Next Article in Journal
Ecological Niche Characteristics of the Diets of Three Sympatric Rodents in the Meili Snow Mountain, Yunnan
Next Article in Special Issue
Reassortants of the Highly Pathogenic Influenza Virus A/H5N1 Causing Mass Swan Mortality in Kazakhstan from 2023 to 2024
Previous Article in Journal
Short-Term Effects of Heat Stress on Cow Behavior, Registered by Innovative Technologies and Blood Gas Parameters
Previous Article in Special Issue
The Role of Hunters in Wildlife Health Research and Monitoring: Their Contribution as Citizen Scientists in Italy
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Genetic Identification of Numerous Apicomplexan Sarcocystis Species in Intestines of Common Buzzard (Buteo buteo)

by
Tautvilė Šukytė
,
Evelina Juozaitytė-Ngugu
,
Saulius Švažas
,
Dalius Butkauskas
and
Petras Prakas
*
Nature Research Centre, Akademijos 2, 08412 Vilnius, Lithuania
*
Author to whom correspondence should be addressed.
Animals 2024, 14(16), 2391; https://doi.org/10.3390/ani14162391
Submission received: 22 July 2024 / Revised: 15 August 2024 / Accepted: 15 August 2024 / Published: 18 August 2024
(This article belongs to the Special Issue Interdisciplinary Perspectives on Wildlife Disease Ecology)

Abstract

:

Simple Summary

Sarcocystis parasites (Apicomplexa: Sarcocystidae) exhibit a complex life cycle necessitating two hosts and infect a wide range of mammals, birds, and reptiles. Birds of prey, positioned at the apex of the food chain, serve as definitive hosts for various Sarcocystis species. This study focuses on the molecular identification of Sarcocystis species in the intestines of the Common Buzzard (Buteo buteo). For this purpose, the small intestines of 30 birds were tested. Microscopic examination of intestinal scrapings and molecular analysis showed that 73.3% of the birds examined were infected with Sarcocystis spp. Nine Sarcocystis species using birds or rodents as their intermediate hosts were confirmed in the small intestines of Common Buzzards by means of DNA analysis. The highest detection rates were established for S. glareoli (53.3%) forming cysts in the brains of rodents and for S. halieti (36.7%) forming sarcocysts in the muscles and brains of birds. In conclusion, the Common Buzzard can transmit numerous Sarcocystis spp., including pathogenic ones.

Abstract

The common Buzzard (Buteo buteo) was previously shown to transmit two Sarcocystis species (S. glareoli and S. microti) forming cysts in the brains of rodents. Due to a lack of research, the richness of Sarcocystis species spread by these birds of prey is expected to be much higher. A total of 30 samples of the small intestine of the Common Buzzard were collected in Lithuania and subjected to Sarcocystis species identification based on nested PCR of 28S rRNA and ITS1, following the sequencing of amplified DNA fragments. Six known Sarcocystis spp., S. cornixi, S. glareoli, S. halieti, S. kutkienae, S. turdusi, and S. wobeseri, along with three genetically distinct species (Sarcocystis sp. Rod3, Sarcocystis sp. Rod4, and Sarcocystis sp. Rod5), were identified. Phylogenetically, these three potentially new species clustered with Sarcocystis spp. characterised by a rodents-birds life cycle. Sarcocystis spp. employing rodents and birds as their intermediate hosts were detected in 66.7% and 50.0% of samples, respectively. These findings are consistent with the diet preferences of Common Buzzards. Notably, co-infections with two or more species were observed in a half of the samples. Altogether, the obtained results indicate that the Common Buzzard could serve as definitive host of various Sarcocystis species.

1. Introduction

The Common Buzzard (Buteo buteo) is a numerous and widespread raptor species that breeds throughout Eurasia to the south of the tundra region and up to China, Kazakhstan, Iran, and Turkey in the south [1]. According to the IUCN Red List, the total Common Buzzard population size is between 2.1 and 3.7 million mature individuals, and its population is stable [2]. The European population is estimated at about 814,000–1,390,000 pairs (equating to 1,630,000–2,770,000 mature individuals), while the Lithuanian breeding population is estimated at about 6000–12,000 pairs [3]. It is the most common diurnal raptor in Europe and Lithuania [1,4]. Common Buzzards are year-round residents over much of their distribution range, though birds breeding in the northern and eastern parts of their range are strict or partial migrants [5]. In Lithuania, they occur throughout the year, though most local breeders migrate to wintering sites located in southern Europe and northern Africa [6]. Common Buzzards mainly use a wide range of woodland habitats, but they also breed in agricultural and sub-urban habitats [7]. It is a common breeder in all administrative districts of Lithuania, with an average estimated population density of 14.2 pairs/100 km2 of forested area and up to 159.4 pairs/100 km2 in optimum habitats [8].
Sarcocystis parasites (Apicomplexa: Sarcocystidae) are characterised by an obligatory two-host life cycle. They can infect mammals (including humans), reptiles, and birds [9]. Birds of prey are at the top of the food chain and serve as definitive hosts (DHs) of numerous Sarcocystis species, mainly using birds and rodents as their intermediate hosts (IHs) [10,11,12]. The DH becomes infected by a consumption of tissues containing mature sarcocysts, while the IH acquires infection through food or water contaminated with sporocysts of Sarcocystis spp. Sarcocysts most frequently develop in the muscles and central nervous system (CNS) of the IH, whereas sporulation of oocysts occurs in the small intestine of the DH [9,10,13]. Some species of Sarcocystis are pathogenic to their IHs [10,13]. The disclosure of DHs of certain species is very important for identifying pathways of parasite spread. These parasites are described in the IH, while the DH of many Sarcocystis species is unknown [10].
The Common Buzzard was identified as the DH of two Sarcocystis species, S. glareoli and S. microti. These species form cysts in the CNS of rodents [12,14,15,16,17,18]. There is evidence indicating that rodents infected with these parasites exhibit a higher risk of being caught by predators compared to uninfected individuals [19]. Previously, two genera were known in the subfamily Sarcocystinae: Sarcocystis and Frenkelia. Between 1998 and 2000, Frenkelia have been synonymised with the genus Sarcocystis, and the species F. glareoli was reclassified as S. glareoli, and F. microti was renamed S. microti [20,21,22]. For more detailed information, please see the following articles: [10,12,23]. In GenBank, the sequences of S. microti and S. glareoli are assigned to either the genera Freneklia (AF009244, AF009245, AF044251, AF044252, AF076863, AF076864, PP350820, and PP350821) or Sarcocystis (PP535695–PP535700).
Sarcocystis microti induces infection in a wider IH range than S. glareoli and is considered to be less IH-specific. Cysts of S. microti have been identified in at least ten genera of rodents [10,24,25,26]. In contrast, the bank vole (Clethrionomys glareolus) is considered the main IH of S. glareoli [10,27,28]. The determination of IHs of S. glareoli and S. mirroti was mainly established by microscopical methods [10,14,15,16,26,29,30,31,32]. However, very morphologically similar sarcocysts representing different Sarcocystis species are found in closely related IHs. Therefore, DNA analysis methods should be used to confirm the Sarcocystis species [12]. The infection of S. glareoli has been reported only in Europe [12,27,28,29,30,31,32,33,34,35,36,37], while S. microti has been detected worldwide in North America [18], Europe [27,28,29,30,31,32,33,34,35,36,37,38], and Japan [39].
Birds are an important part of the diet of Common Buzzards [1,3,40,41,42,43]. Therefore, in the present study, we aimed to clarify whether Common Buzzards can serve as DHs of Sarcocystis spp. using birds as their IHs. Notably, three Sarcocystis spp., S. calchasi, S. falcatula, and S. halieti, cause diseases in birds of several different orders, and S. calchasi and S. falcatula infections can result in mortality of wild birds [44,45,46]. Of these species, S. calchasi and S. halieti are known to be transmitted via birds of prey [11,47,48,49,50]. Furthermore, eight more species of Sarcocystis forming sarcocysts in the tissues of birds are using birds as their DH [10,11,50,51]. Specifically, S. accipitris, S. alectoributeonis, S. columbae, S. cornixi, S. kutkienae, S. lari, S. turdusi, and S. wobeseri have been shown to be spread by birds of the families Accipitridae and Corvidae [10,11,33,48,49,50,51].
The determination of the DHs of Sarcocystis species is complicated. Morphometric measurements of oocysts and sporocysts of different Sarcocystis spp. often overlap. Thus, the morphological species identification in DHs is usually impossible [10,11,48,49,50,51]. In addition, it is generally not possible to determine morphologically how many different Sarcocystis species are present in a naturally infected predator. It has been repeatedly demonstrated that DHs can be simultaneously infected with sporocysts by several Sarcocystis spp. [10,11,48,49,50,51,52,53]. The DH of Sarcocystis spp. is often discovered using experimental infection [10,54,55,56]. However, due to ethical issues, such studies are becoming less common in birds of prey and wild predatory mammals [57]. In contrast, molecular methods are increasingly being used to identify Sarcocystis species in the small intestine scrapings of naturally infected predators and scavengers [11,12,49,50,51,52,53,58]. Furthermore, phylogenetic analysis can indicate a group of animals (e.g., birds, mammals, and reptiles) as potential DHs of specific Sarcocystis species [59,60,61,62]. For instance, Sarcocystis species using birds as their IH are placed into two clusters based on parasite DHs, birds of prey, or predatory mammals [59].
The mitochondrially encoded cytochrome c oxidase I (cox1) is the best choice for the genetic identification of Sarcocystis species that use ungulates as IHs [63,64]. However, this locus is too conservative to discriminate Sarcocystis spp. forming sarcocysts in muscles or CNS of birds and rodents. The ITS1 (internal transcribed spacer 1) is the most reliable marker for identifying Sarcocystis spp. using birds as IHs [61,65]. The 28S rRNA was shown to be a useful gene for the detection of Sarcocystis spp. that use rodents as their IH [12,36,37].
In a previous study, we identified S. glareoli in 5 of 10 examined intestinal mucosa scraping samples of the Common Buzzard collected in Lithuania [12]. However, in accordance with the diet of these birds, we assumed that the Sarcocystis species richness spread by the Common Buzzard is considerably higher. Therefore, we continued our research to determine the role of the Common Buzzard in transmitting Sarcocystis spp. The objective of the present study was, by means of DNA analysis, to identify Sarcocystis spp. using birds and rodents as their IHs in the intestines of the Common Buzzard.

2. Materials and Methods

2.1. Collection of Common Buzzard Samples

A total of 30 Common Buzzards (isolates BbLT11–BbLT40) were collected between 2020 and 2023 in different districts of Lithuania, mainly in Trakai and Ukmergė. All birds obtained from the Kaunas Tadas Ivanauskas Zoology Museum (the Lithuanian national authority responsible for monitoring dead birds) were found dead as a result of collisions with motor vehicles, power lines, buildings, etc., and were kept frozen at −20 °C until microscopic and molecular examinations had been conducted. The current investigation was approved by the Animal Welfare Committee of the Nature Research Centre (no. GGT-9).

2.2. Preparation of Intestines and Microscopical Characterisation of Sarcocystis spp.

Sarcocystis spp. were isolated from the intestines of each Common Buzzard employing a modified technique based on Verma et al. [66]. This method is suitable for the isolation of the different developmental stages of Sarcocystis spp. including oocysts, sporulated oocysts, and sporocysts. The necropsy of the bird was prepared by making a longitudinal incision in the intestine and scraping the mucosal surface. The exfoliated epithelium was immersed in 50 mL of distilled water (dH2O) and homogenised with a commercial mixer at high speed for 1–2 min. The resulting homogenate was centrifuged at 1600 rpm for 6 min at 20 °C and the supernatant removed. The remaining sediments were resuspended in 50 mL of fresh distilled water. Homogenisation, centrifugation, and washing were repeated until the supernatant remained clear. The resulting sediments was diluted 1:1 with HBSS (Hank’s balanced salt solution) and 5.25% sodium hypochlorite solution. The mixture was incubated in an ice bath for 30 min. The centrifugation procedure was then repeated by partial decantation of the supernatant and addition of distilled water until the odour of sodium hypochlorite disappeared. The obtained sediments were evaluated for oocysts/sporocysts under a light microscope (LM) at ×400 magnification. At the last step, 400 µL of resuspended sediment was used from each sample for DNA isolation. DNA extraction was conducted for all bird samples, irrespective of the presence of Sarcocystis spp. oocysts/sporocysts.

2.3. Molecular Analysis of Sarcocystis spp.

The isolation of genomic DNA from intestinal scrapings of Common Buzzards was performed using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania).
The identification of Sarcocystis spp. employing birds as IHs was carried out using a previously described method based on species-specific nested PCR of ITS1 and sequencing [11,51]. The primers used for the amplification of ITS1 fragments are listed in Table 1. In this way, the presence of S. calchasi, S. columbae, S. cornixi, S. corvusi, S. fulicae, S. halieti, S. kutkienae, S. lari, S. turdusi, and S. wobeseri was checked in the samples analysed. The following 10 species were previously reported in Lithuania. It is known or suggested by phylogenetic results that these Sarcocystis species use birds as their DH. The SU1F/5.8SR2 primer pair was applied in the first round of the nested PCR, while the following ten primer pairs were used to identify target Sarcocystis species from birds.
The detection of Sarcocystis spp. employing rodents as IHs was performed by nested PCR of 28S rRNA and ITS1 followed by sequencing. Some of the primers used for the amplification of these species were designed in the current study by the Primer3Plus program (Table 1). For the design of GsSglajamF1/GsSglajamR1 primer, we used recently isolated DNA of S. glareoli isolated from four individual cysts retrieved from the brains of four individual bank voles [36]. To amplify the 28S rRNA, Sgrau281 and Sgrau282 primers were used in the first step of the nested PCR. In a second round of nested PCR, we used three primer pairs, GsSglaF1/GsSglaR1, GsSmicF1/GsSmicR1 and SgraupaukF/SgraupaukR, theoretically amplifying S. glareoli, S. microti, and Sarcocsystis spp. using rodents as their IHs, respectively. Fragments of the ITS1 region were amplified using the external primer pair SU1F/5.8SR2 and the internal primers GsSglajamF1 and GsSglajamR1. PCRs were conducted in a 25 μL mixture that included 4 μL of template DNA, 0.5 μM of both forward and reverse primers, 12.5 μL of DreamTaq PCR Master Mix (Thermo Fisher Scientific Baltics, Vilnius, Lithuania), and the remaining amount of nuclease-free water. Three negative controls were used: (i) a control of the first amplification step using nuclease-free water instead of DNA template, (ii) a control of the second step of nested PCR using water instead of the target DNA, and (iii) a control of the second step of nested PCR adding 1 μL of negative control of the first step. The PCR was initiated with an initial hot start at 94 °C for 5 min, followed by 35 cycles of 94 °C for 35 s, annealing for 54 to 61 °C according to the primers for 45 s and 72 °C for 55 s, and a final extension at 72 °C for 5 min. The amplified products were visualised using 1.0% agarose gel electrophoresis and purified with the help of ExoI and FastAP (Thermo Fisher Scientific Baltics, Vilnius, Lithuania).
The PCR products were sequenced directly using the same forward and reverse primers as for the PCR. Sequencing reactions were performed using the Big-Dye® Terminator v3.1 Cycle Sequencing Kit and the 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s recommendations. The resulted sequences were compared with those of various Sarcocystis spp. available in NCBI GenBank using the nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/, accessed on 19 June 2024). Notably, only pure DNA sequences without double peaks or polysignals were used for further analysis, whereas impure sequences obtained in several cases indicating sequencing errors or mixed Sarcocystis species infections were excluded from further investigations. The Sarcocystis spp. sequences generated in the current work were submitted to GenBank with the accession numbers PP937189, PP937483–PP937522, and PP938236–PP938271.

2.4. Phylogenetic Analysis

The phylogenetic relationships of the detected Sarcocystis spp. using birds as IHs were disclosed in our previous works [11,51,62]. In the current study, we obtained potentially new Sarcocystis species using rodents as IHs; therefore, the phylogenetic analysis focused on the relationships between these species.
Phylogenetic testing was carried out with the help of MEGA11 version 11.0.13 software [67]. Multiple sequence alignments of partial 28S rRNA and ITS1 sequences were performed using the MUSCLE algorithm. The reconstruction of phylogenetic relationships was conducted using the Maximum Likelihood (ML) approach. The selection of nucleotide evolution model has been made using the “Find Best DNA/Proteins Models (ML)” option by the generated lowest scores of Bayesian Information Criterion. Thereby, the Tamura 3 parameter + G evolutionary model was proposed to examine the phylogenetic relationships of the 28S rRNA and ITS1 sequences. Gaps/missing data were treated using the complete deletion option. Toxoplasma gondii and S. falcatula were set as outgroups of the 28S rRNA and ITS1 analyses, respectively. The reliability of the resulted trees was assessed by the bootstrap method with 1000 replications.

3. Results

3.1. Microscopical Detection of Sarcocystis spp. Oocysts/Sporocyst

The examination of the intestinal scraping samples under a light microscope revealed Sarcocystis spp. infection in 22 of 30 (73.3%) Common Buzzards. Under LM, the detected sporocysts were 10.8–18.2 × 8.1–13.9 μm (14.6 × 10.9 μm; n = 83) in size, while the sporulated oocysts measured 8.1–16.3 × 15.3–21.5 μm (12.8 × 17.4 μm; n = 27) (Figure 1).

3.2. Molecular Identification of Sarcocystis spp. Using Birds as Their Intermediate Hosts and Common Buzzards as Definitive Hosts

Five different Sarcocystis species, S. cornixi, S. halieti, S. kutkienae, S. turdusi, and S. wobeseri, employing birds as their IHs, have been identified in the intestines of the Common Buzzard (Table 2). Our ITS1 sequences, excluding primer binding sites, ranged from 435 bp to 596 bp. Eleven obtained sequences of S. halieti showed 97.3–100% similarity compared to each other, two sequences of S. kutkienae generated in this work differed by 0.5%, while no intraspecific polymorphism was observed while analysing the other species detected. Based on the analysed ITS1 fragments, the intraspecific genetic similarity values, calculated using sequences obtained in the present study and those available in GenBank, were 96.3–100%. By contrast, the intraspecific genetic similarity values obtained comparing with the most closely related species did not exceed 92.7%. Thus, the calculated intraspecific and interspecific genetic similarity values for all five detected species did not overlap, verifying the accuracy of species identification.

3.3. Molecular Characterisation of S. glareoli and Three Potentially New Sarcocystis Species Detected in Intestines of Common Buzzards

At first, three primer pairs (GsSglaF1/GsSglaR1, GsSmicF1/GsSmicR1, and SgraupaukF/SgraupaukR) amplifying 28S rRNA fragments (Table 1) were used for the screening of S. glareoli, S. microti, and other Sarcocystis spp. using rodents as their IHs. No amplification was obtained with GsSmicF1/GsSmicR1. Nineteen samples appeared to be positive using GsSglaF1/GsSglaR1 and/or SgraupaukF/ SgraupaukR primer pairs (Table S1). The 28S rRNA sequences generated in 16 isolates of Common Buzzards showed 99.8–100% similarity to those S. glareoli, 99.6–99.7% similarity to those of S. jamaicensis, and 99.3–99.6% similarity to those of Sarcocystis sp. Rod3. Meanwhile 28S rRNA sequences obtained in two isolates of Common Buzzards (BbLT18 and BbLT36) demonstrated 100% similarity to those of Sarcocystis sp. Rod3., 99.8% similarity to those of S. jamaicensis, and 99.4–99.7% similarity to those of S. glareoli (Tables S1 and S2).
Based on the analysed 28S rRNA fragments, minor genetic differences between S. glareoli, S. jamaicensis, and Sarcocystis sp. Rod3 were observed. Therefore, for the separation of these taxa, we decided to design a primer targeting highly variable ITS1. As a result, four 100% identical sequences of S. glareoli containing partial 18S rRNA, complete ITS1, and partial 5.8S rRNA were obtained. The ITS1 region sequence was submitted to GenBank under accession number PP937189. This 1006 bp sequence displayed 93.0% similarity (98% query coverage) compared to S. jamaicensis (KY994651) and less than 85% compared to other Sarcocystis spp. available. Afterwards, the GsSglajamF1/GsSglajamR1 primer pair was designed in silico to amplify S. glareoli and S. jamaicensis. By using GsSglajamF1/GsSglajamR1 primers, we have obtained eighteen 518 bp ITS1 sequences. Among them, 16 sequences (PP937483–P937498) showed 100% identity to each other and to that of S. glareoli (PP937189) and 88.6% similarity to that of S. jamaicensis (KY994651) (Table 3). The other two identical sequences (PP937499 and PP937500) demonstrated 98.5% similarity to those of S. glareoli (PP937189 and PP937483–P937498) and 87.6% similarity to that of S. jamaicensis (KY994651). We obtained these two sequences in the same isolates of Common Buzzards (BbLT18 and BbLT36) in which the generated 28S rRNA sequences displayed 100% identity to Sarcocystis sp. Rod3 (Table S1). Thus, based on 28S rRNA and ITS1 sequences, S. glareoli and presumably another taxon preliminary named Sarcocystis sp. Rod3 were established. At ITS1, these two taxa differed by 1.5%, which were due to eight stable single-nucleotide polymorphisms (SNPs).
Furthermore, with the help of the SgraupaukF/SgraupaukR primer pair, we have obtained three 28S rRNA sequences demonstrating ≤95.0% similarity compared to S. glareoli, S. jamaicensis, S. microti, and Sarcocystis sp. Rod3 (Table S2). Among them, two identical sequences (PP938269 and PP938270) showed 97.7% similarity to the third one (PP938271), 100% similarity to that of Sarcocystis sp. Rod4 (PP535702), and 96.2–96.6% similarity to those of S. strixi, S. cf. strixi, and S. funereus (MF162316, MW349707, OQ557459, OR725602, OR726006, and PP350819). The third 28S rRNA sequence (PP938271) displayed 97.4–97.7% similarity to those of S. strixi and S. cf. strixi (MF162316 and OQ557459). Thus, the genetic comparison showed that the discussed sequences belong to two taxa, which were preliminary named Sarcocystis sp. Rod4 and Sarcocystis sp. Rod5 (Table 3). In summary, four different taxa, S. glareoli, and three not-yet-described genetically different species (Sarcocystis sp. Rod3, Sarcocystis sp. Rod4, and Sarcocystis sp. Rod5) were identified using primers designed for the diagnosis of Sarcocystis spp. using rodents as their IH.

3.4. Phylogeny of Sarcocystis spp. Identified in Common Buzzards Using Rodents as Their Intermediate Hosts

Based on partial 28S rRNA sequences, S. glareoli clustered with S. microti and S. jamaicensis with a high support (Figure 2). Buteo Hawks were proved to be DHs of these three Sarcocystis species [12,15,16,17,18,50,68]. However, the analysed fragment appeared to be too conservative for the disclosure of the phylogenetic relationships between the discussed Sarcocystis species. Other two species identified, Sarcocystis sp. Rod4 and Sarcocystis sp. Rod5, were most closely related to S. funereus, S. strixi, and Sarcocystis cf. strixi. Specifically, Sarcocystis sp. Rod5 clustered with S. strixi and Sarcocystis cf. strixi, while Sarcocystis sp. Rod4 was more closely related to S. funereus than to S. strixi and Sarcocystis cf. strixi. The literature data show that these species cycle between rodents and birds of prey [36,37,69,70,71]. Thus, the phylogenetic results confirm the identification of four different Sarcocystis species using rodents as their IH in the intestines of Common Buzzards.
In the phylogenetic tree based on partial ITS1 sequences, S. glareoli and Sarcocystis sp. Rod3 were grouped together, whereas S. jamaicensis was a sister species to this cluster (Figure 3). These three species using Buteo Hawks as their DH were more closely related to Sarcocystis spp. employing predatory mammals and birds as their IH and DH, respectively (e.g., S. arctica and S. lutrae), than to those employing birds as their hosts (e.g., S. calchasi and S. halieti).

3.5. The Prevalence of Sarcocystis spp. Identified in the Common Buzzard from Lithuania

The most frequently identified Sarcocystis species was S. glareoli, which was found in more than half of samples (53.3%). A relatively high detection rate was also recorded for S. halieti (36.7%) and S. wobeseri (23.3%). By contrast, other Sarcocystis species that were established were rarely found. Sarcocystis kutkienae, Sarcocystis sp. Rod3, and Sarcocystis sp. Rod4 were confirmed in two samples, while S. cornixi, S. turdusi, and Sarcocystis sp. Rod5 were diagnosed in a single sample.
By means of DNA analysis methods, at least one Sarcocystis species was identified in 73.3% of samples examined, as it was also confirmed by morphological examination (Figure 4a). The detection of more than one Sarcocystis species was determined in the half of samples; two different parasite species were observed in 40.0% of the samples, while three to five parasite species were established in 10.0% of the samples. The highest proportion, i.e., 40.0% of the samples, were positive for Sarcocystis spp. employing birds and rodents as their IH (Figure 4b). However, the identification of Sarcocystis spp. using rodents as their IH compared to parasite species using birds as their IH was more frequent. Only 10.0% of samples were positive for exclusively Sarcocystis spp. using birds as their IH, whereas in 23.3% of samples only Sarcocystis spp. using rodents as their IH were established. Thus, Sarcocystis spp. employing rodents and birds as their IH were identified in 66.7% and 50.0% of the samples, respectively. No more than four different species of Sarcocystis spp. forming sarcocysts in birds and no more than two species of Sarcocystis spp. forming sarcocysts in rodents were detected per sample.

4. Discussion

4.1. The Role of Common Buzzards in the Transmission of Sarcocystis spp. Using Rodents as Their IH

In the intestines of Common Buzzards, we have identified four different taxa, S. glareoli, and three potentially new Sarcocystis species (Sarcocystis sp. Rod3, Sarcocystis sp. Rod4, and Sarcocystis sp. Rod5), using rodents as their IH. Notably, the incidence of these Sarcocystis species was higher than those employing birds as their IH (Figure 4b). However, even 40.0% of Common Buzzards were positive for Sarcocystis species using birds and rodents as their IH. The obtained results can be explained by the dietary preferences of Common Buzzards. These birds are generalist carnivores, and their diet includes rodents, birds, reptiles, amphibians, large insects, and carrion [1,3,40,41,42,43]. Notably, the diet can be different in various regions and habitats as it is a very adaptable species. In Lithuania, the ration of Common Buzzards consists of up to 38.3% of small rodents, primarily voles, and up to 31.9% of small birds [6].
In the current study, S. microti was not detected in the intestinal scrapings of Common Buzzards. These findings may reflect the low prevalence of S. microti in rodents observed in Lithuania, where the infection rates were as low as 2.9% (1/35) in tundra voles (Alexandromys oeconomus) and 4.2% (1/24) in short-tailed voles (Microtus agrestis) [31]. Furthermore, the most recent study reported no positive results for S. microti detection in the muscles of 694 rodents and in the intestines of 10 Common Buzzards in Lithuania [12]. Low infection rates of S. microti were also reported in France. Cysts of the parasite were identified in short-tailed voles, common voles (Microtus arvalis), and bank voles, with the prevalence varying between 1.0% and 9.2% [27]. Likewise, in the Czech Republic, S. microti was found in common vole, bank vole, and Apodemus sp., with infection prevalence ranging from 0.6% to 5.0% among the tested species [33].
In the present study, S. glareoli was identified in 53.3% of Common Buzzards. This finding corresponds with the high prevalence of S. glareoli in the muscles of rodents. For example, bank voles consistently exhibit high infection rates with S. glareoli across various regions, indicating a robust host–parasite relationship. The prevalence of S. glareoli in bank voles was found to be 21.1% in Lithuania, 47.3% in France, and 55.9% in Germany [27,28,31]. We have for the first time obtained complete ITS1 sequences of S. glareoli. The newly designed primer pair GsSglajamF1/GsSglajamR1 targeting ITS1 turned out to be very beneficial in discriminating S. glareoli from the closely related S. jamaicensis [12,68,72].

4.2. The Role of Common Buzzards in the Transmission of Sarcocystis spp. Using Birds as Their IH

In the present study, for the first time, S. cornixi, S. halieti, S. kutkienae, S. turdusi, and S. wobeseri using birds as IHs were established in the intestinal samples of Common Buzzards. Corvids are known to be IHs of three Sarcocystis species (S. cornixi, S. halieti, and S. kutkienae) identified in the current study. According to current knowledge, S. cornixi and S. kutkienae form sarcocysts exclusively in the muscles of Corvidae birds [62,73,74], whereas S. turdusi forms sarcocysts in the muscles of small passeriform birds of the families Turdidae [75] and Muscicapidae (see KJ540167 GenBank record). Notably, S. halieti and S. wobeseri are multi-host adapted species, using birds of several different orders as their IH [46,49,74,76,77,78,79,80,81,82,83]. It is worth noting that Accipitridae birds were confirmed to serve as IHs of both these Sarcocystis species [11,48,49].
Based on DNA sequence analysis, Northern Goshawk (Accipiter gentilis) was shown to be a potential DH of the five discussed Sarcocystis species identified in this work, whereas S. halieti, S. turdusi, and S. wobeseri were confirmed in intestinal scrapings of Eurasian Sparrowhawks (Accipiter nisus) in Lithuania [11]. Furthermore, all these five Sarcocystis species (S. cornixi, S. halieti, S. kutkienae, S. turdusi, and S. wobeseri) were molecularly detected in the intestines of corvids collected in Lithuania [51]. In this study, of the analysed species, S. halieti and S. wobeseri were the most frequently identified in the Common Buzzard. IHs of S. halieti are birds of prey, small birds, terrestrial birds, and water birds, whereas water birds and birds of prey are known to serve as IHs of S. wobeseri [46,49,74,76,77,78,79,80,81,82,83]. Due to the lack of research on the diversity of Sarcocystis species in birds, it is assumed that the circle of IHs of S. wobeseri is wider [81,82,83]. Thus, the highest detection rates of S. halieti and S. wobeseri can be explained by their multi-host adaptivity.
In this work, S. calchasi, S. columbae, S. corvusi, and S. lari were not found in the intestine samples of Common Buzzards. In Lithuania, highly pathogenic S. calchasi was detected only in the intestinal scrapings of 1 out of 16 Northern Goshawks (6.3%), and the assumption was raised that this species is not widespread in Lithuania [11]. Sarcocystis corvusi is suspected to be extremely rare in the country [74]. Other species S. columbae have been found in the muscles of the Wood Pigeon (Columba palumbus) [84], Herring Gull (Larus argentatus) [77], Common Gull (Larus canus), and Black-Headed Gull (Larus ridibundus) [80]. Sarcocysts of S. lari were detected in the muscles of the Great Black-Backed Gull (Larus marinus) [59] and the Herring Gull [77]. In conclusion, the composition of identified Sarcocystis spp. using birds as IHs in the analysed samples is generally consistent with the diet of the Common Buzzard which favours small birds in its diet [1,3,6,40,41,42,43].

4.3. Common Buzzards as Definitive Hosts of Potentially New Sarcocystis Species

In our recent investigation, we have identified two potentially new Sarcocystis species in the intestinal mucosa scrapings of two tested Rough-Legged Buzzards (Buteo lagopus). These species were named Sarcocystis sp. Rod3 and Sarcocystis sp. Rod4 [12]. Based on 28S rRNA, Sarcocystis sp. Rod3 and Sarcocystis sp. Rod4 were shown to be most closely related with Sarcocystis spp. using rodents as their IH. The same two species were also detected in the present work. Thus, it could be assumed that Rough-Legged Buzzards and Common Buzzards can potentially spread the same Sarcocystis species. Such a finding is not surprising, as Sarcocystis species are usually more specific to their IH than to their DH [10].
Based on ITS1, Sarcocystis sp. Rod3 was clearly differentiated from S. jamaicensis and was most closely related to S. glareoli. At 518 bp long ITS1 fragment analysed, Sarcocystis sp. Rod3, and S. glareoli differed by eight SNPs, which represents 98.5% sequence similarity (Table 3 and Table S2). Such a genetic difference in highly variable ITS1 should be treated as relatively small [82]. However, no variability was observed when comparing four complete ITS1 sequences of S. glareoli isolated from the IH, the bank vole, and 16 partial ITS1 sequences of S. glareoli isolated from the DH, the Common Buzzard. Thus, to clarify whether Sarcocystis sp. Rod3 represents a separate species or a distant genetic lineage of S. glareoli, detailed morphological studies of this parasite in IHs are required. Furthermore, molecular examinations of small intestine samples of Red-Tailed Hawks (Buteo jamaicensis) and Red-Shouldered Hawks (Buteo lineatus) in the USA suggest the presence of at least one separate Sarcocystis species closely related to S. glareoli, S. jamaicensis, and S. microti [12,50].
In the current work on the intestinal mucosa of the single Common Buzzard, we identified Sarcocystis sp. Rod5 (Table S1). This potentially new Sarcocystis species was found for the first time. Sarcocystis sp. Rod5 as well as Sarcocystis sp. Rod4 phylogenetically clustered with S. funereus and S. strixi (Figure 2) using the Tengmalm’s Owl (Aegolius funereus) and the Barred Owl (Strix varia) as their experimentally confirmed DH. The molecular detection of Sarcocystis sp. Rod4 and Sarcocystis sp. Rod5 in the intestines of Common Buzzards reinforces our previously proposed assumption that some Sarcocystis spp. might be transmitted by representatives of Accipitriformes and Strigiformes [12]. It would therefore be beneficial to further test the intestines of strigiforms for the presence of certain Sarcocystis species using accipitriforms as their DH. To summarise, the applied molecular methods allowed us to detect several potentially new Sarcocystis species yet not described in IHs. However, cloning of PCR products amplified using primers specific to the whole Sarcocystis genus [57,85,86,87,88] can potentially identify yet-not-detected species.

5. Conclusions

Based on nested PCR of 28S rRNA and/or ITS1 sequences, we have identified nine Sarcocystis spp. in the small intestine mucosa of Common Buzzards from Lithuania. Five of these species, S. cornixi, S. halieti, S. kutkienae, S. turdusi, and S. wobeseri, using birds as their IH, were for the first time established in this bird of prey. In addition, S. glareoli forming cysts in the brains of rodents and three yet-undescribed species, Sarcocystis sp. Rod3, Sarcocystis sp. Rod4, and Sarcocystis sp. Rod5, on the basis of phylogenetic results employing rodents as their IH, were detected. The distribution of identified Sarcocystis species was in congruence with the diet of Common Buzzards.
Several taxa, such as S. glareoli, S. jamaicensis, S. microti, and Sarcocystis sp. Rod3, showed low interspecific variability within 28S rRNA. Therefore, in the current study, we suggested a primer pair GsSglajamF1/GsSglajamR1 targeting ITS1 for the clear molecular separation of S. glareoli and S. jamaicensis on the basis of the resulting DNA sequences. Thus, the ITS1 might be the appropriate locus for the distinguishment of closely related Sarcocystis species using rodents as their IH. Despite the fact that we have identified as many as three potentially new Sarcocystis species in this work, further refinement of the methods, for instance, using cloning of PCR products amplified using pan-specific primers, would allow better identification of mixed infections and elucidation of Sarcocystis species composition in the intestines of Common Buzzards or other birds of prey.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14162391/s1, Table S1: Genetic identification of Sarcocystis species producing cysts in muscles or brains of rodents, in intestines of Common Buzzard by 28S rRNA and ITS1 sequences; Table S2: Percentage genetic similarity of four Sarcocystis species identified in the current study, and characterized by suggested small rodents—birds life cycle, based on 28S rRNA and ITS1 sequences.

Author Contributions

Conceptualisation, E.J.-N. and P.P.; methodology, T.Š., E.J.-N. and P.P.; software, T.Š. and P.P.; validation, T.Š., D.B. and P.P.; formal analysis, T.Š., E.J.-N., S.Š. and P.P.; investigation, T.Š. and E.J.-N.; resources, S.Š., D.B. and P.P; data curation, T.Š., E.J.-N. and P.P.; writing—original draft preparation, T.Š., E.J.-N., S.Š. and P.P.; writing—review and editing, T.Š., E.J.-N., S.Š., D.B. and P.P.; visualization P.P.; supervision, D.B. and P.P.; project administration, P.P.; funding acquisition, P.P. All authors have read and agreed to the published version of the manuscript.

Funding

The research was funded by the Research Council of Lithuania (grant number S-MIP-23-4).

Institutional Review Board Statement

The research of current study was conducted under the approval guidelines of the Ethics Committee of Nature Research Centre (no. GGT-9). The samples were collected with the permission of the Ministry of Environment of the Republic of Lithuania (2021-03-31 nr. (26)-SR-89).

Informed Consent Statement

Not applicable.

Data Availability Statement

The 28S rRNA and ITS1 sequences of Sarcocystis species isolated form from intestinal mucosa scraping samples of the Common Buzzard from Lithuania are available in the GenBank database under accession numbers PP937483–PP937522 and PP938236–PP938271. Furthermore, the ITS1 region sequence of S. glareoli from the bank vole containing partial 18S rRNA, complete ITS1, and partial 5.8S rRNA was submitted to GenBank with accession number PP937189.

Acknowledgments

The authors are grateful to Donatas Šneideris for his valuable advice on molecular investigations.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Walls, S.; Kenward, R. The Common Buzzard; T&AD Poyser: London, UK, 2020. [Google Scholar]
  2. The IUCN Red List of Threatened Species 2022. Available online: https://www.iucnredlist.org/species/181049859/181050999 (accessed on 19 June 2024).
  3. Jusys, V.; Karalius, S.; Raudonikis, L. The Guide to Birds of Lithuania; Lithuanian Ornithological Society: Vilnius, Lithuania, 2020. (In Lithuanian) [Google Scholar]
  4. Kurlavičius, P. (Ed.) Lithuanian Breeding Bird Atlas; Lututė: Kaunas, Lithuania, 2006. [Google Scholar]
  5. Snow, D.; Perrins, C. The Birds of the Western Palearctic; Oxford University Press: Oxford, UK, 1998. [Google Scholar]
  6. Kontrimavičius, V.L.; Kazlauskas, R.; Logminas, V. Fauna of Lithuania: Birds; Mokslas: Vilnius, Lithuania, 1990. [Google Scholar]
  7. Hagemeijer, E.J.M.; Blair, M.J. (Eds.) The EBCC Atlas of European Breeding Birds: Their Distribution and Abundance; T & AD Poyser: London, UK, 1997. [Google Scholar]
  8. Drobelis, E. Birds of Prey in Lithuania. Acta Ornithol. Lithu. 1993, 7–8, 117–121. [Google Scholar]
  9. Mehlhorn, H.; Heydorn, A.O. The Sarcosporidia (Protozoa, Sporozoa): Life Cycle and Fine Structure. Adv. Parasitol. 1978, 16, 43–91. [Google Scholar] [CrossRef]
  10. Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
  11. Šukytė, T.; Butkauskas, D.; Juozaitytė-Ngugu, E.; Švažas, S.; Prakas, P. Molecular Confirmation of Accipiter Birds of Prey as Definitive Hosts of Numerous Sarcocystis Species, including Sarcocystis sp., Closely Related to Pathogenic S. calchasi. Pathogens 2023, 12, 752. [Google Scholar] [CrossRef] [PubMed]
  12. Prakas, P.; Jasiulionis, M.; Šukytė, T.; Juozaitytė-Ngugu, E.; Stirkė, V.; Balčiauskas, L.; Butkauskas, D. First Observations of Buzzards (Buteo) as Definitive Hosts of Sarcocystis Parasites Forming Cysts in the Brain Tissues of Rodents in Lithuania. Biology 2024, 13, 264. [Google Scholar] [CrossRef]
  13. Castro-Forero, P.S.; Bulla-Castañeda, M.D.; López Buitrago, A.H.; Díaz Anaya, M.A.; Madeira de Carvalho, M.L.; Pulido-Medellín, O.M. Sarcocystis spp., a Parasite with Zoonotic Potential. Bulg. J. Vet. Med. 2022, 25, 175–186. [Google Scholar] [CrossRef]
  14. Henry, D.P. Isopora buteonis sp. nov. from the Hawk and Owl, and Notes on Isopora lacazii (Labbé) in Birds. Univ. Calif. Publ. Zool. 1932, 37, 291–300. [Google Scholar]
  15. Krampitz, H.E.; Rommel, M.; Geisel, O.; Kaiser, E. Beiträge zum Lebenszyklus der Frenkelien II. Die ungeschlechtliche Entwicklung von Frenkelia clethrionomyobuteonis in der Rötelmaus. Z. Parasitenkd. 1976, 51, 7–14. [Google Scholar] [CrossRef] [PubMed]
  16. Rommel, M.; Krampitz, H.E. Weitere Untersuchungen über das Zwischenwirtsspektrum und de Entwicklungszklus von Frenkelia microti aus der Erdmaus. Zbl. Vet. Med. B 1978, 25, 273–281. [Google Scholar] [CrossRef]
  17. Lindsay, D.S.; Ambrus, S.I.; Blagburn, B.L. Frenkelia sp.-Like Infection in the Small Intestine of a Red-Tailed Hawk. J. Wildl. Dis. 1987, 23, 677–679. [Google Scholar] [CrossRef]
  18. Upton, S.J.; McKown, R.D. The Red-Tailed Hawk, Buteo jamaicensis, a Native Definitive Host of Frenkelia microti (Apicomplexa) in North America. J. Wildl. Dis. 1992, 28, 85–90. [Google Scholar] [CrossRef]
  19. Vorísek, P.; Votýpka, J.; Zvára, K.; Svobodová, M. Heteroxenous Coccidia Increase the Predation Risk of Parasitized Rodents. Parasitology 1998, 117, 521–524. [Google Scholar] [CrossRef] [PubMed]
  20. Mugridge, N.B.; Morrison, D.A.; Johnson, A.M.; Luton, K.; Dubey, J.P.; Votýpka, J.; Tenter, A.M. Phylogenetic Relationships of the Genus Frenkelia: A Review of its History and New Knowledge Gained from Comparison of Large Subunit Ribosomal Ribonucleic Acid Gene Sequences. Int. J. Parasitol. 1999, 29, 957–972. [Google Scholar] [CrossRef]
  21. Mugridge, N.B.; Morrison, D.A.; Jäkel, T.; Heckeroth, A.R.; Tenter, A.M.; Johnson, A.M. Effects of Sequence Alignment and Structural Domains of Ribosomal DNA on Phylogeny Reconstruction for the Protozoan Family Sarcocystidae. Mol. Biol. Evol. 2000, 17, 1842–1853. [Google Scholar] [CrossRef] [PubMed]
  22. Modrý, D.; Votýpka, J.; Svobodová, M. Note on the Taxonomy of Frenkelia microti (Findlay & Middleton, 1934) (Apicomplexa: Sarcocystidae). Syst. Parasitol. 2004, 58, 185–187. [Google Scholar] [CrossRef]
  23. Odening, K. The Present State of Species-Systematics in Sarcocystis Lankester, 1882 (Protista, Sporozoa, Coccidia). Syst. Parasitol. 1998, 41, 209–233. [Google Scholar] [CrossRef]
  24. Laakkonen, J.; Henttonen, H. Ultrastructure of Frenkelia sp. from a Norwegian Lemming in Finland. J. Wildl. Dis. 2000, 36, 362–366. [Google Scholar] [CrossRef]
  25. Karstad, L. Toxoplasma microti (The M-Organism) in the Muskrat (Ondatra zibethica). Can. Vet. J. 1963, 4, 249–251. [Google Scholar] [PubMed]
  26. Kennedy, M.J.; Frelier, P.F. Frenkelia sp. from the Brain of a Porcupine (Erethizon Dorsatum) from Alberta, Canada. J. Wildl. Dis. 1986, 22, 112–114. [Google Scholar] [CrossRef]
  27. Fichet-Calvet, E.; Kia, E.B.; Giraudoux, P.; Quéré, J.P.; Delattre, P.; Ashford, R.W. Frenkelia Parasites in a Small Mammal Community. Dynamics of Infection and Effect on the Host. Parasite 2004, 11, 301–310. [Google Scholar] [CrossRef]
  28. Krücken, J.; Blümke, J.; Maaz, D.; Demeler, J.; Ramünke, S.; Antolová, D.; Schaper, R.; Von Samson-Himmelstjerna, G. Small Rodents as Paratenic or Intermediate Hosts of Carnivore Parasites in Berlin, Germany. PLoS ONE 2017, 12, e0172829. [Google Scholar] [CrossRef]
  29. Grikienienė, J.; Mažeikytė, R. Investigation of Sarcosporidians (Sarcocystis) of Small Mammals in Kamasta Landscape Reserve and Its Surroundings. Acta Zool. Litu. 2000, 10, 55–68. [Google Scholar] [CrossRef]
  30. Grikienienė, J.; Malakauskas, M.; Mažeikytė, R.; Balčiauskas, L.; Senutaitė, J. Muscle Parasites (Sarcocystis, Trichinella, Alaria) of Wild Mammals in Lithuania. Theriol. Litu. 2001, 1, 29–46. [Google Scholar]
  31. Grikienienė, J.; Mažeikytė, R.; Balčiauskas, L. The First Data on Brain Parasites of the Genus Frenkelia (Protista: Coccidia) in Some Small Rodent Species in Lithuania. Acta Zool. Litu. 2003, 13, 21–27. [Google Scholar] [CrossRef]
  32. Grikienienė, J. Investigations into Endoparasites of Small Mammals in the Environs of Lake Drūkšiai. Acta Zool. Litu. 2005, 15, 109–114. [Google Scholar] [CrossRef]
  33. Svobodová, M.; Vorisek, P.; Votýpka, J.; Weidinger, K. Heteroxenous Coccidia (Apicomplexa: Sarcocystidae) in the Populations of Their Final and Intermediate Hosts: European Buzzard and Small Mammals. Acta Protozool. 2004, 43, 251–260. [Google Scholar]
  34. Deter, J.; Bryja, J.; Chaval, Y.; Galan, M.; Henttonen, H.; Laakkonen, J.; Voutilainen, L.; Vapalahti, O.; Vaheri, A.; Salvador, A.R.; et al. Association between the DQA MHC Class II Gene and Puumala Virus Infection in Myodes glareolus, the Bank Vole. Infect. Genet. Evol. 2008, 8, 450–458. [Google Scholar] [CrossRef]
  35. Waindok, P.; Özbakış-Beceriklisoy, G.; Janecek-Erfurth, E.; Springer, A.; Pfeffer, M.; Leschnik, M.; Strube, C. Parasites in Brains of Wild Rodents (Arvicolinae and Murinae) in the City of Leipzig, Germany. Int. J. Parasitol. Parasites Wildl. 2019, 10, 211–217. [Google Scholar] [CrossRef] [PubMed]
  36. Prakas, P.; Stirkė, V.; Šneideris, D.; Rakauskaitė, P.; Butkauskas, D.; Balčiauskas, L. Protozoan Parasites of Sarcocystis spp. in Rodents from Commercial Orchards. Animals 2023, 13, 2087. [Google Scholar] [CrossRef]
  37. Prakas, P.; Gudiškis, N.; Kitrytė, N.; Bagdonaitė, D.L.; Baltrūnaitė, L. Detection of Three Sarcocystis Species (Apicomplexa) in Blood Samples of the Bank Vole and Yellow-Necked Mouse from Lithuania. Life 2024, 14, 365. [Google Scholar] [CrossRef] [PubMed]
  38. Toyé, P.; Tappin, N. Frenkelia glareoli: A Record from Devon. Trans R. Soc. Trop. Med. Hyg. 1972, 66, 529. [Google Scholar]
  39. Fujita, O.; Oku, Y.; Ohbayashi, M. Frenkelia sp. from The Red-Backed Vole, Clethrionomys rufocanus bedfordiae, in Hokkaido, Japan. Jpn. J. Vet. Res. 1988, 36, 69–71. [Google Scholar] [PubMed]
  40. Reif, V.; Tornberg, R.; Jungell, S.; Korpimäki, E. Diet Variation of Common Buzzards in Finland Supports the Alternative Prey Hypothesis. Ecography 2001, 24, 267–274. [Google Scholar] [CrossRef]
  41. Selås, V. Predation on Reptiles and Birds by the Common Buzzard, Buteo buteo, in Relation to Changes in its Main Prey, Voles. Can. J. Zool. 2001, 79, 2086–2093. [Google Scholar] [CrossRef]
  42. Selås, V.; Tveiten, R.; Aanonsen, O. Diet of Common Buzzards (Buteo buteo) in Southern Norway Determined from Prey Remains and Video Recordings. Ornis Fennica 2007, 84, 97–104. [Google Scholar]
  43. Barauskas, R.; Karlonas, M. Birds of Lithuania. Breeding and Annually Occurring Species; Lututė: Kaunas, Lithuania, 2023. [Google Scholar]
  44. Olias, P.; Gruber, A.D.; Hafez, H.M.; Heydorn, A.O.; Mehlhorn, H.; Lierz, M. Sarcocystis calchasi sp. nov. of the Domestic Pigeon (Columba livia f. domestica) and the Northern Goshawk (Accipiter gentilis): Light and Electron Microscopical Characteristics. Parasitol. Res. 2010, 106, 577–585. [Google Scholar] [CrossRef]
  45. Wünschmann, A.; Rejmanek, D.; Conrad, P.A.; Hall, N.; Cruz-Martinez, L.; Vaughn, S.B.; Barr, B.C. Natural Fatal Sarcocystis falcatula Infections in Free-Ranging Eagles in North America. J. Vet. Diagn. Investig. 2010, 22, 282–289. [Google Scholar] [CrossRef]
  46. Maier-Sam, K.; Kaiponen, T.; Schmitz, A.; Schulze, C.; Bock, S.; Hlinak, A.; Olias, P. Encephalitis Associated with Sarcocystis halieti Infection in a Free-Ranging Little Owl (Athene noctua). J. Wildl. Dis. 2021, 57, 712–714. [Google Scholar] [CrossRef]
  47. Olias, P.; Olias, L.; Krücken, J.; Lierz, M.; Gruber, A.D. High Prevalence of Sarcocystis calchasi Sporocysts in European Accipiter Hawks. Vet. Parasitol. 2011, 175, 230–236. [Google Scholar] [CrossRef]
  48. Mayr, S.L.; Maier, K.; Müller, J.; Enderlein, D.; Gruber, A.D.; Lierz, M. Accipiter Hawks (Accipitridae) Confirmed as Definitive Hosts of Sarcocystis turdusi, Sarcocystis cornixi and Sarcocystis sp. ex Phalacrocorax carbo. Parasitol. Res. 2016, 115, 3041–3047. [Google Scholar] [CrossRef]
  49. Gjerde, B.; Vikøren, T.; Hamnes, I.S. Molecular identification of Sarcocystis halieti n. sp., Sarcocystis lari and Sarcocystis truncata in the intestine of a white-tailed sea eagle (Haliaeetus albicilla) in Norway. Int. J. Parasitol. Parasites Wildl. 2018, 7, 1–11. [Google Scholar] [CrossRef]
  50. Rogers, K.H.; Arranz-Solís, D.; Saeij, J.P.J.; Lewis, S.; Mete, A. Sarcocystis calchasi and Other Sarcocystidae Detected in Predatory Birds in California, USA. Int. J. Parasitol. Parasites Wildl. 2021, 17, 91–99. [Google Scholar] [CrossRef] [PubMed]
  51. Juozaitytė-Ngugu, E.; Švažas, S.; Šneideris, D.; Rudaitytė-Lukošienė, E.; Butkauskas, D.; Prakas, P. The Role of Birds of the Family Corvidae in Transmitting Sarcocystis Protozoan Parasites. Animals 2021, 11, 3258. [Google Scholar] [CrossRef]
  52. Prakas, P.; Rudaitytė-Lukošienė, E.; Šneideris, D.; Butkauskas, D. Invasive American Mink (Neovison vison) as Potential Definitive Host of Sarcocystis elongata, S. entzerothi, S. japonica, S. truncata and S. silva using Different Cervid Species as Intermediate Hosts. Parasitol. Res. 2021, 120, 2243–2250. [Google Scholar] [CrossRef]
  53. Šneideris, D.; Moskaliova, D.; Butkauskas, D.; Prakas, P. The Distribution of Sarcocsytis Species Described by Ungulates-Canids Life Cycle in Intestines of Small Predators of the Family Mustelidae. Acta Parasitol. 2024, 69, 747–758. [Google Scholar] [CrossRef]
  54. Duszynski, D.W.; Box, E.D. The Opossum (Didelphis virginiana) as a Host for Sarcocystis debonei from Cowbirds (Molothrus ater) and Grackles (Cassidix mexicanus, Quiscalus quiscula). J. Parasitol. 1978, 64, 326–329. [Google Scholar] [CrossRef]
  55. Singh, L.A.L.; Raisinghani, P.M.; Kumar, D.; Swarankar, C.P. Clinical and Haematobiochemical Changes in Dogs Experimentally Infected with Sarcocystis capracanis. Indian J. Anim. Sci. 1993, 63, 1055–1057. [Google Scholar]
  56. Porter, R.A.; Ginn, P.E.; Dame, J.B.; Greiner, E.C. Evaluation of the Shedding of Sarcocystis falcatula Sporocysts in Experimentally Infected Virginia Opossums (Didelphis virginiana). Vet. Parasitol. 2001, 95, 313–319. [Google Scholar] [CrossRef]
  57. Máca, O.; Gudiškis, N.; Butkauskas, D.; González-Solís, D.; Prakas, P. Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) as Potential Spreaders of Sarcocystis Species. Front. Vet. Sci. 2024, 11, 1392618. [Google Scholar] [CrossRef] [PubMed]
  58. Prakas, P.; Balčiauskas, L.; Juozaitytė-Ngugu, E.; Butkauskas, D. The Role of Mustelids in the Transmission of Sarcocystis spp. Using Cattle as Intermediate Hosts. Animals 2021, 11, 822. [Google Scholar] [CrossRef]
  59. Prakas, P.; Kutkienė, L.; Butkauskas, D.; Sruoga, A.; Žalakevičius, M. Description of Sarcocystis lari sp. n. (Apicomplexa: Sarcocystidae) from the Great Black-Backed Gull, Larus marinus (Charadriiformes: Laridae), on the Basis of Cyst Morphology and Molecular Data. Folia Parasitol. 2014, 61, 11–17. [Google Scholar] [CrossRef]
  60. Prakas, P.; Butkauskas, D.; Švažas, S.; Juozaitytė-Ngugu, E.; Stanevičius, V. Morphologic and Genetic Identification of Sarcocystis fulicae n. sp. (Apicomplexa: Sarcocystidae) from the Eurasian coot (Fulica atra). J. Wildl. Dis. 2018, 54, 765–771. [Google Scholar] [CrossRef]
  61. Prakas, P.; Butkauskas, D.; Švažas, S.; Stanevičius, V. Morphological and Genetic Characterisation of Sarcocystis halieti from the Great Cormorant (Phalacrocorax carbo). Parasitol. Res. 2018, 117, 3663–3667. [Google Scholar] [CrossRef]
  62. Prakas, P.; Butkauskas, D.; Juozaitytė-Ngugu, E. Molecular and Morphological Description of Sarcocystis kutkienae sp. nov. from the Common Raven (Corvus corax). Parasitol. Res. 2020, 119, 4205–4210. [Google Scholar] [CrossRef]
  63. Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep Inferred from the Mitochondrial Cytochrome C Oxidase Subunit I Gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef] [PubMed]
  64. Gjerde, B. Molecular Characterisation of Sarcocystis bovifelis, Sarcocystis bovini n. sp., Sarcocystis hirsuta and Sarcocystis cruzi from Cattle (Bos taurus) and Sarcocystis sinensis from Water Buffaloes (Bubalus bubalis). Parasitol. Res. 2016, 115, 1473–1492. [Google Scholar] [CrossRef]
  65. Prakas, P.; Oksanen, A.; Butkauskas, D.; Sruoga, A.; Kutkienė, L.; Švažas, S.; Isomursu, M.; Liaugaudaitė, S. Identification and Intraspecific Genetic Diversity of Sarcocystis rileyi from Ducks, Anas spp., in Lithuania and Finland. J. Parasitol. 2014, 100, 657–661. [Google Scholar] [CrossRef] [PubMed]
  66. Verma, S.K.; Lindsay, D.S.; Grigg, M.E.; Dubey, J.P. Isolation, Culture and Cryopreservation of Sarcocystis Species. Curr. Protoc. Microbiol. 2017, 45, 20D.1.1–20D.1.27. [Google Scholar] [CrossRef] [PubMed]
  67. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  68. Dubey, J.P.; Cerqueira-Cézar, C.K.; Murata, F.H.A.; Mowery, J.D.; Scott, D.; von Dohlen, A.R.; Lindsay, D.S. Confirmation of Sarcocystis jamaicensis Sarcocysts in IFN-γ Gene Knockout Mice Orally Inoculated with Sporocysts from a Red-Tailed Hawk (Buteo jamaicensis). J. Parasitol. 2019, 105, 143–145. [Google Scholar] [CrossRef]
  69. Verma, S.K.; Von Dohlen, A.R.; Mowery, J.D.; Scott, D.; Cerqueira-Cézar, C.K.; Rosenthal, B.M.; Dubey, J.P.; Lindsay, D.S. Sarcocystis strixi n. sp. from a Barred Owl (Strix varia) Definitive Host and Interferon Gamma Gene Knockout Mice as Experimental Intermediate Host. J. Parasitol. 2017, 103, 768–777. [Google Scholar] [CrossRef]
  70. Máca, O.; Kouba, M.; Korpimäki, E.; González-Solís, D. Molecular Identification of Sarcocystis sp. (Apicomplexa, Sarcocystidae) in Offspring of Tengmalm’s Owls, Aegolius funereus (Aves, Strigidae). Front. Vet. Sci. 2021, 8, 804096. [Google Scholar] [CrossRef]
  71. Máca, O.; Kouba, M.; Langrová, I.; Panská, L.; Korpimäki, E.; González-Solís, D. The Tengmalm’s owl Aegolius funereus (Aves, Strigidae) as the definitive host of Sarcocystis funereus sp. nov. (Apicomplexa). Front. Vet. Sci. 2024, 11, 1356549. [Google Scholar] [CrossRef]
  72. Verma, S.K.; Von Dohlen, A.R.; Mowery, J.D.; Scott, D.; Rosenthal, B.M.; Dubey, J.P.; Lindsay, D.S. Sarcocystis jamaicensis n. sp., from Red-Tailed Hawks (Buteo jamaicensis) Definitive Host and IFN-γ Gene Knockout Mice as Experimental Intermediate Host. J. Parasitol. 2017, 103, 555–564. [Google Scholar] [CrossRef] [PubMed]
  73. Kutkienė, L.; Prakas, P.; Sruoga, A.; Butkauskas, D. Sarcocystis in the Birds Family Corvidae with Description of Sarcocystis cornixi sp. nov. from the Hooded Crow (Corvus cornix). Parasitol. Res. 2009, 104, 329–336. [Google Scholar] [CrossRef]
  74. Juozaitytė-Ngugu, E.; Butkauskas, D.; Švažas, S.; Prakas, P. Investigations on Sarcocystis Species in the Leg Muscles of the Bird Family Corvidae in Lithuania. Parasitol. Res. 2022, 121, 703–711. [Google Scholar] [CrossRef]
  75. Kutkienė, L.; Prakas, P.; Butkauskas, D.; Sruoga, A. Description of Sarcocystis turdusi sp. nov. from the Common Blackbird (Turdus merula). Parasitology 2012, 139, 1438–1443. [Google Scholar] [CrossRef] [PubMed]
  76. Kutkienė, L.; Prakas, P.; Sruoga, A.; Butkauskas, D. The Mallard Duck (Anas platyrhynchos) as Intermediate Host for Sarcocystis wobeseri sp. nov. from the Barnacle Goose (Branta leucopsis). Parasitol. Res. 2010, 107, 879–888. [Google Scholar] [CrossRef]
  77. Prakas, P.; Butkauskas, D.; Juozaitytė-Ngugu, E. Molecular Identification of four Sarcocystis Species in the Herring Gull, Larus argentatus, from Lithuania. Parasites Vectors 2020, 13, 2. [Google Scholar] [CrossRef] [PubMed]
  78. Prakas, P.; Bea, A.; Juozaitytė-Ngugu, E.; Olano, I.; Villanúa, D.; Švažas, S.; Butkauskas, D. Molecular Identification of Sarcocystis halieti in the Muscles of two Species of Birds of Prey from Spain. Parasites Vectors 2021, 14, 414. [Google Scholar] [CrossRef]
  79. Shadbolt, T.; Pocknell, A.; Sainsbury, A.W.; Egerton-Read, S.; Blake, D.P. Molecular Identification of Sarcocystis wobeseri-like Parasites in a New Intermediate Host Species, the White-Tailed Sea Eagle (Haliaeetus albicilla). Parasitol. Res. 2021, 120, 1845–1850. [Google Scholar] [CrossRef]
  80. Máca, O.; González-Solís, D. Role of three Bird Species in the Life Cycle of two Sarcocystis spp. (Apicomplexa, Sarcocystidae) in the Czech Republic. Int. J. Parasitol. Parasites Wildl. 2022, 17, 133–137. [Google Scholar] [CrossRef] [PubMed]
  81. Sato, A.P.; da Silva, T.C.E.; de Pontes, T.P.; Sanches, A.W.D.; Prakas, P.; Locatelli-Dittrich, R. Molecular Characterization of Sarcocystis spp. in Seabirds from Southern Brazil. Parasitol. Int. 2022, 90, 102595. [Google Scholar] [CrossRef] [PubMed]
  82. Juozaitytė-Ngugu, E.; Prakas, P. The Richness of Sarcocystis Species in the Common Gull (Larus canus) and Black-Headed Gull (Larus ridibundus) from Lithuania. Parasitologia 2023, 3, 172–180. [Google Scholar] [CrossRef]
  83. Prakas, P.; Estruch, J.; Velarde, R.; Ilgūnas, M.; Šneideris, D.; Nicolás-Francisco, O.; Marco, I.; Calero-Bernal, R. First Report of Sarcocystis halieti (Apicomplexa) in Bearded Vulture (Gypaetus barbatus). Vet. Res. Commun. 2024, 48, 541–546. [Google Scholar] [CrossRef]
  84. Prakas, P.; Butkauskas, D.; Sruoga, A.; Švažas, S.; Kutkienė, L. Identification of Sarcocystis columbae in Wood Pigeons (Columba palumbus) in Lithuania. Vet. Zootech. 2011, 55, 33–39. [Google Scholar]
  85. Lau, Y.L.; Chang, P.Y.; Subramaniam, V.; Ng, Y.H.; Mahmud, R.; Ahmad, A.F.; Fong, M.Y. Genetic Assemblage of Sarcocystis spp. in Malaysian Snakes. Parasites Vectors 2013, 6, 257. [Google Scholar] [CrossRef] [PubMed]
  86. Moré, G.; Maksimov, A.; Conraths, F.J.; Schares, G. Molecular Identification of Sarcocystis spp. in Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) from Germany. Vet. Parasitol. 2016, 220, 9–14. [Google Scholar] [CrossRef]
  87. Lesniak, I.; Franz, M.; Heckmann, I.; Greenwood, A.D.; Hofer, H.; Krone, O. Surrogate Hosts: Hunting Dogs and Recolonizing Grey Wolves share their Endoparasites. Int. J. Parasitol. Parasites Wildl. 2017, 6, 278–286. [Google Scholar] [CrossRef]
  88. Basso, W.; Alvarez Rojas, C.A.; Buob, D.; Ruetten, M.; Deplazes, P. Sarcocystis Infection in Red Deer (Cervus elaphus) with Eosinophilic Myositis/Fasciitis in Switzerland and Involvement of Red Foxes (Vulpes vulpes) and Hunting Dogs in the Transmission. Int. J. Parasitol. Parasites Wildl. 2020, 13, 130–141. [Google Scholar] [CrossRef]
Figure 1. Sporocysts (a) and sporulated oocysts (b) of Sarcocystis spp. found in intestinal scrapings of Common Buzzards.
Figure 1. Sporocysts (a) and sporulated oocysts (b) of Sarcocystis spp. found in intestinal scrapings of Common Buzzards.
Animals 14 02391 g001
Figure 2. A phylogram of selected Sarcocystis species based on 28S rRNA displaying the phylogenetic placement of four identified species using rodents as their IH and Common Buzzards as their DH. The sequences obtained in our study are in boldface. The ML method and the Tamura 3 parameter + G nucleotide substitution model was used for the generation of the phylogenetic tree. The multiple alignment contained 20 taxa and 678 nucleotide positions including gaps. The phylogram was scaled according to branch length and rooted on Toxoplasma gondii. The dashed line does not reflect the actual evolutionary distance between taxa. The figures next to the branches show bootstrap values higher than 70. Sequences obtained in the present study are shown in boldface.
Figure 2. A phylogram of selected Sarcocystis species based on 28S rRNA displaying the phylogenetic placement of four identified species using rodents as their IH and Common Buzzards as their DH. The sequences obtained in our study are in boldface. The ML method and the Tamura 3 parameter + G nucleotide substitution model was used for the generation of the phylogenetic tree. The multiple alignment contained 20 taxa and 678 nucleotide positions including gaps. The phylogram was scaled according to branch length and rooted on Toxoplasma gondii. The dashed line does not reflect the actual evolutionary distance between taxa. The figures next to the branches show bootstrap values higher than 70. Sequences obtained in the present study are shown in boldface.
Animals 14 02391 g002
Figure 3. A phylogram of selected Sarcocystis species based on ITS1 showing the phylogenetic position of S. glareoli and Sarcocystis sp. Rod3 identified in intestines of Common Buzzards. The sequences obtained in our study are marked in bold. The ML method and the Tamura 3 parameter + G nucleotide substitution model was applied for the construction of the phylogenetic tree. The multiple alignment contained 17 taxa and 626 nucleotide positions including gaps. The phylogram was scaled according to branch length and rooted on S. falcatula. Bootstrap values higher than 70 are demonstrated next to the branches. Sequences obtained in the present study are shown in boldface.
Figure 3. A phylogram of selected Sarcocystis species based on ITS1 showing the phylogenetic position of S. glareoli and Sarcocystis sp. Rod3 identified in intestines of Common Buzzards. The sequences obtained in our study are marked in bold. The ML method and the Tamura 3 parameter + G nucleotide substitution model was applied for the construction of the phylogenetic tree. The multiple alignment contained 17 taxa and 626 nucleotide positions including gaps. The phylogram was scaled according to branch length and rooted on S. falcatula. Bootstrap values higher than 70 are demonstrated next to the branches. Sequences obtained in the present study are shown in boldface.
Animals 14 02391 g003
Figure 4. The percentage distribution of Sarcocystis spp. in the examined sample of Common Buzzards from Lithuania. (a) The distribution of the number of species identified in the sample. (b) The distribution of Sarcocystis spp. using birds and or rodents as their IH in the sample. IH = intermediate host.
Figure 4. The percentage distribution of Sarcocystis spp. in the examined sample of Common Buzzards from Lithuania. (a) The distribution of the number of species identified in the sample. (b) The distribution of Sarcocystis spp. using birds and or rodents as their IH in the sample. IH = intermediate host.
Animals 14 02391 g004
Table 1. List and characteristics of primers used for amplification of various Sarcocystis spp.
Table 1. List and characteristics of primers used for amplification of various Sarcocystis spp.
Primer NameOrientationPrimer Sequence (5′-3′)LocusLength (bp)Target
Species
Ref.
SU1FForwardGATTGAGTGTTCCGGTGAATTATTITS1 region *~1000Sarcocystis spp. [49]
5.8SR2ReverseAAGGTGCCATTTGCGTTCAGAA
GsScalF2ForwardCCTTTTGTAAGGTTGGGGACATAITS1584S. calchasi[11]
GsScalR2ReverseGCCTCCCTCCCTCTTTTTG
GsScolFForwardATATGTTCATCCTTTCGTAGCGTTGITS1579S. columbae[51]
GsScolRReverseGCCATCCCTTTTTCTAAGAGAAGTC
GsScornF2ForwardAGTTGTTGACGTTCGTGAGGTCITS1483S. cornixi[51]
GsScornR2ReverseACACACTACTCATTATCTCCTACTCCT
GsScovFForwardTATTCATTCTTTCGGTAGTGTTGAGITS1524S. corvusi[51]
GsScovRReverseTTACTCTTTTAACAGCTTCGCTGAG
GsSfulFForwardCAAAGATGAAGAAGGTATATACGTGAAITS1449S. fulicae[51]
GsSfulRReverseCTTTACTCTTGAAGAACGACGTTGA
GsShalFForwardGATAATTGACTTTACGCGCCATTACITS1644S. halieti[51]
GsShalR2ReverseCCATCCCTTTTTCTAAAGGAGGTC
GsSkutkF2ForwardACACACGGTCGAGTTGATATGACITS1625S. kutkienae[51]
GsSkutkR2ReverseTCTTTACCCTTAAACAATTTCGTTG
GsSlarFForwardTTCGTGAGGTTATTATCATTGTGCTITS1545S. lari[51]
GsSlarRReverseGGCGATAGAAATCAAAGCAGTAGTA
GsSturFForwardGATTTTTGATGTCCGTTGAAGTTATITS1561S. turdusi[51]
GsSturRReverseCATTCAAATATGCTCTCTTCCTTCT
GsSwobFForwardATGAACTGCTTTTTCTTCCATCTTTITS1532S. wobeseri[51]
GsSwobR2ReverseCTCCTCTTGAAGGTGGTCGTGT
GsSglajamF1ForwardTTTCGTAGCGCTGAGGAGATTITS1~560S. glareoli/S. jamaicensisPS
GsSglajamR1 ReverseTGCTTTTCTTCCTTTACTTTTGAATG PS
Sgrau281ForwardGCGGAGGAAAAGAAAATAACAAT28S rRNA~900Sarcocystis spp. from rodents[36]
Sgrau282ReverseCTATCGCTTAGGACCGGCTA
GsSglaF1ForwardGCAAAATGTGTGGTAAGTTTCACAT28S rRNA565S. glareoli[12]
GsSglaR1ReverseCCCTCTAAAAAGATGTTACCCTTCT
GsSmicF1ForwardTGTGGTAAGTTTCACATAAGGCTAA28S rRNA553S. microti[12]
GsSmicR1ReverseCTTTCTAAAAAGATGTACCTTCTCCT
SgraupaukF ForwardCGTATTTGCCCTGTGTCCTT28S rRNA~660Sarcocystis spp. from rodentsPS
SgraupaukR ReverseGTCGTAGGTGCAAAGCATAACATC PS
Ref.: reference; PS: present study; *: partial 18S rRNA, complete ITS1, and partial 5.8S rRNA.
Table 2. Genetic identification of avian Sarcocystis spp. in intestines of Common Buzzard based on ITS1.
Table 2. Genetic identification of avian Sarcocystis spp. in intestines of Common Buzzard based on ITS1.
SpeciesGenBank Accession NumbersIntraspecific Similarity (%) *Interspecific Similarity, Comparing
with Most Closely Related Species (%) *
S. cornixiPP93750198.6–100S. kutkienae 88.7–90.5
S. halietiPP937502–PP93751296.3–100S. columbae 91.1–92.5
S. kutkienaePP937513, PP93751499.0–100S. cornixi 88.4–89.1
S. turdusiPP93751598.4–100S. wobeseri 84.8–86.1
S. wobeseriPP937516–PP93752299.0–100S. calchasi 91.9–92.7
* All sequences available in GenBank are included in this comparison.
Table 3. Genetic identification of Sarcocystis spp. in intestines of Common Buzzard using rodents as their IHs.
Table 3. Genetic identification of Sarcocystis spp. in intestines of Common Buzzard using rodents as their IHs.
SpeciesGenetic
Region
Primer pairsGenBank Acc No.Percentage Intraspecific
Similarity (Number of Sequences Determined in the Present Study) *
Percentage Interspecific Similarity, Comparing
with Most Closely Related Species *
S. glareoli28S rRNAGsSglaF1/
GsSglaR1 and SgraupaukF/
SgraupaukR
PP938236– PP93826599.8–100 (30)S. jamaicensis 99.6–99.7
S. glareoliITS1GsSglaF1/
GsSglaR1
PP937483–P937498100 (16)S. sp. Rod3 98.5
S. sp. Rod328S rRNAGsSglaF1/
GsSglaR1 and SgraupaukF/
SgraupaukR
PP938266– PP938268100 (3)S. jamaicensis 99.8
S. sp. Rod3ITS1GsSglaF1/
GsSglaR1
PP937499– PP937500100 (2)S. glareoli 98.5
S. sp. Rod428S rRNASgraupaukF/
SgraupaukR
PP938269, PP938270100 (2)S. sp. Rod5 97.7
S. sp. Rod528S rRNASgraupaukF/
SgraupaukR
PP938271not applicable (1)S. cf. strixi and S. sp. Rod4 97.7
* All sequences available in GenBank are included in this comparison.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Šukytė, T.; Juozaitytė-Ngugu, E.; Švažas, S.; Butkauskas, D.; Prakas, P. The Genetic Identification of Numerous Apicomplexan Sarcocystis Species in Intestines of Common Buzzard (Buteo buteo). Animals 2024, 14, 2391. https://doi.org/10.3390/ani14162391

AMA Style

Šukytė T, Juozaitytė-Ngugu E, Švažas S, Butkauskas D, Prakas P. The Genetic Identification of Numerous Apicomplexan Sarcocystis Species in Intestines of Common Buzzard (Buteo buteo). Animals. 2024; 14(16):2391. https://doi.org/10.3390/ani14162391

Chicago/Turabian Style

Šukytė, Tautvilė, Evelina Juozaitytė-Ngugu, Saulius Švažas, Dalius Butkauskas, and Petras Prakas. 2024. "The Genetic Identification of Numerous Apicomplexan Sarcocystis Species in Intestines of Common Buzzard (Buteo buteo)" Animals 14, no. 16: 2391. https://doi.org/10.3390/ani14162391

APA Style

Šukytė, T., Juozaitytė-Ngugu, E., Švažas, S., Butkauskas, D., & Prakas, P. (2024). The Genetic Identification of Numerous Apicomplexan Sarcocystis Species in Intestines of Common Buzzard (Buteo buteo). Animals, 14(16), 2391. https://doi.org/10.3390/ani14162391

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop