Next Article in Journal
Use of Blood Lactate in Assessment of Manual Capture Techniques of Zoo-Housed Crocodilians
Next Article in Special Issue
Comprehensive Analyses of Bone and Cartilage Transcriptomes Evince Ion Transport, Inflammation and Cartilage Development-Related Genes Involved in Chickens’ Femoral Head Separation
Previous Article in Journal
Absence of 2899C<T Mutation in the WNK4 Gene in a Free-Ranging Lion (Panthera leo) with Polymyopathy
Previous Article in Special Issue
Differential Modulation of 25-hydroxycholecalciferol on Innate Immunity of Broiler Breeder Hens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 3
10.3390/ani12030393
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Associations of Transcription Factor 21 Gene Polymorphisms with the Growth and Body Composition Traits in Broilers

by
Linyong Shen
1,†,
Jiaqiang Yu
2,†,
Yaowen Ge
1,
Hui Li
1,
Yumao Li
1,
Zhiping Cao
1,
Peng Luan
1,
Fan Xiao
3,
Haihe Gao
3 and
Hui Zhang
1,*
1
Key Laboratory of Chicken Genetics and Breeding, Ministry of Agriculture and Rural Affairs, Key Laboratory of Animal Genetics, Breeding and Reproduction, Education Department of Heilongjiang Province, College of Animal Science and Technology, Northeast Agricultural University, Harbin 150030, China
2
Forest Investigating and Planning Institute of Daxinganling, Yakshi 022150, China
3
Fujian Sunnzer Biotechnology Development Co., Ltd., Nanping 354100, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2022, 12(3), 393; https://doi.org/10.3390/ani12030393
Submission received: 31 December 2021 / Revised: 4 February 2022 / Accepted: 6 February 2022 / Published: 8 February 2022
(This article belongs to the Special Issue Genetic Selection and Associated Defects in Poultry Production)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The functional SNPs discovered in this work will give helpful information on the crucial molecular markers that may be employed in breeding efforts to improve the heart development of broiler chickens.

Abstract

This study aims to identify molecular marker loci that could be applied in broiler breeding programs. In this study, we used public databases to locate the Transcription factor 21 (TCF21) gene that affected the economically important traits in broilers. Ten single nucleotide polymorphisms were detected in the TCF21 gene by monoclonal sequencing. The polymorphisms of these 10 SNPs in the TCF21 gene were significantly associated (p < 0.05) with multiple growth and body composition traits. Furthermore, the TT genotype of g.-911T>G was identified to significantly increase the heart weight trait without affecting the negative traits, such as abdominal fat and reproduction by multiple methods. Thus, it was speculated that the g.-911T>G identified in the TCF21 gene might be used in marker-assisted selection in the broiler breeding program.

1. Introduction

Chicken (Gallus gallus) is the most commonly raised poultry by humans. Since the 1950s, the growth rates and meat yield of broilers have significantly improved. However, with the rapid growth of broilers, some problems inducing huge economic losses have emerged, such as obesity, ascites syndrome, leg diseases, broiler immunity decline, and sudden death [1]. The growth rate of broilers is positively correlated with these unfavorable traits. As a result, it is difficult to simultaneously increase the growth rate and decrease these unfavorable traits in broilers by the traditional phenotypic selection method alone. Notably, molecular marker-assisted selection (MAS) can provide new ideas for overcoming such problems [2]. The combination of molecular genetic marker breeding with traditional phenotypic selection helps to greatly improve the breeding efficiency and accelerate the breeding process [3]. In recent years, with the rapid development of molecular genetics, genetic markers have been gradually applied in the MAS of livestock and poultry [4]. This technology contributes to substantially improving the breeding efficiency and shortening the generation intervals [5]. Among the numerous molecular markers, single nucleotide polymorphisms (SNPs) have been the most extensively studied [6,7,8,9]. Therefore, SNPs are of practical significance to identify genes or markers related to the economically important traits of broilers.
Transcription factor 21 (TCF21) plays an important role in a variety of economically important traits such as heart development [10], testis formation [11], and adipogenesis [12] in chickens. This study aims to identify the SNPs of the TCF21 gene that are significantly associated with the growth and body composition traits of broilers. The results of this study can provide useful information for the molecular genetic marker-assisted breeding of the economically important traits of broilers.

2. Material and Methods

2.1. ChIP-Seq Analysis

The ChIP-seq dataset for histone modification marks (H3K4me3, H3K27ac, H3K4me1, H3K27me3) and CTCF data in the seven tissues of chickens used in this work were downloaded from the GEO Datasets: GSE158430 [13]. The Bedtools software 2.29.1 version was used to separate the ChIP-seq datasets of all tissues within the same merged [14]. The reference genome and annotation file for galGal6 (Gallus gallus) were downloaded from the UCSC Genome Browser (http://hgdownload.soe.ucsc.edu/goldenPath/galGal6/bigZips/, accessed on 16 June 2021). These combined data were genetically annotated using the ChIPseeker software 1.30.2 version [15] and visualized using the IGV browser (http://software.broadinstitute.org/software/igv/, accessed on 16 June 2021).

2.2. Experimental Populations and Phenotype Measurements

Details on the Northeast Agricultural University broiler lines divergently selected for abdominal fat content (NEAUHLF) were described by Zhang et al. [16]. In this study, altogether, 675 male birds from the generations 21 (G21) populations of NEAUHLF were used for an association study. All birds were raised and managed in accordance with the routine commercial broiler feeding procedures.
For the G21 populations, the body weight (BW) of all male birds was measured at 1, 3, 5, and 7 weeks of age (assigned as BW1, BW3, BW5, and BW7, respectively). At the age of 7 weeks, the above birds were slaughtered, and the body composition traits were recorded. Before slaughter, the chest angle (ChA), keel length (KeL), body oblique length (BoL), chest width (ChW), metatarsus length (MeL), and metatarsus circumference (MeC) of all birds were measured. After slaughter, the carcass weight (CW), abdominal fat weight (AFW), liver weight (LW), muscular stomach weight (MSW), glandular stomach weight (GSW), heart weight (HW), spleen weight (SW), and testicle weight (TeW) were measured. For the reporting of results, we complied with the Animal Research: Reporting In Vivo Experiments (ARRIVE) guidelines [17].

2.3. Genotyping of SNPs

In total, 20 individuals from NEAUHLF were randomly selected (with 10 birds from each line). Then, the whole gene of TCF21, including the gene body region, the 5 ‘flanking region (2000 bp), and the 3’ flanking region (2000 bp), was sequenced, which resulted in 10 SNPs, referred to as g.-1243C>T, g.-1171T>C, g.-911T>G, g.-891C>T, g.691C>T, g.897T>C, g.1033G>A, g.1892A>G, g.2091C>T, and g.2155C>T, according to their respective positions in the TCF21 gene.
Using Primer Premier 5.0 (Premier, Canada), a series of PCR primers were designed to amplify the various portions of the chicken TCF21 genomic DNA sequence based on the chicken gene sequence (NCBI Reference Sequence: NC_006090.5), and all PCR primer sequences were synthesized and purified by Invitrogen (Camarillo, CA, USA). The primer sequences are shown in Table 1.
Furthermore, the total genomic DNA was extracted from 675 male birds of the G21 of NEAUHLF for PCR analysis, according to previous depiction [18]. These SNPs were genotyped with the PCR-restriction fragment length polymorphism (PCR-RFLP) method. The PCR amplification system included: 50 μg/μL genomic DNA 1 μL, 10 mmol/L dNTP 0.8 μL, 10 × PCR Buffer 1 μL, 10 mol/L upstream and downstream primers each 0.2 μL, 5 U/μL Taq DNA polymerase 0.1 μL, and deionized water 6.7 μL. The PCR amplification conditions were as follows: pre-denaturation conditions were all 94 °C for 5 min, denaturation conditions were all 94 °C for 30 s, extension conditions were all 72 °C for 30 s, and ultimate extension conditions were all 72 °C for 7 min. The annealing conditions and cycle number are listed in Table 1. After the PCR reaction was finished, 1.2% of the agarose gel was configured, the PCR amplification products were added, and the electrophoresis time was set for 20 min at 100 V. This agarose gel was removed from the electrophoresis solution and placed in the gel imaging analysis system to take pictures for identification. All the PCR reagents and electrophoresis reagents were obtained from Dalian Treasure Biological Engineering Co., Ltd. (Dalian, China).
The PCR amplification product was detected by the agarose electrophoresis of the target band single bright sample, and carried out by an enzymatic reaction test and enzymatic reaction system (2 μL of PCR product, 1 μL of Cutsmart Buffer, 6.8 μL of deionized water, and 0.2 μL of endonuclease, which were digested overnight at 37 °C). The SnapGene 5.0 Viewer (https://www.snapgene.com/snapgene-viewer/, accessed on 20 October 2021) was used to select the restriction enzymes, and the endonuclease for each SNP are displayed in Table 1. New England Biolabs provided all of the restriction enzymes (New England Biolabs, Ipswich, MA, USA). The digested products were detected by 3.0% agarose gel electrophoresis at 110 V for 50 min, and three genotypes were acquired for each of the 10 SNPs (Figure S1).

2.4. Transcription Factor Binding Site Analysis

To explore the potential molecular mechanisms underlying the association of SNPs loci in the TCF21 gene with the economically important traits in broiler chickens, bioinformatic analysis was performed using three transcription factor binding site software, including JASPAR (http://jaspar.binf.ku.dk/, accessed on 12 December 2021), TFBIND (http://tfbind.hgc.jp/, accessed on 12 December 2021), and Mulan (http://mulan.dcode.org/, accessed on 12 December 2021). These three bioinformatics software predicted overlapping transcription factors that were considered to possibly bind to the DNA sequence of SNPs in the TCF21 gene.

2.5. Statistical Analyses

The difference in allele frequencies between the lean and fat lines was determined and examined using the Chisquare test, with p < 0.05 as a significant difference between the lean and fat lines.
In this study, the JMP 7.0 software (SAS Inst. Inc., Cary, NC, USA) was employed for establishing a generalized linear mixed model to analyze the associations of SNP polymorphisms with the growth and body composition traits, with p < 0.05 being adopted as a threshold. In addition, the significant differences between the least-square means of different genotypes were calculated by the contrast test (p < 0.05). Then, the statistical model for analyzing the associations of genotypes with the growth and body composition traits was constructed based on the population characteristics [19]. The following model was utilized:
Y = μ + G +L + F (L) + D (F, L) + BW7 + e I
where Y is the observed value of traits, μ stands for the population mean, G indicates the genotype fixed effect, and L suggests the line fixed effect. In addition, F (L) indicates the random effect of the family within the line, whereas D (F, L) represents the random effect of dams in the family of the line, and e is the random effect. Model I was adopted to analyze the associations of SNP polymorphisms with the growth and body composition traits in 675 male birds (335 individuals from the lean line and 340 individuals from the fat line) from the G21 population of NEAUHLF, in which each line consisted of 40 family lines (one sire and four dams, respectively).
The statistical analysis model for genetic parameter estimation is shown below:
y = Xβ + Zu + e II
where y stands for the n-dimensional vector of the broiler growth and body composition traits, X represents the n × p matrix of fixed effects, β indicates the p-dimensional vector of fixed effects, Z suggests the n × q matrix of random effects, while u is the q-dimensional vector of random genetic effects, and e denotes the n-dimensional vector of random residual effects. Moreover, model II was applied in estimating the genetic parameters of the growth and body composition traits of the lean and fat lines in the G21 population of NEAUHLF.

3. Results

3.1. Identification of Genes Associated with Growth and Body Composition Traits in Broilers

Genome-wide searches for genes affecting the important economic traits in broilers were conducted using the ChIP-seq data for histone modifications. The results revealed that the TCF21 gene plays an important role in the adipose, liver, lung, and spleen tissues of broilers (Figure 1). Then, the entire gene of TCF21, as well as 2000 bp upstream and downstream of the TCF21 gene, was sequenced, and 10 SNPs were identified (Figure S1).
The genotype frequencies and allele frequencies of those 10 SNPs in the TCF21 gene in NEAUHLF were analyzed. Meanwhile, the chi-square independence test was conducted to calculate the differences in allele frequencies between the lean and fat lines. As discovered from the results, differences in the allele frequencies of these 10 SNPs were statistically significant between the lean and fat lines (p < 0.05; Table 2).

3.2. NEAUHLF Is an Ideal Test Material for Studying the Correlation between Growth and Body Composition Traits in Broilers

The phenotypic information of the growth and body composition traits is displayed in Figure 2. As observed from Figure 2, differences in most of these traits (except for HW and BW5) were significant (p < 0.05) between the lean and fat lines in the NEAUHLF population.
Furthermore, the heritability (h2) values of the growth and body composition traits were estimated. The results indicated that AFW, BW1, BW5, GSW, MSW, and TeW showed high heritability values (h2 > 0.3), whereas BW3, BW7, CW, and MeC had moderate values (0.2 < h2 < 0.3), and BoL, ChA, ChW, HW, KeL, LW, and MeL had low values (h2 < 0.2; Table 3). In addition, this study also estimated the genetic correlation (rg) between AFW and the other growth and body composition traits. As a result, at the genetic level, AFW was highly positively correlated (rg = 0.696 ± 0.223) with LW, but highly negatively correlated (−0.8 < rg < −0.3) with BoL, BW1, 3, 5, 7, GSW, KeL, and MeL. In addition, AFW showed low genetic correlations with ChW, CW, HW, MeC, MSW, and TeW (−0.3 < rg < 0.3; Table 3).

3.3. Associations of TCF21 Gene Polymorphisms with Growth and Body Composition Traits

The positions of these 10 SNPs in the TCF21 gene are shown in Figure 3A. Furthermore, this study analyzed the associations of the polymorphisms of those 10 SNPs in the TCF21 gene with the growth and body composition traits in NEAUHLF. According to the results, the polymorphisms of g.-1243C>T, g.-1171T>C, g.-911T>G, and g.-891C>T were significantly related (p < 0.05) to HW. In addition, the polymorphisms of g.2091C>T and g.2155C>T were significantly correlated (p < 0.05) with BW and TeW (Figure 3B). Linkage disequilibrium (LD) analysis revealed the existence of 2 different LD blocks, with 4 SNPs from block 1 (g.-1243C>T, g.-1171T>C, g.-911T>G and g.-891C>T) in a strong linkage disequilibrium and 2 SNPs from block 2 (g.2091C>T and g.2155C>T) were also in a strong linkage disequilibrium state (Figure 3C). All these results suggest that SNPs within Block 1 may have important effects on the HW trait, and SNPs within Block 2 may have important effects on the TeW and BW traits.
Subsequently, this study further compared the least squares means of SNPs within these two blocks for different genotypes and traits. The results showed that the CC genotype of g.-1243C>T, TT genotype of g.-1171T>C, TT genotype of g.-911T>G, and CC genotype of g.-891C>T had higher heart weight than the heterozygous genotype (p < 0.05, Figure 4). Furthermore, the TT genotype of g.2091 C>T and g.2155C>T had higher body weight and lower testicle weight in broilers (p < 0.05; Figure 4).
In order to investigate the potential molecular mechanism underlying the association of the HW trait with four SNPs from Block 1 (g.-1243C>T, g.-1171T>C, g.-911T>G, and g.-891C>T), we carried out an in silico analysis of the transcription factor binding site using three bioinformatic tools. The results showed that g.-911T>G was located in multiple potential transcription factor binding regions (Table 4).

4. Discussion

In this study, two broiler lines were divergently selected for abdominal fat content for over twenty generations. The results revealed significantly different AFW values between the lean and fat lines. In addition to AFW, some other growth and body composition traits (except for HW and BW5) also showed significant differences (p < 0.05) between the lean and fat lines. The above results indicated that when AFW was selected, the other traits associated with AFW were also under selection. Therefore, the genetic correlations between AFW and other growth and body composition traits were estimated. The results indicated that AFW showed high genetic correlations with most of the other growth and body composition traits, including LW, GSW, BW1, 3, 5, 7, MeL, KeL, and BoL. Some studies also analyzed the correlations of AFW with the growth and body composition traits in chickens and reported that AFW exhibits high genetic correlations with BW5, BW7, LW, CW, and skin weight [26,27], which are consistent with our results. Therefore, the lean and fat lines were the ideal experimental materials used to study the growth and body composition traits.
It was discovered in this study that the polymorphisms of g.2091C>T and g.2155C>T in the TCF21 gene were significantly associated (p < 0.05) with the TeW and BW traits. As revealed by studies on mammals, the TCF21 gene plays an important role in the functions of testicles [11]. In addition, the testis growth and development of chickens are controlled by genetic factors [28,29,30,31,32], and cocks with lower TeW are usually less fertile [33]. Furthermore, it is found that male mice with the TCF21 gene knockout have sex differentiation phenotypes [34]. The male sex determining factor SRY affects TeW through regulating TCF21 [35,36]. Regrettably, the least squares mean analysis revealed that the TT genotype of g.2091C>T and g.2155C>T had higher body weight and lower testicle weight. It also indicated that selection for these two SNPs did not result in neither fast growth rate (BW) nor high reproductive performance (TeW) in broilers.
Heart hypertrophy increases the risk of sudden death in broilers, especially those with higher BW and AFW traits [37]. This research study found that the polymorphisms of g.-1243C>T, g.-1171T>C, g.-911T>G, and g.-891C>T were significantly related (p < 0.05) to the HW trait. Some literature reports 13 susceptible sites are detected in a GWAS on human coronary heart disease, among which rs12190287 is located at the 3’UTR of TCF21 [38,39]. Generally, TCF21 is expressed in mesoderm cells in the epicardial organ and then in mesenchymal cells that form the pericardium [40]. The loss of TCF21 in chickens leads to epicardial blistering, increased smooth muscle differentiation on the heart surface, a paucity of interstitial fibroblasts, along with neonatal lethality [10]. It is encouraging that the least squares mean analysis revealed that the CC genotype of g.-1243C>T, TT genotype of g.-1171T>C, TT genotype of g.-911T>G, and CC genotype of g.-891C>T had higher heart weight (p < 0.05; Figure 4). It also indicated that selection for these four SNPs could improve the HeW trait without affecting other unfavorable traits at the same time in broilers. The non-coding regions of genes have a large number of regulatory elements, including enhancers, promoters, and silencers. Studies have shown that SNP located within these regulatory elements can affect traits by influencing the activity of regulatory elements [41,42,43]. In silico analysis suggested that the g.-1243C>T was located in the regions of potential binding of BACH1 [20], and the g.-911T>G was located in multiple transcription factor binding regions (GATA4, SMAD1, and SOX17). Studies have shown that these transcription factors all play important roles in animal heart development [21,22,23,24,25]. It is hypothesized that the TCF21 gene g.-911T>G regulates the HW trait probably through binding to transcription factors (GATA4, SMAD1, and SOX17) to influence the activity of regulatory elements in this region.

5. Conclusions

In this study, the associations of TCF21 gene polymorphisms with the growth and body composition traits in broilers were analyzed. The results indicate that the g.-911T>G in the TCF21 gene may be important molecular markers that affect the HW trait, and could be used in breeding programs to improve the heart development of broilers.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani12030393/s1, Figure S1: TCF21 gene SNPs typing results.

Author Contributions

Conceptualization, H.Z. and H.L.; Data curation, L.S. and J.Y.; Formal analysis, Y.G. and H.L.; Funding acquisition, H.Z.; Resources, Y.L., Z.C., P.L., F.X. and H.G.; Visualization, Y.G.; Writing—original draft, L.S. and J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Key R&D Program of China (No. 2021YFD1300100), National Natural Science Foundation of China (No. 31772586; No. 31972549), China Agriculture Research System of MOF and MARA (CARS-41), and Heilongjiang Postdoctoral Financial Assistance (LBH-Q20006). The funding body did not have any influence over the design, analysis and reporting of the study.

Institutional Review Board Statement

All animal work was conducted according to the guidelines for the Care and Use of Experimental Animals established by the Ministry of Science and Technology of the People’s Republic of China (approval number: 2006-398), and approved by the Tab of Laboratory Animal Welfare and Ethics Committee of Northeast Agricultural University (NEAUEC20170201). For reporting of results, we complied with the Animal Research: Reporting In Vivo Experiments (ARRIVE) guidelines [17].

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors would like to acknowledge the members of the Poultry Breeding Group of the College of Animal Science and Technology at the Northeast Agricultural University for managing the birds and collecting the data.

Conflicts of Interest

The authors declare no conflict of interest, and have no relevant financial or non-financial competing interests to report.

References

  1. Dierick, E.; Hirvonen, O.P.; Haesebrouck, F.; Ducatelle, R.; Van Immerseel, F.; Goossens, E. Rapid growth predisposes broilers to necrotic enteritis. Avian Pathol. 2019, 48, 416–422. [Google Scholar] [CrossRef] [PubMed]
  2. Deeb, J.; Lamont, S. Genetic Architecture of Growth and Body Composition in Unique Chicken Populations. J. Hered. 2002, 93, 107–118. [Google Scholar] [CrossRef] [Green Version]
  3. Khare, V.; Khare, A. Modern Approach in Animal Breeding by Use of Advanced Molecular Genetic Techniques. Int. J. Livest. Res. 2017, 7, 1–22. [Google Scholar] [CrossRef]
  4. Williams, J. The use of marker-assisted selection in animal breeding and biotechnology. Rev. Sci. Tech. Oie. 2005, 24, 379–391. [Google Scholar] [CrossRef]
  5. Wolc, A. Understanding genomic selection in poultry breeding. World Poult. Sci. J. 2014, 70, 309–314. [Google Scholar] [CrossRef] [Green Version]
  6. Vignal, A.; Milan, D.; SanCristobal, M.; Eggen, A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sel. Evol. 2002, 34, 275–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Wang, Q.; Wang, F.; Liu, L.; Li, Q.; Liu, R.; Zheng, M.; Cui, H.; Wen, J.; Zhao, G. Genetic Mutation Analysis of High and Low IgY Chickens by Capture Sequencing. Animals 2019, 9, 272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Zhu, B.; Li, Q.; Liu, R.; Zheng, M.; Wen, J.; Zhao, G. Genome-Wide Association Study of H/L Traits in Chicken. Animals 2019, 9, 260. [Google Scholar] [CrossRef] [Green Version]
  9. Li, W.; Zheng, M.; Zhao, G.; Wang, J.; Liu, J.; Wang, S.; Feng, F.; Liu, D.; Zhu, D.; Li, Q.; et al. Identification of QTL regions and candidate genes for growth and feed efficiency in broilers. Genet. Sel. Evol. 2021, 53, 13. [Google Scholar] [CrossRef]
  10. Braitsch, C.; Combs, M.; Quaggin, S.; Yutzey, K. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev. Biol. 2012, 368, 345–357. [Google Scholar] [CrossRef] [Green Version]
  11. Zhang, H.; Na, W.; Zhang, H.-L.; Wang, N.; Du, Z.-Q.; Wang, S.-Z.; Wang, Z.-P.; Zhang, Z.; Li, H. TCF21 is related to testis growth and development in broiler chickens. Genet. Sel. Evol. 2017, 49, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Zhang, X.; Cheng, B.; Ma, Y.; Liu, Y.; Wang, N.; Zhang, H.; Li, Y.; Wang, Y.; Luan, P.; Cao, Z.; et al. Genome-wide survey and functional analysis reveal TCF21 promotes chicken preadipocyte differentiation by directly upregulating HTR2A. Biochem. Biophys. Res. Commun. 2022, 587, 131–138. [Google Scholar] [CrossRef]
  13. Kern, C.; Wang, Y.; Xu, X.; Pan, Z.; Halstead, M.; Chanthavixay, G.; Saelao, P.; Waters, S.; Xiang, R.; Chamberlain, A.; et al. Functional annotations of three domestic animal genomes provide vital resources for comparative and agricultural research. Nat. Commun. 2021, 12, 1821. [Google Scholar] [CrossRef]
  14. Quinlan, A.R. BEDTools: The Swiss-Army Tool for Genome Feature Analysis. Curr. Protoc. Bioinform. 2014, 47, 11–12. [Google Scholar] [CrossRef]
  15. Yu, G.; Wang, L.-G.; He, Q.-Y. ChIPseeker: An R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 2015, 31, 2382–2383. [Google Scholar] [CrossRef] [Green Version]
  16. Zhang, H.; Hu, X.; Wang, Z.; Zhang, Y.; Wang, S.-Z.; Wang, N.; Leng, L.; Wang, S.; Wang, Q.; Wang, Y.; et al. Selection Signature Analysis Implicates the PC1/PCSK1 Region for Chicken Abdominal Fat Content. PLoS ONE 2012, 7, e40736. [Google Scholar] [CrossRef] [PubMed]
  17. Percie du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020, 18, e3000410. [Google Scholar] [CrossRef]
  18. Bian, L.H.; Wang, S.Z.; Wang, Q.G.; Zhang, S.; Wang, Y.X.; Li, H. Variation at the insulin-like growth factor 1 gene and its association with body weight traits in the chicken. J. Anim. Breed. Genet. 2008, 125, 265–270. [Google Scholar] [CrossRef]
  19. Dybus, A. Associations between Leu/Val polymorphism of growth hormone gene and milk production traits in Black-and-White cattle. Arch. Anim. Breed. 2002, 45, 421–428. [Google Scholar] [CrossRef] [Green Version]
  20. Yano, Y.; Ozono, R.; Oishi, Y.; Kambe, M.; Yoshizumi, M.; Ishida, T.; Omura, S.; Oshima, T.; Igarashi, K. Genetic ablation of the transcription repressor Bach1 leads to myocardial protection against ischemia/reperfusion in mice. Genes Cells 2006, 11, 791–803. [Google Scholar] [CrossRef] [PubMed]
  21. Shimizu, K.; Sunagawa, Y.; Funamoto, M.; Honda, H.; Katanasaka, Y.; Murai, N.; Kawase, Y.; Hirako, Y.; Katagiri, T.; Yabe, H.; et al. The Selective Serotonin 2A Receptor Antagonist Sarpogrelate Prevents Cardiac Hypertrophy and Systolic Dysfunction via Inhibition of the ERK1/2-GATA4 Signaling Pathway. Pharmaceuticals 2021, 14, 1268. [Google Scholar] [CrossRef] [PubMed]
  22. Cicenia, M.; Alesi, V.; Orlando, V.; Magliozzi, M.; Di Tommaso, S.; Iodice, F.G.; Pompei, E.; Toscano, A.; Digilio, M.C.; Drago, F.; et al. 8p23.1 deletion: Look out for left ventricular hypertrabeculation and not only congenital heart diseases. Single-center experience and literature revision. Am. J. Med. Genet. A 2021. [Google Scholar] [CrossRef]
  23. Liang, Y.; Xu, Y.; Ding, L.; Chen, X.; Li, H. Urotensin II Induces Cardiac Fibrosis through the TGF-β/Smad Signaling Pathway during the Development of Cardiac Hypertrophy. Int. Heart J. 2021, 62, 1135–1144. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, T.M.; Wang, S.S.; Xu, Y.J.; Zhao, C.M.; Qiao, X.H.; Yang, C.X.; Liu, X.Y.; Yang, Y.Q. SOX17 Loss-of-Function Mutation Underlying Familial Pulmonary Arterial Hypertension. Int. Heart J. 2021, 62, 566–574. [Google Scholar] [CrossRef]
  25. Zhao, L.; Jiang, W.F.; Yang, C.X.; Qiao, Q.; Xu, Y.J.; Shi, H.Y.; Qiu, X.B.; Wu, S.H.; Yang, Y.Q. SOX17 loss-of-function variation underlying familial congenital heart disease. Eur. J. Med. Genet. 2021, 64, 104211. [Google Scholar] [CrossRef]
  26. Zerehdaran, S.; Vereijken, A.L.; van Arendonk, J.A.; van der Waaijt, E.H. Estimation of genetic parameters for fat deposition and carcass traits in broilers. Poult. Sci. 2004, 83, 521–525. [Google Scholar] [CrossRef]
  27. Xiang, H.; Gan, J.; Zeng, D.; Li, J.; Yu, H.; Zhao, H.; Yang, Y.; Tan, S.; Li, G.; Luo, C.; et al. Specific Microbial Taxa and Functional Capacity Contribute to Chicken Abdominal Fat Deposition. Front. Microbiol. 2021, 12, 643025. [Google Scholar] [CrossRef] [PubMed]
  28. Quaggin, S.E.; Schwartz, L.; Cui, S.; Igarashi, P.; Deimling, J.; Post, M.; Rossant, J. The basic-helix-loop-helix protein pod1 is critically important for kidney and lung organogenesis. Development 1999, 126, 5771–5783. [Google Scholar] [CrossRef] [PubMed]
  29. Petrovic, N.; Walden, T.B.; Shabalina, I.G.; Timmons, J.A.; Cannon, B.; Nedergaard, J. Chronic peroxisome proliferator-activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1-containing adipocytes molecularly distinct from classic brown adipocytes. J. Biol. Chem. 2010, 285, 7153–7164. [Google Scholar] [CrossRef] [Green Version]
  30. Akama, T.; Chun, T.H. Transcription factor 21 (TCF21) promotes proinflammatory interleukin 6 expression and extracellular matrix remodeling in visceral adipose stem cells. J. Biol. Chem. 2018, 293, 6603–6610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Lambeth, L.S.; Smith, C.A. Disorders of sexual development in poultry. Sex. Dev. 2012, 6, 96–103. [Google Scholar] [CrossRef] [PubMed]
  32. Morris, K.R.; Hirst, C.E.; Major, A.T.; Ezaz, T.; Ford, M.; Bibby, S.; Doran, T.J.; Smith, C.A. Gonadal and Endocrine Analysis of a Gynandromorphic Chicken. Endocrinology 2018, 159, 3492–3502. [Google Scholar] [CrossRef]
  33. Zheng, J.X.; Liu, Z.Z.; Yang, N. Deficiency of growth hormone receptor does not affect male reproduction in dwarf chickens. Poult. Sci. 2007, 86, 112–117. [Google Scholar] [CrossRef] [PubMed]
  34. Cui, S.; Ross, A.; Stallings, N.; Parker, K.L.; Capel, B.; Quaggin, S.E. Disrupted gonadogenesis and male-to-female sex reversal in Pod1 knockout mice. Development 2004, 131, 4095–4105. [Google Scholar] [CrossRef] [Green Version]
  35. Bhandari, R.; Sadler-Riggleman, I.; Clement, T.; Skinner, M. Basic Helix-Loop-Helix Transcription Factor TCF21 Is a Downstream Target of the Male Sex Determining Gene SRY. PLoS ONE 2011, 6, e19935. [Google Scholar] [CrossRef] [Green Version]
  36. Bhandari, R.; Schinke, E.; Haque, M.; Sadler-Riggleman, I.; Skinner, M. SRY Induced TCF21 Genome-Wide Targets and Cascade of bHLH Factors During Sertoli Cell Differentiation and Male Sex Determination in Rats. Biol. Reprod. 2012, 87, 131. [Google Scholar] [CrossRef]
  37. Lin, H.Y.; Chou, P.C.; Chen, Y.H.; Lai, L.S.; Chung, T.K.; Walzem, R.L.; Huang, S.Y.; Chen, S.E. Dietary Supplementation of 25-Hydroxycholecalciferol Improves Livability in Broiler Breeder Hens-Amelioration of Cardiac Pathogenesis and Hepatopathology. Animals 2019, 9, 770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Zhong, H.; Beaulaurier, J.; Lum, P.; Molony, C.; Yang, X.; MacNeil, D.; Weingarth, D.; Zhang, B.; Greenawalt, D.; Dobrin, R.; et al. Liver and Adipose Expression Associated SNPs Are Enriched for Association to Type 2 Diabetes. PLoS Genet. 2010, 6, e1000932. [Google Scholar] [CrossRef] [Green Version]
  39. Consortium, T.; Kanoni, S.; Willenborg, C.; Farrall, M.; Assimes, T.; Thompson, J.; Ingelsson, E.; Saleheen, D.; Erdmann, J.; Goldstein, B.; et al. Large-scale association analysis identifies new risk loci for coronary artery disease. Nat. Genet. 2012, 45, 25–33. [Google Scholar] [CrossRef]
  40. Hidai, H.; Bardales, R.; Goodwin, R.; Quertermous, T.; Quertermous, E. Cloning of capsulin, a basic helix-loop-helix factor expressed in progenitor cells of the pericardium and the coronary arteries1. Mech. Develop. 1998, 73, 33–43. [Google Scholar] [CrossRef]
  41. Mann, A.; Bhatia, S. Zebrafish: A Powerful Model for Understanding the Functional Relevance of Noncoding Region Mutations in Human Genetic Diseases. Biomedicines 2019, 7, 71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. McEwan, A.R.; MacKenzie, A. Perspective: Quality Versus Quantity; Is It Important to Assess the Role of Enhancers in Complex Disease from an In Vivo Perspective? Int. J. Mol. Sci. 2020, 21, 7856. [Google Scholar] [CrossRef] [PubMed]
  43. Soltani-Fard, E.; Taghvimi, S.; Abedi Kichi, Z.; Weber, C.; Shabaninejad, Z.; Taheri-Anganeh, M.; Hossein Khatami, S.; Mousavi, P.; Movahedpour, A.; Natarelli, L. Insights into the Function of Regulatory RNAs in Bacteria and Archaea. Int. J. Transl. Med. 2021, 1, 403–423. [Google Scholar] [CrossRef]
Animals 12 00393 g001 550
Figure 1. Bioinformatics analysis of the TCF21 gene in chickens.
Figure 1. Bioinformatics analysis of the TCF21 gene in chickens.
Animals 12 00393 g001
Animals 12 00393 g002 550
Figure 2. Phenotypic information regarding the growth and body composition traits in NEAUHLF. *, p < 0.05; **, p < 0.01; ns, p > 0.05 (nonsignificant). Abdominal fat weight (AFW), body oblique length (BoL), body weight at birth of age (BW0), body weight at 1 week of age (BW1), body weight at 3 weeks of age (BW3), body weight at 5 weeks of age (BW5), body weight at 7 weeks of age (BW7), chest angle (ChA), chest width (ChW), carcass weight (CW), glandular stomach weight (GSW), heart weight (HW), keel length (KeL), liver weight (LW), metatarsus circumference (MeC), metatarsus length (MeL), muscular stomach weight (MSW), spleen weight (SW), and testicle weight (TeW).
Figure 2. Phenotypic information regarding the growth and body composition traits in NEAUHLF. *, p < 0.05; **, p < 0.01; ns, p > 0.05 (nonsignificant). Abdominal fat weight (AFW), body oblique length (BoL), body weight at birth of age (BW0), body weight at 1 week of age (BW1), body weight at 3 weeks of age (BW3), body weight at 5 weeks of age (BW5), body weight at 7 weeks of age (BW7), chest angle (ChA), chest width (ChW), carcass weight (CW), glandular stomach weight (GSW), heart weight (HW), keel length (KeL), liver weight (LW), metatarsus circumference (MeC), metatarsus length (MeL), muscular stomach weight (MSW), spleen weight (SW), and testicle weight (TeW).
Animals 12 00393 g002
Animals 12 00393 g003 550
Figure 3. Identification of functional SNPs in the TCF21 gene. (A) The distribution of SNPs in the TCF21 gene. (B) Associations of TCF21 gene polymorphisms with the growth and body composition traits in G21 populations. The red line indicates the significant threshold p < 0.05. (C) Linkage disequilibrium (LD) analysis of these 10 SNPs.
Figure 3. Identification of functional SNPs in the TCF21 gene. (A) The distribution of SNPs in the TCF21 gene. (B) Associations of TCF21 gene polymorphisms with the growth and body composition traits in G21 populations. The red line indicates the significant threshold p < 0.05. (C) Linkage disequilibrium (LD) analysis of these 10 SNPs.
Animals 12 00393 g003
Animals 12 00393 g004 550
Figure 4. Analysis of the phenotypes of different genotypes of functional SNPs. * indicates a significant difference, p < 0.05.
Figure 4. Analysis of the phenotypes of different genotypes of functional SNPs. * indicates a significant difference, p < 0.05.
Animals 12 00393 g004
Table
Table 1. Primers used to amplify the SNPs in the TCF21 gene.
Table 1. Primers used to amplify the SNPs in the TCF21 gene.
SNP IDPrimers (5′ to 3′)Size of Product (bp)Annealing ConditionsNumber of CyclesrEndonuclease
g.-1243C>T
(rs741031208)		F: CTGAATAGTTGGATTTTCCCCTGCC
R:CTGATGGAGTCGAAGAGGGGTTTTA		38961 °C 35 s35HPyCH4IV
g.-1171T>G
(rs312348545)		F:AGGTGTGTGAAGAAGGAAGGAGATACTGGGGAAGGC
R:GATAAGGTCCCTGGCTGTGGGGCTGCATGC		30764 °C 30 s35HinP1I
g.-911T>G
(rs739858013)		F: CCTTATCTTGCCTGTTTACTC
R: GCACTTGGACCTCGCTATT		37955 °C 35 s35HinFI
g.-891>T
(rs735029013)		F: GGAGCCCTCTCTTCCCCTCTTCTT
R:CGTGCTGTCTAAACGCTGTCCTGTA		33261.8 °C 35 s35RsaI
g.691C>T
(rs16282937)		F: TCCACTGGTCCCCACTGTCCCGT
R: GGTTGGGCACAAAGCCTCAAAAGC		27357.8 °C 35 s35BstNI
g.897T>C
(rs316577617)		F: TCCACTGGTCCCCACTGTCCCGT
R: GGTTGGGCACAAAGCCTCAAAAGC		27360 °C 35 s35PvuII
g.1033G>A
(rs16282934)		F: GTCCCCTCCACTGGTCCCCACTGT
R: GGGAGTGCTTTCTGGTGTGGCCG		39460 °C 35 s40HinP1I
g.1892A>G
(rs793941727)		F:TTGTCTGAGACCTGTGGAATATGTAGATGCCTTGA
R:GGCAATAATCCTCAGCCCCACACCGA		51263.9 °C 30 s35BpuEI
g.2091C>T
(rs314263759)		F: TACTTTTCGTTTCCAACTCACCAGG
R:GACATCTTGTAAACAGTGCGGTCATAAC		53660 °C 30 s35AhdI
g.2155C>T
(rs16282929)		F:ATTGAGTGCGTGTGCAGTCGAGTGTC
R:CTCAGAGTTGACCCTCCTTGGGGAGTC		43262 °C 30 s35HpaII
Table
Table 2. The differences in allele frequencies of SNPs between the lean and fat lines.
Table 2. The differences in allele frequencies of SNPs between the lean and fat lines.
SNPsStrainGenotype Frequency (No. of Birds)Allele Frequencyχ2
g.-1243C>T CCTCTTCT
Lean line0.701 (235)0.278 (93)0.021 (7)0.840.1621.66577
Fat line0.547 (186)0.379 (129)0.074 (25)0.7370.263(p < 0.01)
g.-1171T>C TTTCCCTC
Lean line0.728 (244)0.266 (89)0.006 (2)0.8610.13928.45446
Fat line0.562 (190)0.367 (124)0.071 (24)0.7460.254(p < 0.01)
g.-911T>G TTTGGGTG
Lean line0.697 (232)0.294 (98)0.009 (3)0.8440.15620.67613
Fat line0.56 (190)0.366 (124)0.074 (25)0.7430.257(p < 0.01)
g.-891C>T CCCTTTCT
Lean line0.77 (258)0.227 (76)0.003 (1)0.8840.11639.40273
Fat line0.574 (195)0.356 (121)0.07 (24)0.7510.249(p < 0.01)
g.691C>T CCCTTTCT
Lean line0.49 (164)0.409 (137)0.101 (34)0.6940.306103.2983
Fat line0.2 (68)0.438 (149)0.362 (123)0.4190.581(p < 0.01)
g.897T>C CCCTTTGT
Lean line0 (1)0.3 (101)0.7 (230)0.1550.845133.2732
Fat line0.212 (72)0.465 (158)0.323 (110)0.4440.556(p < 0.01)
g.1033G>A AAAGGGAG
Lean line0.62 (207)0.32 (101)0.06 (20)0.780.2269.4667
Fat line0.34 (116)0.45 (151)0.21 (71)0.5670.433(p < 0.01)
g.1892A>G AAAGGGAG
Lean line0.184 (59)0.763 (245)0.053 (17)0.5650.43538.83882
Fat line0.467 (154)0.527 (174)0.006 (2)0.730.27(p < 0.01)
g.2091C>T TTTGCCTC
Lean line0.8445 (277)0.137 (45)0.018 (6)0.9090.09161.71857
Fat line1 (340)0 (0)0 (0)10(p < 0.01)
g.2155C>T TTTCCCTC
Lean line0.728 (244)0.238 (80)0.033 (11)0.8480.15263.82669
Fat line0.45 (153)0.421 (143)0.129 (44)0.660.34(p < 0.01)
χ2 indicates chi-squared distribution.
Table
Table 3. Phenotypic traits, heritability, and genetic correlation between abdominal fat and other phenotypic traits.
Table 3. Phenotypic traits, heritability, and genetic correlation between abdominal fat and other phenotypic traits.
Traits (Unit)HeritabilityGenetic Correlation
AFW (g)0.485 ± 0.0961
BoL (cm)0.069 ± 0.063−0.716 ± 0.308
BW1 (g)0.500 ± 0.102−0.332 ± 0.160
BW3 (g)0.218 ± 0.080−0.515 ± 0.194
BW5 (g)0.304 ± 0.086−0.345 ± 0.200
BW7 (g)0.224 ± 0.080−0.565 ± 0.190
ChA (°)0.096 ± 0.0430.213 ± 0.132
ChW (cm)0.083 ± 0.0620.240 ± 0.306
CW (g)0.273 ± 0.091−0.155 ± 0.255
GSW (g)0.537 ± 0.097−0.340 ± 0.150
HW (g)0.187 ± 0.0720.165 ± 0.216
KeL (cm)0.193 ± 0.073−0.329 ± 0.204
LW (g)0.131 ± 0.0660.696 ± 0.223
MeC (cm)0.250 ± 0.084−0.133 ± 0.198
MeL (cm)0.176 ± 0.076−0.438 ± 0.208
MSW (g)0.662 ± 0.094−0.181 ± 0.145
TeW (g)0.413 ± 0.1060.199 ± 0.238
The bold indicates moderate or higher heritability or genetic correlation.
Table
Table 4. Transcription factor binding site analysis.
Table 4. Transcription factor binding site analysis.
SNPsBase GroupTranscription FactorsFunction
g.-1243C>TCBACH1Myocardial ischemia [20]
g.-1171T>C---
g.-911T>GTGATA4Key regulators of heart gene expression [21,22]
SMAD1protects cardiomyocytes from ischemia-reperfusion injury [23]
SOX17Early heart development in mouse embryos [24,25]
g.-891C>T---
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Shen, L.; Yu, J.; Ge, Y.; Li, H.; Li, Y.; Cao, Z.; Luan, P.; Xiao, F.; Gao, H.; Zhang, H. Associations of Transcription Factor 21 Gene Polymorphisms with the Growth and Body Composition Traits in Broilers. Animals 2022, 12, 393. https://doi.org/10.3390/ani12030393

AMA Style

Shen L, Yu J, Ge Y, Li H, Li Y, Cao Z, Luan P, Xiao F, Gao H, Zhang H. Associations of Transcription Factor 21 Gene Polymorphisms with the Growth and Body Composition Traits in Broilers. Animals. 2022; 12(3):393. https://doi.org/10.3390/ani12030393

Chicago/Turabian Style

Shen, Linyong, Jiaqiang Yu, Yaowen Ge, Hui Li, Yumao Li, Zhiping Cao, Peng Luan, Fan Xiao, Haihe Gao, and Hui Zhang. 2022. "Associations of Transcription Factor 21 Gene Polymorphisms with the Growth and Body Composition Traits in Broilers" Animals 12, no. 3: 393. https://doi.org/10.3390/ani12030393

APA Style

Shen, L., Yu, J., Ge, Y., Li, H., Li, Y., Cao, Z., Luan, P., Xiao, F., Gao, H., & Zhang, H. (2022). Associations of Transcription Factor 21 Gene Polymorphisms with the Growth and Body Composition Traits in Broilers. Animals, 12(3), 393. https://doi.org/10.3390/ani12030393

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop