 2020, 44, 267–273. [Google Scholar] [CrossRef]
  14. Moore, R.D.; Romine, M.W.; O’Connor, P.J.; Tomporowski, P.D. The influence of exercise-induced fatigue on cognitive function. J. Sports Sci. 2012, 30, 841–850. [Google Scholar] [CrossRef]
  15. Marcora, S.M.; Staiano, W.; Manning, V. Mental fatigue impairs physical performance in humans. J. Appl. Physiol. 2009, 106, 857–864. [Google Scholar] [CrossRef]
  16. Zheng, Y.; Ren, X.; Qi, X.; Song, R.; Zhao, C.; Ma, J.; Li, X.; Deng, Q.; He, Y.; Kong, L.; et al. Bao Yuan decoction alleviates fatigue by restraining inflammation and oxidative stress via the AMPK/CRY2/PER1 signaling pathway. J. Ethnopharmacol. 2024, 328, 118058. [Google Scholar] [CrossRef]
  17. Zhou, S.S.; Zhou, J.; Xu, J.D.; Shen, H.; Kong, M.; Yip, K.M.; Han, Q.B.; Zhao, Z.Z.; Xu, J.; Chen, H.B.; et al. Ginseng ameliorates exercise-induced fatigue potentially by regulating the gut microbiota. Food Funct. 2021, 12, 3954–3964. [Google Scholar] [CrossRef] [PubMed]
  18. Oliynyk, S.; Oh, S. Actoprotective effect of ginseng: Improving mental and physical performance. J. Ginseng Res. 2013, 37, 144–166. [Google Scholar] [CrossRef]
  19. Liu, X.L.; Zhao, Y.C.; Chen, X.Y.; She, X.X.; Sadia, K.; Jiang, Y.; Xie, H.Y.; Jiang, B.N.; Zheng, Y.A.; Liu, W.C.; et al. Anti-fatigue effect and molecular mechanism of black ginseng polysaccharides in mice. Food Sci. 2020, 41, 173–179. [Google Scholar] [CrossRef]
  20. Nam, K.Y.; Kim, Y.S.; Shon, M.Y.; Park, J.D. Recent advances in studies on chemical constituents and biological activities of Korean black ginseng (Panax ginseng CA Meyer). Korean J. Pharmacogn. 2015, 46, 173–188. [Google Scholar]
  21. Stevens, B.R.; Kakuda, D.K.; Yu, K.; Waters, M.; Vo, C.B.; Raizada, M.K. Induced nitric oxide synthesis is dependent on induced alternatively spliced CAT-2 encoding L-arginine transport in brain astrocytes. J. Biol. Chem. 1996, 271, 24017–24022. [Google Scholar] [CrossRef] [PubMed]
  22. Kakuda, D.K.; Sweet, M.J.; Mac Leod, C.L.; Hume, D.A.; Markovich, D. CAT2-mediated L-arginine transport and nitric oxide production in activated macrophages. Biochem. J. 1999, 340 Pt 2, 549–553. [Google Scholar] [CrossRef] [PubMed]
  23. Mosher, S.L.; Sparks, S.A.; Williams, E.L.; Bentley, D.J.; Mc Naughton, L.R. Ingestion of a Nitric Oxide Enhancing Supplement Improves Resistance Exercise Performance. J. Strength. Cond. Res. 2016, 30, 3520–3524. [Google Scholar] [CrossRef] [PubMed]
  24. Bryan, N.S.; Burleigh, M.C.; Easton, C. The oral microbiome, nitric oxide and exercise performance. Nitric Oxide 2022, 125–126, 23–30. [Google Scholar] [CrossRef] [PubMed]
  25. Guillou, H.; Zadravec, D.; Martin, P.G.; Jacobsson, A. The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog. Lipid Res. 2010, 49, 186–199. [Google Scholar] [CrossRef]
  26. Cohen, P.; Friedman, J.M. Leptin and the control of metabolism: Role for stearoyl-CoA desaturase-1 (SCD-1). J. Nutr. 2004, 134, 2455S–2463S. [Google Scholar] [CrossRef]
  27. He, F.; Ru, X.; Wen, T. NRF2, a Transcription Factor for Stress Response and Beyond. Int. J. Mol. Sci. 2020, 21, 4777. [Google Scholar] [CrossRef]
  28. Ryoo, I.G.; Kwak, M.K. Regulatory crosstalk between the oxidative stress-related transcription factor Nfe2l2/Nrf2 and mitochondria. Toxicol. Appl. Pharmacol. 2018, 359, 24–33. [Google Scholar] [CrossRef]
  29. Biswas, M.; Chan, J.Y. Role of Nrf1 in antioxidant response element-mediated gene expression and beyond. Toxicol. Appl. Pharmacol. 2010, 244, 16–20. [Google Scholar] [CrossRef]
  30. Hu, S.; Feng, J.; Wang, M.; Wufuer, R.; Liu, K.; Zhang, Z.; Zhang, Y. Nrf1 is an indispensable redox-determining factor for mitochondrial homeostasis by integrating multi-hierarchical regulatory networks. Redox Biol. 2022, 57, 102470. [Google Scholar] [CrossRef]
  31. Zhang, M.; An, C.; Gao, Y.; Leak, R.K.; Chen, J.; Zhang, F. Emerging roles of Nrf2 and phase II antioxidant enzymes in neuroprotection. Prog. Neurobiol. 2013, 100, 30–47. [Google Scholar] [CrossRef] [PubMed]
  32. Kanki, T.; Ohgaki, K.; Gaspari, M.; Gustafsson, C.M.; Fukuoh, A.; Sasaki, N.; Hamasaki, N.; Kang, D. Architectural role of mitochondrial transcription factor A in maintenance of human mitochondrial DNA. Mol. Cell Biol. 2004, 24, 9823–9834. [Google Scholar] [CrossRef] [PubMed]
  33. Kang, I.; Chu, C.T.; Kaufman, B.A. The mitochondrial transcription factor TFAM in neurodegeneration: Emerging evidence and mechanisms. FEBS Lett. 2018, 592, 793–811. [Google Scholar] [CrossRef]
  34. Busch, J.D. MitoRibo-Tag Mice—A Novel Tool to Study the Composition of the Mitochondrial Ribosome In Vivo. Doctoral Dissertation, Universität zu Köln, Köln, Germany, 2019. [Google Scholar]
  35. Lin, M.; Hu, S.; Zeng, Q.; Xiao, B.; He, Y. Screening anti-fatigue components of American ginseng saponin by analyzing spectrum-effect relationship coupled with UPLC-Q-TOF-MS. Asian Biomed. 2023, 17, 163–172. [Google Scholar] [CrossRef]
  36. Zhang, G.; Lu, B.; Wang, E.; Wang, W.; Li, Z.; Jiao, L.; Li, H.; Wu, W. Panax ginseng improves physical recovery and energy utilization on chronic fatigue in rats through the PI3K/AKT/mTOR signalling pathway. Pharm. Biol. 2023, 61, 316–323. [Google Scholar] [CrossRef]
  37. Choi, J.Y.; Woo, T.S.; Yoon, S.Y.; Ike Campomayor Dela, P.; Choi, Y.J.; Ahn, H.S.; Lee, Y.S.; Yu, G.Y.; Cheong, J.H. Red ginseng supplementation more effectively alleviates psychological than physical fatigue. J. Ginseng Res. 2011, 35, 331–338. [Google Scholar] [CrossRef] [PubMed]
  38. Kim, J.; Beak, S.; Ahn, S.; Moon, B.S.; Kim, B.S.; Lee, S.J.; Oh, S.J.; Park, H.Y.; Kwon, S.H.; Shin, C.H.; et al. Effects of taurine and ginseng extracts on energy metabolism during exercise and their anti-fatigue properties in mice. Nutr. Res. Pract. 2022, 16, 33–45. [Google Scholar] [CrossRef]
  39. Jo, G.S.; Chai, H.Y.; Ji, H.J.; Kang, M.H.; Kang, S.J.; Ji, J.G.; Kim, D.J.; Lee, B.J. Enhancement of exercise capacity by black ginseng extract in rats. Lab. Anim. Res. 2010, 26, 279–286. [Google Scholar] [CrossRef]
  40. Avakian, E.V.; Sugimoto, R.B.; Taguchi, S.; Horvath, S.M. Effect of Panax ginseng extract on energy metabolism during exercise in rats. Planta Med. 1984, 50, 151–154. [Google Scholar] [CrossRef]
  41. Liu, Y.; Li, C.; Shen, X.; Liu, Y. The use of traditional Chinese medicines in relieving exercise-induced fatigue. Front. Pharmacol. 2022, 13, 969827. [Google Scholar] [CrossRef]
  42. Khajehlandi, M.; Janbozorgi, M. Effect of one session of resistance training with and without blood flow restriction on serum levels of creatine kinase and lactate dehydrogenase in female athletes. J. Clin. Basic Res. 2018, 2, 5–10. [Google Scholar] [CrossRef]
  43. Pereira, B.; Costa Rosa, L.F.; Safi, D.A.; Medeiros, M.H.; Curi, R.; Bechara, E.J. Superoxide dismutase, catalase, and glutathione peroxidase activities in muscle and lymphoid organs of sedentary and exercise-trained rats. Physiol. Behav. 1994, 56, 1095–1099. [Google Scholar] [CrossRef] [PubMed]
  44. Gomez-Cabrera, M.C.; Domenech, E.; Vina, J. Moderate exercise is an antioxidant: Upregulation of antioxidant genes by training. Free Radic. Biol. Med. 2008, 44, 126–131. [Google Scholar] [CrossRef] [PubMed]
  45. Ibrahim, M.Y.; Ashour, O.M. Changes in nitric oxide and free radical levels in rat gastrocnemius muscle during contraction and fatigue. Clin. Exp. Pharmacol. Physiol. 2011, 38, 791–795. [Google Scholar] [CrossRef]
  46. Tsai, P.S.; Chen, C.C.; Tsai, P.S.; Yang, L.C.; Huang, W.Y.; Huang, C.J. Heme oxygenase 1, nuclear factor E2–related factor 2, and nuclear factor κB are involved in hemin inhibition of type 2 cationic amino acid transporter expression and L-arginine transport in stimulated macrophages. J. Am. Soc. Anesthesiol. 2006, 105, 1201–1210. [Google Scholar] [CrossRef]
  47. Thirumalai, T.; Therasa, S.V.; Elumalai, E.; David, E. Intense and exhaustive exercise induce oxidative stress in skeletal muscle. Asian Pac. J. Trop. Dis. 2011, 1, 63–66. [Google Scholar] [CrossRef]
  48. Deaton, C.M.; Marlin, D.J. Exercise-associated oxidative stress. Clin. Tech. Equine Pract. 2003, 2, 278–291. [Google Scholar] [CrossRef]
  49. Powers, S.K.; Lategan-Potgieter, R.; Goldstein, E. Exercise-induced Nrf2 activation increases antioxidant defenses in skeletal muscles. Free Radic. Biol. Med. 2024, 224, 470–478. [Google Scholar] [CrossRef]
  50. Chen, L.; Ru, Q.; Xiong, Q.; Yang, J.; Xu, G.; Wu, Y. Potential Effects of Nrf2 in Exercise Intervention of Neurotoxicity Caused by Methamphetamine Oxidative Stress. Oxid. Med. Cell Longev. 2022, 2022, 4445734. [Google Scholar] [CrossRef]
  51. Zhang, H.; Zhao, C.; Hou, J.; Su, P.; Yang, Y.; Xia, B.; Zhao, X.; He, R.; Wang, L.; Cao, C.; et al. Red ginseng extract improves skeletal muscle energy metabolism and mitochondrial function in chronic fatigue mice. Front. Pharmacol. 2022, 13, 1077249. [Google Scholar] [CrossRef]
  52. Lu, G.; Liu, Z.; Wang, X.; Wang, C. Recent Advances in Panax ginseng C.A. Meyer as a Herb for Anti-Fatigue: An Effects and Mechanisms Review. Foods 2021, 10, 1030. [Google Scholar] [CrossRef]
  53. Kennedy, G.; Spence, V.A.; McLaren, M.; Hill, A.; Underwood, C.; Belch, J.J. Oxidative stress levels are raised in chronic fatigue syndrome and are associated with clinical symptoms. Free. Radic. Biol. Med. 2005, 39, 584–589. [Google Scholar] [CrossRef] [PubMed]
  54. Roberts, F.L.; Markby, G.R. New insights into molecular mechanisms mediating adaptation to exercise; A review focusing on mitochondrial biogenesis, mitochondrial function, mitophagy and autophagy. Cells 2021, 10, 2639. [Google Scholar] [CrossRef] [PubMed]
Life 14 01467 g001
Figure 1. High-performance liquid chromatography profiles. (A) High-performance liquid chromatography profiles of ginsenoside standards; (B) high-performance liquid chromatography profiles of ginsenosides in black ginseng.
Figure 1. High-performance liquid chromatography profiles. (A) High-performance liquid chromatography profiles of ginsenoside standards; (B) high-performance liquid chromatography profiles of ginsenosides in black ginseng.
Life 14 01467 g001
Life 14 01467 g002
Figure 2. The effect of black ginseng ginsenoside treatment on the tissue and serum markers of fatigue in mice. (A) Muscle glycogen, (B) hepatic glycogen, (C) lactate, (D) lactate dehydrogenase, (E) catalase, (F) lipid peroxides, and (G) total superoxide dismutase. The animals were gavaged daily for 21 d with either a low—(LBG group, 300 mg/kg), medium—(MBG group, 400 mg/kg), or high—(HBG group, 500 mg/kg) dose of black ginseng ginsenoside extract. Following an exercise challenge involving treadmill running, swimming, and rotating rod exercises, the mice were killed, and serum samples were obtained. The results are the mean ± standard deviation. The values bearing different superscripted letters are significantly different.
Figure 2. The effect of black ginseng ginsenoside treatment on the tissue and serum markers of fatigue in mice. (A) Muscle glycogen, (B) hepatic glycogen, (C) lactate, (D) lactate dehydrogenase, (E) catalase, (F) lipid peroxides, and (G) total superoxide dismutase. The animals were gavaged daily for 21 d with either a low—(LBG group, 300 mg/kg), medium—(MBG group, 400 mg/kg), or high—(HBG group, 500 mg/kg) dose of black ginseng ginsenoside extract. Following an exercise challenge involving treadmill running, swimming, and rotating rod exercises, the mice were killed, and serum samples were obtained. The results are the mean ± standard deviation. The values bearing different superscripted letters are significantly different.
Life 14 01467 g002
Life 14 01467 g003
Figure 3. The expression of hepatic genes involved in fatigue determined by real-time PCR. The relative mRNA levels are presented as the mean ± standard deviation. The values bearing different superscripted letters are significantly different. (A) CAT-2, cationic amino acid transporter 2; (B) Scd-2, stearoyl-CoA desaturase-2; (C) NRF1, nuclear respiratory factor 1; (D) NRE2L2, nuclear factor erythroid 2–related factor 2; (E) TFAM, mitochondrial transcription factor A; (F) MtCOX2, cytochrome c oxidase II; and (G) MtND1, mitochondrial NADH–ubiquinone oxidoreductase core subunit 1.
Figure 3. The expression of hepatic genes involved in fatigue determined by real-time PCR. The relative mRNA levels are presented as the mean ± standard deviation. The values bearing different superscripted letters are significantly different. (A) CAT-2, cationic amino acid transporter 2; (B) Scd-2, stearoyl-CoA desaturase-2; (C) NRF1, nuclear respiratory factor 1; (D) NRE2L2, nuclear factor erythroid 2–related factor 2; (E) TFAM, mitochondrial transcription factor A; (F) MtCOX2, cytochrome c oxidase II; and (G) MtND1, mitochondrial NADH–ubiquinone oxidoreductase core subunit 1.
Life 14 01467 g003
Table 1. The primer sequence of the genes.
Table 1. The primer sequence of the genes.
GeneForward PrimerReverse Primer
CAT-2ATCTTCTCCATCGTGGGCTTCATCCATGGATATGTGTACTTC
Scd-2TGGTGCCCTGGTACTGCTCGATGAAGAACGTGGTGAAG
NRF1GGCGGGAGGACCTTCTGTATGCGGCCCAATTTTGTTCCACCTCTCC
NRE2L2CAGCCCAGCACATCCAGACAGAGAATATCCAGGGCAAGCGACTCAT
TFAMCGGGGAATGTGGGGCGTGCTAAGCGTTTCTGCCGGGCTTCCTTCTC
MtCOX2ACAAGACGCCACATCACCTATCATTACTTCTTGGGCGTCTATTGTGCT
MtND1GCAAAGGCCCCAACATCGTAGTAAGGGGGTGAGGTATTGGTAAGG
Table 2. Retention time and content of black ginseng ginsenosides.
Table 2. Retention time and content of black ginseng ginsenosides.
No.NameRetention Time (min)Content (μg/mL)
1Rg132.31941.21893 ± 0.068
2Re32.45461.79905 ± 0.049
3Rb139.896122.02576 ± 0.042
4RC40.57350.13992 ± 0.015
5Rb241.15655.49115 ± 0.022
6S-Rg241.74945.89925 ± 0.029
7R-Rg241.94514.43858 ± 0.003
8Rh142.4409.59264 ± 0.003
9Rd42.74024.24622 ± 0.002
10S-Rg352.392158.83643 ± 0.062
11R-Rg353.00963.97367 ± 0.041
12RK161.86298.88668 ± 0.046
13Rg562.90592.69036 ± 0.013
Total839.23864 ± 0.212
Table 3. The results of the feeding, body weight, and exercise experiment on the mice supplemented with black ginseng ginsenosides.
Table 3. The results of the feeding, body weight, and exercise experiment on the mice supplemented with black ginseng ginsenosides.
GroupsFood Intake
(g/d)		Final Weight
(g)		Swimming
Time (min)		Rotating Rod
Time (s)		Running Time
(s)
Control group5.33 ± 0.26 a33.32 ± 1.92 a17.17 ± 1.28 b1371.04 ± 41.25 c809.00 ± 33.80 d
LBG5.31 ± 0.18 a32.56 ± 2.11 a17.49 ± 0.43 b1432.30 ± 30.67 c1344.00 ± 51.53 c
MBG5.29 ± 0.18 a32.54 ± 2.61 a21.06 ± 0.69 a1723.84 ± 84.77 b1777.00 ± 49.09 b
HBG5.36 ± 0.28 a32.68 ± 1.89 a21.97 ± 0.91 a1812.70 ± 67.16 a2095.00 ± 67.16 a
The results are the mean ± standard deviation (15 mice per group). Control group; LBG, low-dose black ginseng ginsenoside group (300 mg/kg); MBG, medium-dose black ginseng ginsenoside group (400 mg/kg); HBG, high-dose black ginseng ginsenoside group (500 mg/kg). The values within a column bearing different superscripted letters are significantly different.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ge, S.; Li, J.; Tai, X.; Wang, K.; Huang, L.; Su, W.; Zhang, G.; Zhong, B.; Li, F. Ginsenoside-Enriched Extract from Black Ginseng Anti-Fatigue Effects by Improving Antioxidant Capacity and Mitochondrial Function. Life 2024, 14, 1467. https://doi.org/10.3390/life14111467

AMA Style

Ge S, Li J, Tai X, Wang K, Huang L, Su W, Zhang G, Zhong B, Li F. Ginsenoside-Enriched Extract from Black Ginseng Anti-Fatigue Effects by Improving Antioxidant Capacity and Mitochondrial Function. Life. 2024; 14(11):1467. https://doi.org/10.3390/life14111467

Chicago/Turabian Style

Ge, Shunji, Jiating Li, Xueyue Tai, Kuo Wang, Liyan Huang, Weixin Su, Guoqi Zhang, Bao Zhong, and Fenglin Li. 2024. "Ginsenoside-Enriched Extract from Black Ginseng Anti-Fatigue Effects by Improving Antioxidant Capacity and Mitochondrial Function" Life 14, no. 11: 1467. https://doi.org/10.3390/life14111467

APA Style

Ge, S., Li, J., Tai, X., Wang, K., Huang, L., Su, W., Zhang, G., Zhong, B., & Li, F. (2024). Ginsenoside-Enriched Extract from Black Ginseng Anti-Fatigue Effects by Improving Antioxidant Capacity and Mitochondrial Function. Life, 14(11), 1467. https://doi.org/10.3390/life14111467

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop