Next Article in Journal
Triplex Crystal Digital PCR for the Detection and Differentiation of the Wild-Type Strain and the MGF505-2R and I177L Gene-Deleted Strain of African Swine Fever Virus
Previous Article in Journal
Evaluation of a Tetracycline-Resistant E. coli Enumeration Method for Correctly Classifying E. coli in Environmental Waters in Kentucky, USA
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 9
10.3390/pathogens12091091
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China

by
Kaichuang Shi
1,2,*,†,
Hongjin Zhou
1,†,
Shuping Feng
2,
Junxian He
1,
Biao Li
1,
Feng Long
2,
Yuwen Shi
1,
Yanwen Yin
2 and
Zongqiang Li
1,*
1
College of Animal Science and Technology, Guangxi University, Nanning 530005, China
2
Guangxi Center for Animal Disease Control and Prevention, Nanning 530001, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2023, 12(9), 1091; https://doi.org/10.3390/pathogens12091091
Submission received: 19 July 2023 / Revised: 21 August 2023 / Accepted: 25 August 2023 / Published: 28 August 2023
(This article belongs to the Special Issue Swine Viral Diseases: 2nd Edition)
Browse Figures
Review Reports Versions Notes

Abstract

:
Rotavirus A species (RVA), RVB, RVC, and RVH are four species of rotaviruses (RVs) that are prevalent in pig herds, and co-infections occur frequently. In this study, a quadruplex real-time quantitative RT-PCR (RT-qPCR) for the simultaneous detection of four porcine RVs was developed by designing specific primers and probes based on the VP6 gene of RVA, RVB, RVC, and RVH, respectively. The method showed high specificity and could only detect RVA, RVB, RVC, and RVH, without cross-reaction with other porcine viruses; showed excellent sensitivity, with a limit of detection (LOD) of 1.5 copies/µL for each virus; showed good repeatability, with intra-assay coefficients of variation (CVs) of 0.15–1.14% and inter-assay CVs of 0.07–0.96%. A total of 1447 clinical fecal samples from Guangxi province in China were tested using the developed quadruplex RT-qPCR. The results showed that RVA (42.71%, 618/1447), RVB (26.95%, 390/1447), RVC (42.92%, 621/1447), and RVH (13.68%, 198/1447) were simultaneously circulating in the pig herds, and the co-infection rate of different species of rotaviruses was found to be up to 44.01% (579/1447). The clinical samples were also detected using one previously reported method, and the coincidence rate of the detection results using two methods was more than 99.65%. The phylogenetic tree based on the VP6 gene sequences of RVH revealed that the porcine RVH strains from Guangxi province belonged to the genotype I5, which was closely related to Japanese and Vietnamese strains. In summary, an efficient, sensitive, and accurate method for the detection and differentiation of RVA, RVB, RVC, and RVH was developed and applied to investigate the prevalence of porcine RVs in Guangxi province, China. This study is the first to report the prevalence of porcine RVH in China.

1. Introduction

Rotaviruses (RVs) are non-enveloped RNA viruses belonging to the genus Rotavirus in the family Reoviridae and are the main pathogens causing gastroenteritis in various hosts, such as human beings, birds, and mammals [1]. The viral genome consists of 11 segments of double-stranded RNA encoding six structural proteins (VP1-4, VP6, and VP7) and five non-structural proteins (NSP1-5/6) [2]. Based on the antigenicity and sequence diversity of the structural protein VP6, RVs can be classified into nine species, namely rotavirus A specie (RVA) to RVD, and RVF to RVJ, of which RVA, RVB, RVC, and RVH are the four RVs that have been identified in pigs to date [1,3,4].
Porcine RVA was first identified in diarrheic piglets from Australia in 1975, followed by RVB and RVC in piglets from the United Kingdom in 1980s and the United States in 1980, respectively [5,6,7]. Compared to RVB and RVC, RVA is considered to be the most predominant rotavirus due to its high detection rate in different pig herds [4,8]. Porcine RVC has been identified in many countries around the world [9,10,11,12,13,14]. After 2009, the prevalence of RVC infection in animals increased from 10% to 25% [14]. In recent years, an increasing number of countries have reported high positivity rates of porcine RVC. So far, the highest positivity rate of porcine RVC, which reached to 76.10%, was reported in the United States [15]. Porcine RVB has been reported in North America, South America, Europe, Asia, the United States, Canada, Brazil, Italy, Russia, Switzerland, Japan, and India [16,17,18,19,20,21,22]. The incidence of porcine RVB is usually lower than that of RVA and RVC, and porcine RVB is usually coinfected with other RVs, such as RVA and/or RVC [23,24]. However, in 2020, Brazil reported 66.4% of the samples were only positive for RVB, and no other porcine RV was found, indicating that RVB acted as an important primary enteric pathogen in piglets [25]. One research indicated that porcine RVH has spread in the United States since 2002 [26], but porcine RVH was first isolated from diarrheic pigs in Japan in 2011 [27]. To date, RVH has been discovered in different countries, such as Italy, the United States, Brazil, South Africa, Spain, and Vietnam [18,28,29,30,31,32]. RVE was first discovered in pigs in the United Kingdom in 1986 [33], but it has not been found elsewhere and even in the United Kingdon since then, so it has been dropped from classifications. So far, porcine RVs, including RVA, RVB, RVC, and RVH, have been reported in many countries around the world, and have caused huge losses to the pig industry [1,4,8].
Porcine RVs are important diarrheic pathogens to pigs, and the piglets suffering from diarrhea were often co-infected with multiple species of porcine RVs [9,20,24]; thus, it is of great significance to develop a method for the simultaneous detection and differentiation of different groups of porcine RVs in the clinical practice. Multiplex real-time quantitative PCR (qPCR) is a commonly used technique for viral detection owing to its high specificity, sensitivity, accuracy, high-throughput, and ability to detect several viruses in one tube during the same reaction [34,35]. So far, the multiplex qPCR has been developed for detection of two species of the four porcine RVs [18,36,37]. However, no multiplex RT-qPCR has been reported for the simultaneous detection of RVA, RVB, RVC, and RVH until now. Therefore, to meet the urgent needs of clinical practice, a quadruplex RT-qPCR assay was developed for the simultaneous detection and differentiation of RVA, RVB, RVC, and RVH in this study.

2. Materials and Methods

2.1. Vaccine Strains and Positive Clinical Samples

The vaccine strains of porcine epidemic diarrhea virus (PEDV, CV777 strain), RVA (NX strain), transmissible gastroenteritis virus (TGEV, H strain), foot-and-mouth disease virus (FMDV, O/Mya98/XJ/2010 strain), swine influenza virus (SIV, TJ strain), classical swine fever virus (CSFV, C strain), porcine reproductive and respiratory syndrome virus (PRRSV, TJM-F92 strain), pseudorabies virus (PRV, Bartha-K61 strain), and porcine circovirus type 2 (PCV2, SX07 strain) were bought from China Animal Husbandary Industry Co., Ltd. (Beijing, China) and stored at −80 °C until used.
The positive samples of porcine deltacoronavirus (PDCoV), African swine fever virus (ASFV), RVB, RVC, and RVH, which were confirmed by qPCR/RT-qPCR and sequencing, were provided by Guangxi Center for Animal Disease Control and Prevention (CADC), China, and stored at −80 °C until used.

2.2. Collection of the Clinical Samples

A total of 1447 clinical fecal samples were collected from 1447 diarrheic pigs in 9 regions of Guangxi province, southern China, from January 2021 to December 2022. The samples were transported to the laboratory at less than 4 °C within 12 h after collection and stored at −80 °C until used.

2.3. Design of Primers and Probes

The VP6 gene sequences of RVA, RVB, RVC, and RVH were downloaded from GenBank of the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/nucleotide/, accessed on 25 September 2021) and then aligned using Clustal W of DNAstar Ver 6.0 (https://www.dnastar.com/, accessed on 25 September 2021) to obtain the conserved regions of the sequences. Four pairs of specific primers and corresponding TaqMan probes were designed using Oligo software (Version 7.60) (https://www.oligo.net/, accessed on 25 September 2021) (Table 1), and their specificity was confirmed using the BLAST search tool from the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 25 September 2021).

2.4. Extraction of Nucleic Acid

The clinical fecal swabs were mixed with phosphate-buffered saline (PBS, pH7.2) (W/V, 20%), vortexed for 5 min, and centrifuged at 12,000 rpm for 10 min at 4 °C. Total DNA and RNA are extracted from 200 µL of the supernatants or vaccine solutions using MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (TaKaRa, Dalian, China) according to the manufacturer’s instructions, reverse transcribed to cDNA using PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) per the manufacturer’s instructions, and then stored at –80 °C until used.

2.5. Construction of the Standard Plasmids

The construction of the standard recombinant plasmids was performed as described by Liu et al. in a previous report [38] with minor modifications. Briefly, the targeted fragments of VP6 gene were amplified via PCR from the cDNAs of RVA, RVB, RVC, and RVH, purified, cloned into the pMD18-T vector (TaKaRa, Dalian, China), and transformed into E. coli DH5α cells (TaKaRa, Dalian, China). The recombinant standard plasmids were confirmed via sequencing, and named p-RVA, p-RVB, p-RVC, and p-RVH, respectively. The OD values at 260 nm and 280 nm of the standard plasmid was determined using a NanoDrop spectrophotometer (Thermo Fisher, Waltham, MA, USA), and the concentration was calculated using the following formula: p l a s m i d c o p i e s / µ L = 6.02   ×   10 23   ×   X   n g / µ L   ×   10 − 9 p l a s m i d   l e n g t h b p   ×   660 .

2.6. Optimization of the Reaction Parameters

To determine the optimal reaction conditions, the quadruplex RT-qPCR experiments with different annealing temperatures (56–62 °C) and concentrations of each primer and probe (20 pmol/µL, 0.2 µL–0.5 µL) were performed using the mixture of four standard plasmids as a template. All amplification reaction were performed using One-Step PrimeScript™ RT-PCR Kit (TaKaRa, Dalian, China) in QuantStudio 6 qPCR system (ABI, Carlsbad, CA, USA). The following amplification process was used: 42 °C for 5 min; 95 °C for 10 s; and then 40 cycles of 95 °C for 5 s and 58 °C for 34 s. The fluorescence signals were automatically recorded at the end of each cycle. The optimal reaction conditions were determined based on the criteria of maximum ΔRn and minimum cycle threshold (Ct).

2.7. Generation of the Standard Curves

The mixture of four standard plasmids (at a ratio of 1:1:1:1) with concentrations ranging from 1.5 × 108 to 1.5 × 102 copies/µL (final reaction concentrations: 1.5 × 107 to 1.5 × 101 copies/µL) was used as a template for amplification to generate the standard curves.

2.8. Analytical Specificity Analysis

The specificity of the quadruplex RT-qPCR was assessed using the total DNA/RNA of RVA, RVB, RVC, RVH, PEDV, TGEV, FMDV, SIV, CSFV, PRRSV, PRV, PDCoV, ASFV, and PCV2 as templates. The four standard plasmids were used as positive controls, and the negative fecal sample and distilled water were used as negative controls.

2.9. Analytical Sensitivity Analysis

The mixture of four standard plasmids (at a ratio of 1:1:1:1) with concentrations ranging from 1.5 × 108 to 1.5 × 10−1 copies/µL (final reaction concentrations: 1.5 × 107 to 1.5 × 10−2 copies/µL) was used as a template for amplification to evaluate the sensitivity of the quadruplex RT-qPCR. The limit of detection (LOD) of the method was determined based on Ct values obtained from the templates with different concentrations.

2.10. Repeatability Analysis

The mixture of four standard plasmids with three concentrations of 1.5 × 108, 1.5 × 106, 1.5 × 104 copies/µL (final reaction concentrations were 1.5 × 107, 1.5 × 105, 1.5 × 103 copies/µL) were used as template to amplify in triplicate one day to assess the intra-assay CVs, and in three different times to assess the inter-assay CVs. The repeatability and reproducibility of the method was determined based on the CVs values.

2.11. Detection of RVs in Clinical Samples

The total nucleic acids were extracted from 1447 clinical fecal samples from Guangxi province in China and then used to test RVA, RVB, RVC, and RVH using the developed quadruplex RT-qPCR. In addition, these samples were also tested using the RT-qPCR developed by Ferrari et al. [18], and the coincidence rate of two methods was calculated to further evaluate the feasibility of the developed assay in this study.

2.12. Phylogenetic Analysis Based on RVH VP6 Gene

A total of 25 RVH positive samples from different pig farms were selected randomly for amplification of VP6 gene using a pair of primers (RVH-VP6-F: GTGACCCACAAGGATGGATCTCAT; RVH-VP6-R: GAACACTGGATCCCAGTGCGTGAC) described in the previous report [31]. The total RNAs were extracted from the clinical samples, reverse transcribed to cDNA, and then used as templates to amplify the VP6 gene using Premix Taq™ (TaKaRa, Dalian, China). The amplified products were purified, ligated into the pMD18-T vector (TaKaRa, Dalian, China), and then transformed into E. coli DH5α. After culturing at 37 °C for 22–24 h, the positive clones were extracted and sequenced (BGI, Shenzhen, China). Then, the sequences were verified using the NCBI BLAST tool and aligned with the reference sequences using Clustal W in MEGAX. Finally, the phylogenetic tree based on the VP6 sequences, which were obtained from this study or downloaded from GenBank of NCBI (https://www.ncbi.nlm.nih.gov/nucleotide/, accessed on 25 September 2021) as reference sequences (Table 2), was constructed using the neighbor-joining (NJ) method of MEGA11.0 (https://www.megasoftware.net/, accessed on 25 September 2021) with 1000 bootstrap replications.

3. Results

3.1. Construction of the Standard Plasmids

The VP6 gene fragments of RVA, RVB, RVC, and RVH were amplified by PCR, respectively, and used to construct the recombinant standard plasmids. The plasmids were confirmed by sequencing, and named p-RVA, p-RVB, p-RVC, and p-RVH, respectively. The original concentrations of the standard plasmids p-RVA, p-RVB, p-RVC, and p-RVH were determined to be 3.26 × 1010, 1.78 × 1010, 2.62 × 1010, and 4.51 × 1010 copies/µL, respectively. They were adjusted to the same concentration of 1.50 × 1010 copies/µL and stored at −80 °C until used.

3.2. Optimization of the Reaction Conditions

After optimization of the reaction conditions of different annealing temperatures, and different primer and probe concentrations using orthogonal tests, the optimal parameters of the quadruplex RT-qPCR were obtained. The optimal reaction system in a total volume of 20 µL is shown in Table 3. The one-step amplification parameters were as follows: 42 °C for 5 min, 95 °C for 10 s, and then 40 cycles of 95 °C for 5 s, 58 °C for 34 s. The fluorescent signals were collected at the end of each cycle. The sample with a Ct value ≤ 36 was considered the positive sample and with a Ct value > 36 was considered the negative sample.

3.3. Generation of the Standard Curves

The mixture of four standard plasmids with concentrations from 1.5 × 108 to 1.5 × 102 copies/µL (final reaction concentration: 1.5 × 107 to 1.5 × 101 copies/µL) were used as templates to generate the standard curves. The results showed that RVA (slope = −3.117, R2 = 0.998, Eff% = 103.5), RVB (slope = −3.174, R2 = 0.999, Eff% = 104.7), RVC (slope = −3.280, R2 = 0.999, Eff% = 105.6), and RVH (slope = −3.239, R2 = 1, Eff% = 100.4) had good correlation coefficients (R2 ≥ 0.998) and amplification efficiencies (E) (Figure 1).

3.4. Specificity Analysis

The total DNA/RNA of PEDV, TGEV, FMDV, SIV, CSFV, PRRSV, PRV, PDCoV, ASFV, and PCV2 were used to evaluate the specificity of the developed quadruplex RT-qPCR. The results showed that the assay could only detect RVA, RVB, RVC, and RVH (with fluorescent signals) (Figure 2), and not cross-detected the other viruses (without fluorescent signals), indicating good specificity of the assay.

3.5. Sensitivity Analysis

The mixture of the four standard plasmid was 10-fold serially diluted, and the concentrations of 1.5 × 108 to 1.5 × 10−1 copies/µL (final reaction concentrations: 1.5 × 107 to 1.5 × 10−2 copies/µL) were used as templates for sensitivity assessment of the assay. The results showed that the LOD of RVA, RVB, RVC, and RVH was 1.5 × 100 copies/µL (final reaction concentration) (Figure 3).

3.6. Repeatability Analysis

The coefficient of variation (CV) in intra-assay and inter-assay of the four standard plasmids was calculated using the Ct values to evaluate the repeatability of the assay. The results showed that the intra-assay CV for repeatability and the inter-assay CV for reproducibility were 0.15–1.14% and 0.07–0.96%, respectively, indicating that the quadruplex RT-qPCR was stable and reproducible (Table 4).

3.7. The Prevalence of RVs in Clinical Samples

The 1447 clinical fecal samples from Guangxi province were tested using the quadruplex RT-qPCR. The results showed that the positivity rates of RVA, RVB, RVC, and RVH were 42.71% (618/1447), 26.95% (390/1447), 42.92% (621/1447) and 13.68% (198/1447), respectively (Table 5). The total infection rate, single infection rate, and co-infection rate of the samples were 65.10% (942/1447), 25.09% (363/1447) and 40.01% (579/1447), respectively. As for co-infection, the RVA + RVC co-infection showed the highest positivity rate of 10.09% (146/1447) of the dual infection, the RVA + RVB + RVC co-infection showed the highest positivity rate of 12.72% (184/1447) of the triple infection, while the RVA + RVB + RVC + RVH quadruple infection showed the positivity rate of 2.07% (30/1447).
The 1447 clinical samples were also tested using the multiplex RT-qPCR for detection of RVA-RVB and RVC-RVH reported by Ferrari et al. [18], and the positivity rates of RVA, RVB, RVC, and RVH were 42.36% (613/1447), 26.81% (388/1447), 43.26% (626/1447), and 13.68% (198/1447), respectively. The coincidence rates between these two methods were 99.65%, 99.86%, 99.65%, and 100% for RVA, RVB, RVC, and RVH, respectively (Table 6).

3.8. Phylogenetic Analysis Based on RVH VP6 Gene Sequences

The positive samples of RVH were randomly selected to use for further analysis of the viral genetic characterization. The VP6 gene fragments were amplified, sequenced, and analyzed. Finally, a total of 25 VP6 gene sequences of RVH were obtained and uploaded to NCBI GenBank (the accession numbers: OR039733-OR039733). The sequence alignment of porcine RVH VP6 gene revealed that the 25 gene sequences had 88.3–99.8% matching nucleotide identity with each other and had 82.4–94.1% matching nucleotide identity with other reference strains obtained from GenBank (Table 2). Phylogenetic analysis based on VP6 gene sequences revealed that all RVH strains obtained in this study belonged to genotype I5 (Figure 4). In addition, the RVH-GXQZ-2022-01 strain (accession number: OR039757), together with two RVH strains obtained from Chinese environmental samples (accession number: MK379308, MK379500), belonged to the same branch as Japanese and Vietnamese strains, while the other strains of this study belonged to another branch. These results suggested that the Chinese porcine RVH strains were more closely related to the RVH strains from Vietnam and Japan, than to the RVH strains from other countries, such as Spain, South Africa, Brazil, and the United States.

4. Discussion

To date, four different porcine RVs, including RVA, RVB, RVC, and RVH, have been discovered to infect pigs, and have been reported in many countries around the world [1,4,8]. A number of studies have shown that co-infections of the four porcine RVs often occur. Ferrari et al. reported that the co-infection rate of RVs in suckling pigs, weaned pigs, and fattening pigs in Italy was above 60% [18]. Baumann et al. reported that 71% of pigs in Switzerland were infected with multiple RVs, of which double infection of RVA + RVC (25%), and triple infection of RVA + RVB + RVC (36%) were the most common types of infection [20]. Molinari et al. reported that 86.4% samples from the United States had mixed RV infections, and RVA + RVB + RVC co-infections were as high as 24.3% [24]. Compared to the conventional PCR, the qPCR has the advantages of not needing electrophoresis, convenient operation, high sensitivity, excellent specificity, uneasy contamination, and high throughout [35]. Compared to the singleplex qPCR, the multiplex qPCR has the advantages of detection of several targets in one tube during the same reaction and is especially time-saving, labor-saving, cost-saving, and highly efficient [34]. Therefore, the multiplex qPCR has been widely used for the simultaneous detection of several pathogens in laboratories [34,35]. As for porcine RVs, since there exist co-infections of RVA, RVB, RVC, and RVH, it is necessary to establish a quadruplex qPCR to simultaneously detect and differentiate these four pathogens. So far, only the multiplex RT-qPCR for simultaneous detection of RVA + RVC, RVA + RVB, and RVC + RVH have been reported, and they could not simultaneously detect and distinguish three and more viruses of these four porcine RVs in clinical practice [18,36,37,38]. Therefore, four pairs of specific primers and probes were designed based on the conserved regions of the VP6 gene of RVA, RVB, RVC, and RVH, respectively, and a quadruplex RT-qPCR for the detection of these four porcine RVs was developed in this study. The developed assay showed good specificity, high sensitivity, and excellent repeatability. It could only amplify the targeted viruses, without cross-reaction with other swine viruses; It showed the LOD of 1.5 copies/µL (final reaction concentration) for all four viruses, with intra-assay CVs of 0.17–1.14% and inter-assay CVs of 0.07–0.96%. The assay was used to test the 1447 clinical samples and had a high coincidence rate of more than 99.65% with the reported reference multiplex RT-qPCR [18], which was also used to test these samples. The results verified the application of the developed assay in this study for the field samples.
The positivity rates of RVA, RVB, RVC, and RVH in the 1447 clinical samples were 42.71% (618/1447), 26.95% (390/1447), 42.92% (621/1447), and 13.68% (198/1447), respectively. All four porcine RVs were discovered in Guangxi province, and the positivity rate of rotavirus was 65.10% (942/1447), indicating that porcine RVs were widely prevalent in pig herds. Marthaler et al. reported that the positivity rates of RVA, RVB, and RVC were 62%, 33%, and 53% in the clinical samples from the United States, Mexico, and Canada, respectively [36]. In a recent report from Italy, the positivity rates of RVA, RVB, RVC, and RVH in 962 fecal samples were 53%, 45%, 43%, and 14%, respectively [18]. Our study demonstrated slightly lower or similar positivity rates of the four porcine RVs to those reports. In addition, this study revealed that co-infections were common in pig herds, with a co-infection rate of 40.01% (579/1447), which is consistent with the results from Switzerland and Brazil [20,24]. In this study, the co-infections with RVA + RVC (10.09%) and RVA + RVB + RVC (12.72%) were the predominant types of dual infection and triple infection, which was in agreement with the results of Baumann et al. [20]. Notably, RVH had a high positivity rate of 13.68% (190/1447) in the clinical samples. To our knowledge, this is the first report on the prevalence of porcine RVH in China, and the high positivity rates suggests that its harmfulness cannot be ignored.
Porcine RVs have been reported in China. The investigations of RVA showed that the positivity rate of RVA was 28.76% (65/226) in Shandong province during 2013–2014 [39], 4.3% (12/280) in Heilongjiang province in 2022 [40], 17.59% (70/398) in nine provinces during 2015–2017 [41], and 16.83% (100/394) in East China during 2017–2019 [42]. RVC has been reported in China and showed a positivity rate of 4.3% for RVC and 1.4% for RVA in Zhejiang province in 2013 [43], 18.7% (51/273) for RVC, and 7.0% (19/273) for RVA in Zhejiang, Shandong, Jiangsu, and Shanxi provinces during 2013–2019 [44], 12.5% (11/88) for RVA, and 11.4% (10/88) for RVC in Jiangsu province in 2022 [37]. However, RVB has not been reported in China. In addition, RVH has also not been reported in pigs in China until now, and only the sequences of two RVH strains, which were from environmental samples, were downloaded from NCBI GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/, accessed on 16 May 2023). Since the RVH positive samples were first discovered in China, we randomly selected 25 positive samples to amplify the VP6 gene fragments, sequence, and analyze. Recently, the phylogenetic analysis using a complete-genome-based RVH genotyping system showed that RVH strains could be classified into genotypes I1 to I6 according to the VP6 gene sequence with a cut-off value of 87% [45]. In this study, 25 VP6 gene nucleotide sequences of porcine RVH strains were obtained. The phylogenetic tree based on the deduced amino acid sequences of RVH VP6 gene revealed that all 25 strains from Guangxi province belonged to the I5 genotype, and the two RVH strains from environmental samples also belonged to the I5 genotype, indicating that the Chinese strains share a common origin. In addition, the Chinese strains were most closely related to the Japanese and Vietnamese strains (Figure 4), suggesting that they might have a similar origin but have minor mutations.

5. Conclusions

A quadruplex RT-qPCR assay has been developed for the simultaneous detection and differentiation of RVA, RVB, RVC, and RVH, with good specificity, high sensitivity, and excellent repeatability. This method could be used to differentiate the co-infection of porcine RVs in clinical samples. In addition, RVA, RVB, RVC, and RVH showed high positivity rates in diarrheic clinical samples from Guangxi province in China. The phylogenetic tree based on the VP6 gene sequences of porcine RVH was first analyzed in China and revealed that all the Chinese strains belonged to the I5 genotype.

Author Contributions

Investigation, and writing—original draft preparation: H.Z. and S.F.; methodology, software and validation: J.H., B.L. and Y.S.; data curation and supervision: F.L. and Y.Y.; funding acquisition and writing—review and editing: K.S. and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

The Key Research and Development Program (No. AB21238003) of Guangxi Science and Technology Bureau, China.

Institutional Review Board Statement

The study was approved by Guangxi Center for Animal Disease Control and Prevention (CADC) (No. 2020-A-02).

Informed Consent Statement

Written informed consent was obtained for using the clinical samples in this study from the animal’s owners.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Vlasova, A.N.; Amimo, J.O.; Saif, L.J. Porcine rotaviruses: Epidemiology, immune responses and control strategies. Viruses 2017, 9, 48. [Google Scholar] [CrossRef] [PubMed]
  2. Patton, J.T. Rotavirus diversity and evolution in the post-vaccine world. Discov. Med. 2012, 13, 85–97. [Google Scholar]
  3. Matthijnssens, J.; Otto, P.H.; Ciarlet, M.; Desselberger, U.; Van Ranst, M.; Johne, R. VP6-sequence-based cutoff values as a criterion for rotavirus species demarcation. Arch. Virol. 2012, 157, 1177–1182. [Google Scholar] [CrossRef] [PubMed]
  4. Kumar, D.; Shepherd, F.K.; Springer, N.L.; Mwangi, W.; Marthaler, D.G. Rotavirus infection in swine: Genotypic diversity, immune responses, and role of gut microbiome in rotavirus immunity. Pathogens 2022, 11, 1078. [Google Scholar] [CrossRef] [PubMed]
  5. Rodger, S.M.; Craven, J.A.; Williams, I. Letter: Demonstration of reovirus-like particles in intestinal contents of piglets with diarrhoea. Aust. Vet. J. 1975, 51, 536. [Google Scholar] [CrossRef]
  6. Theil, K.W.; Saif, L.J.; Moorhead, P.D.; Whitmoyer, R.E. Porcine rotavirus-like virus (group B rotavirus): Characterization and pathogenicity for gnotobiotic pigs. J. Clin. Microbiol. 1985, 21, 340–345. [Google Scholar] [CrossRef]
  7. Saif, L.J.; Bohl, E.H.; Theil, K.W.; Cross, R.F.; House, J.A. Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J. Clin. Microbiol. 1980, 12, 105–111. [Google Scholar] [CrossRef]
  8. Papp, H.; László, B.; Jakab, F.; Ganesh, B.; De Grazia, S.; Matthijnssens, J.; Ciarlet, M.; Martella, V.; Bányai, K. Review of group A rotavirus strains reported in swine and cattle. Vet. Microbiol. 2013, 165, 190–199. [Google Scholar] [CrossRef]
  9. Theuns, S.; Vyt, P.; Desmarets, L.M.B.; Roukaerts, I.D.M.; Heylen, E.; Zeller, M.; Matthijnssens, J.; Nauwynck, H.J. Presence and characterization of pig group A and C rotaviruses in feces of Belgian diarrheic suckling piglets. Virus Res. 2016, 213, 172–183. [Google Scholar] [CrossRef]
  10. Niira, K.; Ito, M.; Masuda, T.; Saitou, T.; Abe, T.; Komoto, S.; Sato, M.; Yamasato, H.; Kishimoto, M.; Naoi, Y.; et al. Whole genome sequences of Japanese porcine species C rotaviruses reveal a high diversity of genotypes of individual genes and will contribute to a comprehensive, generally accepted classification system. Infect. Genet. Evol. 2016, 44, 106–113. [Google Scholar] [CrossRef]
  11. Roczo-Farkas, S.; Dunlop, R.H.; Donato, C.M.; Kirkwood, C.D.; McOrist, S. Rotavirus group C infections in neonatal and grower pigs in Australia. Vet. Rec. 2021, 188, e296. [Google Scholar] [CrossRef]
  12. Joshi, M.S.; Arya, S.A.; Shinde, M.S.; Ingle, V.C.; Birade, H.S.; Gopalkrishna, V. Rotavirus C infections in asymptomatic piglets in India, 2009–2013: Genotyping and phylogenetic analysis of all genomic segments. Arch. Virol. 2022, 167, 2665–2675. [Google Scholar] [CrossRef]
  13. Jiao, R.; Ji, Z.; Zhu, X.; Shi, H.; Chen, J.; Shi, D.; Liu, J.; Jing, Z.; Zhang, J.; Zhang, L.; et al. Genome analysis of the G6P6 genotype of porcine group C rotavirus in China. Animals 2022, 12, 2951. [Google Scholar] [CrossRef]
  14. Zhao, S.; Jin, X.; Zang, L.; Liu, Z.; Wen, X.; Ran, X. Global infection rate of rotavirus C during 1980–2022 and analysis of critical factors in the host range restriction of virus VP4. Viruses 2022, 14, 2826. [Google Scholar] [CrossRef] [PubMed]
  15. Chepngeno, J.; Diaz, A.; Paim, F.C.; Saif, L.J.; Vlasova, A.N. Rotavirus C: Prevalence in suckling piglets and development of virus-like particles to assess the influence of maternal immunity on the disease development. Vet. Res. 2019, 50, 84. [Google Scholar] [CrossRef]
  16. Shepherd, F.K.; Murtaugh, M.P.; Chen, F.; Culhane, M.R.; Marthaler, D.G. Longitudinal surveillance of porcine rotavirus B strains from the United States and Canada and in silico identification of antigenically important sites. Pathogens 2017, 6, 64. [Google Scholar] [CrossRef]
  17. Molinari, B.L.D.; Alfieri, A.F.; Alfieri, A.A. Molecular characterization of a new G (VP7) genotype in group B porcine rotavirus. Intervirology 2018, 61, 42–48. [Google Scholar] [CrossRef] [PubMed]
  18. Ferrari, E.; Salogni, C.; Martella, V.; Alborali, G.L.; Scaburri, A.; Boniotti, M.B. Assessing the epidemiology of rotavirus A, B, C and H in diarrheic pigs of different ages in northern Italy. Pathogens 2022, 11, 467. [Google Scholar] [CrossRef] [PubMed]
  19. Alekseev, K.P.; Penin, A.A.; Mukhin, A.N.; Khametova, K.M.; Grebennikova, T.V.; Yuzhakov, A.G.; Moskvina, A.S.; Musienko, M.I.; Raev, S.A.; Mishin, A.M.; et al. Genome characterization of a pathogenic porcine rotavirus B strain identified in Buryat Republic, Russia in 2015. Pathogens 2018, 7, 46. [Google Scholar] [CrossRef] [PubMed]
  20. Baumann, S.; Sydler, T.; Rosato, G.; Hilbe, M.; Kummerlen, D.; Sidler, X.; Bachofen, C. Frequent occurrence of simultaneous infection with multiple rotaviruses in Swiss pigs. Viruses 2022, 14, 1117. [Google Scholar] [CrossRef] [PubMed]
  21. Marthaler, D.; Suzuki, T.; Rossow, K.; Culhane, M.; Collins, J.; Goyal, S.; Tsunemitsu, H.; Ciarlet, M.; Matthijnssens, J. VP6 genetic diversity, reassortment, intragenic recombination and classification of rotavirus B in American and Japanese pigs. Vet. Microbiol. 2014, 172, 359–366. [Google Scholar] [PubMed]
  22. Lahon, A.; Ingle, V.C.; Birade, H.S.; Raut, C.G.; Chitambar, S.D. Molecular characterization of group B rotavirus circulating in pigs from India: Identification of a strain bearing a novel VP7 genotype, G21. Vet. Microbiol. 2014, 174, 342–352. [Google Scholar] [CrossRef]
  23. Marthaler, D.; Rossow, K.; Gramer, M.; Collins, J.; Goyal, S.; Tsunemitsu, H.; Kuga, K.; Suzuki, T.; Ciarlet, M.; Matthijnssens, J. Detection of substantial porcine group B rotavirus genetic diversity in the United States, resulting in a modified classification proposal for G genotypes. Virology 2012, 433, 85–96. [Google Scholar] [CrossRef]
  24. Molinari, B.L.; Possatti, F.; Lorenzetti, E.; Alfieri, A.F.; Alfieri, A.A. Unusual outbreak of post-weaning porcine diarrhea caused by single and mixed infections of rotavirus groups A, B, C, and H. Vet. Microbiol. 2016, 193, 125–132. [Google Scholar] [CrossRef]
  25. Miyabe, F.M.; Dall Agnol, A.M.; Leme, R.A.; Oliveira, T.E.S.; Headley, S.A.; Fernandes, T.; de Oliveira, A.G.; Alfieri, A.F.; Alfieri, A.A. Porcine rotavirus B as primary causative agent of diarrhea outbreaks in newborn piglets. Sci. Rep. 2020, 10, 22002. [Google Scholar] [CrossRef]
  26. Marthaler, D.; Rossow, K.; Culhane, M.; Goyal, S.; Collins, J.; Matthijnssens, J.; Nelson, M.; Ciarlet, M. Widespread rotavirus H in commercially raised pigs, United States. Emerg. Infect. Dis. 2014, 20, 1195–1198. [Google Scholar] [CrossRef] [PubMed]
  27. Wakuda, M.; Ide, T.; Sasaki, J.; Komoto, S.; Ishii, J.; Sanekata, T.; Taniguchi, K. Porcine rotavirus closely related to novel group of human rotaviruses. Emerg. Infect. Dis. 2011, 17, 1491–1493. [Google Scholar] [CrossRef]
  28. Hull, J.J.A.; Qi, M.; Montmayeur, A.M.; Kumar, D.; Velasquez, D.E.; Moon, S.S.; Magana, L.C.; Betrapally, N.; Ng, T.F.F.; Jiang, B.; et al. Metagenomic sequencing generates the whole genomes of porcine rotavirus A, C, and H from the United States. PLoS ONE 2020, 15, e0244498. [Google Scholar] [CrossRef] [PubMed]
  29. Molinari, B.L.; Lorenzetti, E.; Otonel, R.A.; Alfieri, A.F.; Alfieri, A.A. Species H rotavirus detected in piglets with diarrhea, Brazil, 2012. Emerg. Infect. Dis. 2014, 20, 1019–1022. [Google Scholar] [CrossRef] [PubMed]
  30. Nyaga, M.M.; Peenze, I.; Potgieter, C.A.; Seheri, L.M.; Page, N.A.; Yinda, C.K.; Steele, A.D.; Matthijnssens, J.; Mphahlele, M.J. Complete genome analyses of the first porcine rotavirus group H identified from a South African pig does not provide evidence for recent interspecies transmission events. Infect. Genet. Evol. 2016, 38, 1–7. [Google Scholar] [CrossRef] [PubMed]
  31. Puente, H.; Cortey, M.; de Nova, P.J.G.; Mencia-Ares, O.; Gomez-Garcia, M.; Diaz, I.; Arguello, H.; Martin, M.; Rubio, P.; Carvajal, A. First identification and characterization of rotavirus H in swine in Spain. Transbound. Emerg. Dis. 2021, 68, 3055–3069. [Google Scholar] [CrossRef] [PubMed]
  32. Phan, M.V.T.; Anh, P.H.; Cuong, N.V.; Munnink, B.B.O.; van der Hoek, L.; My, P.T.; Tri, T.N.; Bryant, J.E.; Baker, S.; Thwaites, G.; et al. Unbiased whole-genome deep sequencing of human and porcine stool samples reveals circulation of multiple groups of rotaviruses and a putative zoonotic infection. Virus Evol. 2016, 2, vew027. [Google Scholar] [CrossRef] [PubMed]
  33. Chasey, D.; Bridger, J.C.; McCrae, M.A. A new type of atypical rotavirus in pigs. Arch. Virol. 1986, 89, 235–243. [Google Scholar] [CrossRef]
  34. Hawkins, S.F.C.; Guest, P.C. Multiplex analyses using real-time quantitative PCR. Methods Mol. Biol. 2017, 1546, 125–133. [Google Scholar]
  35. Saijo, M.; Morikawa, S.; Kurane, I. Real-time quantitative polymerase chain reaction for virus infection diagnostics. Expert. Opin. Med. Diagn. 2008, 2, 1155–1171. [Google Scholar] [CrossRef] [PubMed]
  36. Marthaler, D.; Homwong, N.; Rossow, K.; Culhane, M.; Goyal, S.; Collins, J.; Matthijnssens, J.; Ciarlet, M. Rapid detection and high occurrence of porcine rotavirus A, B, and C by RT-qPCR in diagnostic samples. J. Virol. Methods 2014, 209, 30–34. [Google Scholar] [CrossRef]
  37. Zhang, L.; Jiang, Z.; Zhou, Z.; Sun, J.; Yan, S.; Gao, W.; Shao, Y.; Bai, Y.; Wu, Y.; Yan, Z.; et al. A TaqMan probe-based multiplex real-time PCR for simultaneous detection of porcine epidemic diarrhea virus subtypes G1 and G2, and porcine rotavirus groups A and C. Viruses 2022, 14, 1819. [Google Scholar] [CrossRef]
  38. Liu, H.; Shi, K.; Zhao, J.; Yin, Y.; Chen, Y.; Si, H.; Qu, S.; Long, F.; Lu, W. Development of a one-step multiplex qRT-PCR assay for the detection of African swine fever virus, classical swine fever virus and atypical porcine pestivirus. BMC Vet. Res. 2022, 18, 43. [Google Scholar] [CrossRef]
  39. Xue, R.; Tian, Y.; Zhang, Y.; Zhang, M.; Li, Z.; Chen, S.; Liu, Q. Diversity of group A rotavirus of porcine rotavirus in Shandong province China. Acta Virol. 2018, 62, 229–234. [Google Scholar] [CrossRef]
  40. Werid, G.M.; Zhang, H.; Ibrahim, Y.M.; Pan, Y.; Zhang, L.; Xu, Y.; Zhang, W.; Wang, W.; Chen, H.; Fu, L.; et al. Development of a multiplex RT-PCR assay for simultaneous detection of four potential zoonotic swine RNA viruses. Vet. Sci. 2022, 9, 176. [Google Scholar] [CrossRef]
  41. Ding, G.; Fu, Y.; Li, B.; Chen, J.; Wang, J.; Yin, B.; Sha, W.; Liu, G. Development of a multiplex RT-PCR for the detection of major diarrhoeal viruses in pig herds in China. Transbound. Emerg. Dis. 2020, 67, 678–685. [Google Scholar] [CrossRef]
  42. Tao, R.; Chang, X.; Zhou, J.; Zhu, X.; Yang, S.; Li, K.; Gu, L.; Zhang, X.; Li, B. Molecular epidemiological investigation of group A porcine rotavirus in East China. Front. Vet. Sci. 2023, 10, 1138419. [Google Scholar] [CrossRef]
  43. Liu, G.; Jiang, Y.; Opriessnig, T.; Gu, K.; Zhang, H.; Yang, Z. Detection and differentiation of five diarrhea related pig viruses utilizing a multiplex PCR assay. J. Virol. Methods 2019, 263, 32–37. [Google Scholar] [CrossRef]
  44. Nan, P.; Wen, D.; Opriessnig, T.; Zhang, Q.; Yu, X.; Jiang, Y. Novel universal primer-pentaplex PCR assay based on chimeric primers for simultaneous detection of five common pig viruses associated with diarrhea. Mol. Cell. Probes 2021, 58, 101747. [Google Scholar] [CrossRef]
  45. Suzuki, T.; Inoue, D. Full genome-based genotyping system for rotavirus H and detection of potential gene recombination in nonstructural protein 3 between porcine rotavirus H and rotavirus C. J. Gen. Virol. 2018, 99, 1582–1589. [Google Scholar] [CrossRef]
Pathogens 12 01091 g001
Figure 1. The amplification curves (A–D) and standard curves (E) of the quadruplex RT-qPCR. The figures show the amplification curves of the standard plasmids p-RVA (A), p-RVB (B), p-RVC (C), and p-RVH (D) with different concentrations. 1–7: The final reaction concentrations of the standard plasmids ranged from 1.5 × 107 to 1.5 × 101 copies/µL; 8: Negative control. The standard curves (E) show excellent correlation (R2 ≥ 0.998) between the logarithmic values of the plasmid concentrations and the Ct values.
Figure 1. The amplification curves (A–D) and standard curves (E) of the quadruplex RT-qPCR. The figures show the amplification curves of the standard plasmids p-RVA (A), p-RVB (B), p-RVC (C), and p-RVH (D) with different concentrations. 1–7: The final reaction concentrations of the standard plasmids ranged from 1.5 × 107 to 1.5 × 101 copies/µL; 8: Negative control. The standard curves (E) show excellent correlation (R2 ≥ 0.998) between the logarithmic values of the plasmid concentrations and the Ct values.
Pathogens 12 01091 g001
Pathogens 12 01091 g002
Figure 2. Specificity analysis of the quadruplex RT-qPCR. 1: p-RVH; 2: p-RVC; 3: p-RVA; 4: p-RVB; 5: RVH; 6: RVC; 7: RVA; 8: RVB; 9–18: PEDV, TGEV, FMDV, SIV, CSFV, PRRSV, PRV, PDCoV, ASFV, and PCV2; 19: Negative control using fecal sample; 20: Negative control using distilled water.
Figure 2. Specificity analysis of the quadruplex RT-qPCR. 1: p-RVH; 2: p-RVC; 3: p-RVA; 4: p-RVB; 5: RVH; 6: RVC; 7: RVA; 8: RVB; 9–18: PEDV, TGEV, FMDV, SIV, CSFV, PRRSV, PRV, PDCoV, ASFV, and PCV2; 19: Negative control using fecal sample; 20: Negative control using distilled water.
Pathogens 12 01091 g002
Pathogens 12 01091 g003
Figure 3. Sensitivity analysis of the quadruplex RT-qPCR. The figures show the amplification curves of the standard plasmids p-RVA (A), p-RVB (B), p-RVC (C), and p-RVH (D) with different concentrations. 1–10: The final reaction concentrations of the standard plasmids ranged from 1.5 × 107 to 1.5 × 10−2 copies/µL. 11: Negative control using fecal sample.
Figure 3. Sensitivity analysis of the quadruplex RT-qPCR. The figures show the amplification curves of the standard plasmids p-RVA (A), p-RVB (B), p-RVC (C), and p-RVH (D) with different concentrations. 1–10: The final reaction concentrations of the standard plasmids ranged from 1.5 × 107 to 1.5 × 10−2 copies/µL. 11: Negative control using fecal sample.
Pathogens 12 01091 g003
Pathogens 12 01091 g004
Figure 4. Phylogenetic tree based on the RVH VP6 amino acid sequences. The tree was constructed using the neighbor-joining method and the Kimura three-parameter model. Numbers along the tree represent the confidence value for a given internal branch based on 1000 Bootstrap replicates, and only values larger than 70 are shown. The RVH strains obtained in this study were marked with circles (●).
Figure 4. Phylogenetic tree based on the RVH VP6 amino acid sequences. The tree was constructed using the neighbor-joining method and the Kimura three-parameter model. Numbers along the tree represent the confidence value for a given internal branch based on 1000 Bootstrap replicates, and only values larger than 70 are shown. The RVH strains obtained in this study were marked with circles (●).
Pathogens 12 01091 g004
Table 1. Primers and TaqMan probes used for detection of RVA, RVB, RVC, and RVH.
Table 1. Primers and TaqMan probes used for detection of RVA, RVB, RVC, and RVH.
Primer/ProbeSequence (5′→3′)Position aGenotypeSize/bp
RVA-VP6-F AATATGACACCAGCAGTTGCAAA918–940I5107
RVA-VP6-R ACAGATTCACAAACTGCAGATTCAA1000–1024
RVA-VP6-P CY5-CAAGCACCGCCATTTATATTTCATGCTACA-BHQ3951–980
RVB-VP6-F GTGTCYGCRTWTGCTGC1181–1197I6, I8, I10, I11, I12, I1362
RVB-VP6-R CCTYTCGAAGCACTYCC1227–1243
RVB-VP6-P VIC-GGRAGCTGACGCCGGATCAGA-BHQ11203–1223
RVC-VP6-F GTGAAGAGAATGGTGATGTAG1189–1209I1, I4, I5, I6, I7, I10, I11, I12, I13157
RVC-VP6-R GTTCACATTTCATCCTCCTG1324–1343
RVC-VP6-P FAM-TAGCATGATTCACGAATGGGTTTAG-BHQ11255–1279
RVH-VP6-F GGAAGAGCTACTGGAAAGATGG43–64I1, I3, I4, I5, I699
RVH-VP6-R GACTCCTGAGCATGGTACTTTC120–141
RVH-VP6-P Texas Red-CAGTTCAAGGCAGACCAGGAGGAA-BHQ277–100
a Note: The locations of the primers and probes on the VP6 gene correspond to the reference strains of RVA, RVB, RVC and RVH, whose GenBank accession numbers were FJ617209, KF882587, KC164677, and MK379512, respectively.
Table 2. RVH strains used for phylogenetic analysis in this study.
Table 2. RVH strains used for phylogenetic analysis in this study.
No.StrainAccession No.DateOriginSpecies
1ADRV-NAY6320801997ChinaHuman
2J19DQ1139021997ChinaHuman
3SKA-1AB5766261999JapanPorcine
4B219DQ1680332002BangladeshHuman
5MRC-DPRU1575KT9620312007South AfricaPorcine
6KS9.5-3KF7572852008USAPorcine
7OK.5.68MH2301212008USAPorcine
8NC7.64-3KF7572802008USAPorcine
9MN.9.65KU2545872008USAPorcine
10AR7.10-1KF7572892012USAPorcine
11BR59KF0216192012BrazilPorcine
12BR61KM3594792012BrazilPorcine
13VNM/12089_8KX3625172012VietnamPorcine
14VNM/14250_11KX3625412012VietnamPorcine
15VNM/12087_40KX3625282012VietnamPorcine
16VNM/14176_13KX3625522012VietnamPorcine
17NGS-3LC3484712014JapanPorcine
18NGS-5LC3484722014JapanPorcine
19NGS-6LC3484732014JapanPorcine
20NGS-7LC3484742014JapanPorcine
21NGS-16LC3484782014JapanPorcine
22NGS-8LC3484752015JapanPorcine
23NGS-9LC4162532015JapanPorcine
24NGS-10LC3484762015JapanPorcine
25NGS-18LC4162732015JapanPorcine
26SP-VC29MT6449792017SpainPorcine
27SP-VC36MT6449802017SpainPorcine
28VIRES_HeB02_C1MK3793082017ChinaPorcine
29VIRES_SD01_C1MK3795002017ChinaPorcine
30RVH-GXBS-2021-01OR0397332021China (This study)Porcine
31RVH-GXBS-2021-02OR0397342021China (This study)Porcine
32RVH-GXBS-2021-03OR0397352021China (This study)Porcine
33RVH-GXBS-2022-01OR0397362022China (This study)Porcine
34RVH-GXBS-2022-02OR0397372022China (This study)Porcine
35RVH-GXBS-2022-03OR0397382022China (This study)Porcine
36RVH-GXBS-2022-04OR0397392022China (This study)Porcine
37RVH-GXBS-2022-05OR0397402022China (This study)Porcine
38RVH-GXBS-2022-06OR0397412022China (This study)Porcine
39RVH-GXBS-2022-07OR0397422022China (This study)Porcine
40RVH-GXBS-2022-08OR0397432022China (This study)Porcine
41RVH-GXBS-2022-09OR0397442022China (This study)Porcine
42RVH-GXBS-2022-10OR0397452022China (This study)Porcine
43RVH-GXBS-2022-11OR0397462022China (This study)Porcine
44RVH-GXBS-2022-12OR0397472022China (This study)Porcine
45RVH-GXCZ-2021-01OR0397482021China (This study)Porcine
46RVH-GXGG-2021-01OR0397492021China (This study)Porcine
47RVH-GXGG-2022-01OR0397502022China (This study)Porcine
48RVH-GXGG-2022-02OR0397512022China (This study)Porcine
49RVH-GXLZ-2022-01OR0397522022China (This study)Porcine
50RVH-GXLZ-2022-02OR0397532022China (This study)Porcine
51RVH-GXNN-2021-01OR0397542021China (This study)Porcine
52RVH-GXNN-2022-01OR0397552022China (This study)Porcine
53RVH-GXQZ-2021-01OR0397562021China (This study)Porcine
54RVH-GXQZ-2022-01OR0397572022China (This study)Porcine
Table 3. The reaction system of the quadruplex RT-qPCR.
Table 3. The reaction system of the quadruplex RT-qPCR.
ReagentVolume (µL)Final Concentration (nM)
2× One Step RT-PCR Buffer III 10.0/
Ex Taq HS (5 U/µL) 0.4/
PrimeScript RT Enzyme Mix II 0.4/
RVA-VP6-F 0.1100
RVA-VP6-R 0.1100
RVA-VP6-P 0.1100
RVB-VP6-F 0.3300
RVB-VP6-R 0.3300
RVB-VP6-P 0.1100
RVC-VP6-F 0.3300
RVC-VP6-R 0.3300
RVC-VP6-P 0.1100
RVH-VP6-F 0.2200
RVH-VP6-R 0.2200
RVH-VP6-P 0.2200
Nucleic acid 2.0/
RNase Free Distilled Water Up to 20.0/
Table 4. Repeatability analysis of the quadruplex RT-qPCR.
Table 4. Repeatability analysis of the quadruplex RT-qPCR.
PlasmidConcentration
(Copies/µL)		Ct Value of Intra-AssayCt Value of Inter-Assay
xSDCV (%)xSDCV (%)
p-RVA 1.5 × 10714.47 0.14 0.97 14.43 0.08 0.55
1.5 × 10520.15 0.09 0.45 19.91 0.11 0.55
1.5 × 10326.18 0.04 0.15 26.21 0.05 0.19
p-RVB 1.5 × 10714.90 0.17 1.14 14.77 0.09 0.61
1.5 × 10521.15 0.18 0.85 21.17 0.09 0.43
1.5 × 10327.67 0.17 0.61 27.64 0.02 0.07
p-RVC 1.5 × 10713.66 0.10 0.73 13.53 0.13 0.96
1.5 × 10519.92 0.05 0.25 19.99 0.17 0.85
1.5 × 10326.56 0.21 0.79 26.73 0.09 0.34
p-RVH 1.5 × 10714.02 0.11 0.78 13.93 0.06 0.43
1.5 × 10520.36 0.06 0.29 20.26 0.06 0.30
1.5 × 10326.67 0.09 0.34 26.68 0.18 0.67
Table 5. Detection results of the clinical samples in Guangxi province in China.
Table 5. Detection results of the clinical samples in Guangxi province in China.
RegionNumberNumber of Positive Sample
RVARVBRVCRVHA + B aA + CA + HB + CB + HC + HA + B + CA + B + HA + C + HB + C + HA + B + C + HSingle InfectionCo-Infection
Chongzuo 142459461401602163012142 (29.58%)32 (22.54%)
Baise 59433618326680225425112612823032128 (21.55%)285 (47.98%)
Guigang 205664784302320234140121626 (12.68%)76 (37.07%)
Nanning 2549167145120393332226020265 (25.59)109 (42.91%)
Hechi 126320100000200003 (25.00%)3 (25.00%)
Qinzhou 6713352280106408030119 (28.36%)23 (34.33%)
Beihai 37000130000000000013 (35.14%)0 (0%)
Liuzhou 111593642349331063280856 (50.45%)43 (38.74%)
Yulin 252101471100000006011 (44.00%)8 (32.00%)
Total 1447618 (42.71%)390 (26.95%)621 (42.92%)198 (13.68%)35 (2.42%)146 (10.09%)31 (2.14%)55 (3.80%)12 (0.83%)24 (1.66%)184 (12.72%)4 (0.28%)45 (3.11%)13 (0.90%)30 (2.07%)363 (25.09%)579 (40.01%)
a Note: A + B stands for co-infection of RVA and RVB; A + C stands for co-infection of RVA and RVC; A + H stands for co-infection of RVA and RVH; B + C stands for co-infection of RVB and RVC; B + H stands for co-infection of RVB and RVH; C + H stands for co-infection of RVC and RVH; A + B + C stands for co-infection of RVA, RVB, and RVC; A + B + H stands for co-infection of RVA, RVB, and RVH; A + C + H stands for co-infection of RVA, RVC, and RVH; B + C + H stands for co-infection of RVB, RVC, and RVH; A + B + C + H stands for co-infection of RVA, RVB, RVC, and RVH.
Table 6. Agreements of the detection results using the developed and the reported reference multiplex RT-qPCR.
Table 6. Agreements of the detection results using the developed and the reported reference multiplex RT-qPCR.
MethodNumber of Positive Samples
RVA (%)RVB (%)RVC (%)RVH (%)
The Developed Multiplex RT-qPCR 618/1447 (42.71%)390/1447 (26.95%)621/1447 (42.92%)198/1447 (13.68%)
The Reported Reference Method 613/1447 (42.36%)388/1447 (26.81%)626/1447 (43.26%)198/1447 (13.68%)
Agreements 99.65%99.86%99.65%100.00%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shi, K.; Zhou, H.; Feng, S.; He, J.; Li, B.; Long, F.; Shi, Y.; Yin, Y.; Li, Z. Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China. Pathogens 2023, 12, 1091. https://doi.org/10.3390/pathogens12091091

AMA Style

Shi K, Zhou H, Feng S, He J, Li B, Long F, Shi Y, Yin Y, Li Z. Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China. Pathogens. 2023; 12(9):1091. https://doi.org/10.3390/pathogens12091091

Chicago/Turabian Style

Shi, Kaichuang, Hongjin Zhou, Shuping Feng, Junxian He, Biao Li, Feng Long, Yuwen Shi, Yanwen Yin, and Zongqiang Li. 2023. "Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China" Pathogens 12, no. 9: 1091. https://doi.org/10.3390/pathogens12091091

APA Style

Shi, K., Zhou, H., Feng, S., He, J., Li, B., Long, F., Shi, Y., Yin, Y., & Li, Z. (2023). Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China. Pathogens, 12(9), 1091. https://doi.org/10.3390/pathogens12091091

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop