The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Indigenous Bacteria of A. tropicus
2.2. Obtaining the Bacterial Biomass
2.3. Preparation of Experimental Diets
2.4. Viability of L. lactis PH3-05 in the Experimental Diets
2.5. Experimental Design
2.6. Evaluation of Growth and Survival Rate
2.7. Sample Collection
2.8. Enzyme Activities Quantification
2.9. Histological Analysis
2.10. RNA Extraction, Reverse Transcription, and Gene Expression Analysis
2.11. DNA Isolation from Gut Microbiota and Preparation of 16S rRNA Gene Libraries and Sequencing
2.12. Data Analysis and Statistics
3. Results
3.1. Growth Indexes and Survival Rates
3.2. Digestive Enzyme Activity
3.3. Histological Analysis
3.4. Gene Expression
3.5. Classification and Taxonomy of the Bacterial Taxonomic Profile
3.6. Bacterial Community Structure through Beta Diversity
3.7. Predicted Metabolic Functions of the Intestinal Microbiota from KEGG
4. Discussion
4.1. Growth Indexes and Survival Rate
4.2. Digestive Enzyme Activity
4.3. Histological Analysis
4.4. Gene Expression
4.5. Gut Microbiome
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO (Food and Agriculture Organization of the United Nations). The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020. [Google Scholar] [CrossRef]
- Reinoso, S.; Gutiérrez, M.S.; Domínguez-Borbor, C.; Argüello-Guevara, W.; Bohórquez-Cruz, M.; Sonnenholzner, S.; Nova-Baza, D.; Mardones, C.; Navarrete, P. Selection of Autochthonous Yeasts Isolated from the Intestinal Tracts of Cobia Fish (Rachycentron canadum) with Probiotic Potential. J. Fungi 2023, 9, 274. [Google Scholar] [CrossRef] [PubMed]
- Reda, R.M.; Selim, K.; El-Sayed, H.M.; El-Hady, M.A. In Vitro Selection and Identification of Potential Probiotics Isolated from the Gastrointestinal Tract of Nile Tilapia, Oreochromis niloticus. Probiotics Antimicrob. Proteins 2017, 10, 692–703. [Google Scholar] [CrossRef] [PubMed]
- Rohani, M.F.; Islam, S.M.; Hossain, M.K.; Ferdous, Z.; Siddik, A.; Nuruzzaman, M.; Padeniya, U.; Brown, C.L.; Shahjahan, M. Probiotics, prebiotics and synbiotics improved the functionality of aquafeed: Upgrading growth, reproduction, immunity and disease resistance in fish. Fish Shellfish Immunol. 2022, 120, 569–589. [Google Scholar] [CrossRef] [PubMed]
- Galdeano, C.M.; Cazorla, S.I.; Dumit, M.L.; Del Mar Vélez, M.; Perdigón, G. Beneficial Effects of Probiotic Consumption on the Immune System. Ann. Nutr. Metab. 2019, 74, 115–124. [Google Scholar] [CrossRef]
- Nayak, S. Probiotics and immunity: A fish perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef]
- Pérez-Sánchez, T.; Ruiz-Zarzuela, I.; De Blas, I.; Balcázar, J.L. Probiotics in aquaculture: A current assessment. Rev. Aquac. 2013, 6, 133–146. [Google Scholar] [CrossRef]
- Ringø, E.; Harikrishnan, R.; Soltani, M.; Ghosh, K. The effect of gut microbiota and probiotics on metabolism in fish and shrimp. Animals 2022, 12, 3016. [Google Scholar] [CrossRef]
- Valipour, A.; Nedaei, S.; Noori, A.; Khanipour, A.; Hoseinifar, S.H. Dietary Lactobacillus plantarum affected on some immune parameters, air-exposure stress response, intestinal microbiota, digestive enzyme activity and performance of narrow clawed crayfish (Astacus leptodactylus, Eschscholtz). Aquaculture 2019, 504, 121–130. [Google Scholar] [CrossRef]
- Yi, Y.; Zhen-Hua, Z.; Zhao, F.; Liu, H.; Yu, L.; Zha, J.; Wang, G. Probiotic potential of Bacillus velezensis JW: Antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish Shellfish Immunol. 2018, 78, 322–330. [Google Scholar] [CrossRef]
- Srirengaraj, V.; Razafindralambo, H.; Rabetafika, H.; Nguyen, H.T.; Sun, Y. Synbiotic Agents and Their Active Components for Sustainable Aquaculture: Concepts, Action Mechanisms, and Applications. Biology 2023, 12, 1498. [Google Scholar] [CrossRef]
- Bolotin, A.; Wincker, P.; Mauger, S.; Jaillon, O.; Malarme, K.; Weissenbach, J.; Ehrlich, S.D.; Sorokin, A. The Complete Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 2001, 11, 731–753. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Beck, B.R.; Hwang, S.; Song, S.K. Feeding olive flounder (Paralichthys olivaceus) with Lactococcus lactis BFE920 expressing the fusion antigen of Vibrio OmpK and FlaB provides protection against multiple Vibrio pathogens: A universal vaccine effect. Fish Shellfish Immunol. 2021, 114, 253–262. [Google Scholar] [CrossRef]
- Ray, A.K.; Ghosh, K.S.; Ringø, E. Enzyme-producing bacteria isolated from fish gut: A review. Aquac. Nutr. 2012, 18, 465–492. [Google Scholar] [CrossRef]
- Zhu, C.; Liu, D.; Chen, W.; Ban, S.; Liu, T.; Huang, W.; Jiang, M. Effects of dietary host-associated Lactococcus lactis on growth performance, disease resistance, intestinal morphology and intestinal microbiota of mandarin fish (Siniperca chuatsi). Aquaculture 2021, 540, 736702. [Google Scholar] [CrossRef]
- Goupil-Feuillerat, N.; Cocaign-Bousquet, M.; Godon, J.; Ehrlich, S.D.; Renault, P. Dual role of alpha-acetolactate decarboxylase in Lactococcus lactis subsp. lactis. J. Bacteriol. 1997, 179, 6285–6293. [Google Scholar] [CrossRef]
- Kaktcham, P.M.; Piame, L.T.; Sileu, M.S.; Kouam, M.F.; Temgoua, J.; Ngoufack, F.Z.; de Lourdes Pérez-Chabela, M. Bacteriocinogenic Lactococcus lactis subsp. lactis 3MT isolated from freshwater Nile Tilapia: Isolation, safety traits, bacteriocin characterisation, and application for biopreservation in fish pâté. Arch. Microbiol. 2019, 201, 1249–1258. [Google Scholar] [CrossRef] [PubMed]
- Sperandio, B.; Polard, P.; Ehrlich, D.; Renault, P.; Guédon, É. Sulfur Amino Acid Metabolism and Its Control in Lactococcus lactis IL1403. J. Bacteriol. 2005, 187, 3762–3778. [Google Scholar] [CrossRef] [PubMed]
- Linh, T.H.; Nagai, S.; Nagasaka, N.; Okane, S.; Taoka, Y. Effect of Lactococcus lactis K-C2 on the growth performance, amino acid content and gut microflora of amberjack Seriola dumerili. Fish. Sci. 2018, 84, 1051–1062. [Google Scholar] [CrossRef]
- Dawood, M.A.; Koshio, S.; Ishikawa, M.; Yokoyama, S.; Basuini, E.; Hossain, M.S.; Nhu, T.H.; Dossou, S.; Moss, A.S. Effects of dietary supplementation of Lactobacillus rhamnosus or/and Lactococcus lactis on the growth, gut microbiota and immune responses of red sea bream, Pagrus major. Fish Shellfish Immunol. 2016, 49, 275–285. [Google Scholar] [CrossRef]
- Feng, J.; Chang, X.; Zhang, Y.; Yan, X.; Zhang, J.; Nie, G. Effects of Lactococcus lactis from Cyprinus carpio L. as probiotics on growth performance, innate immune response and disease resistance against Aeromonas hydrophila. Fish Shellfish Immunol. 2019, 93, 73–81. [Google Scholar] [CrossRef]
- Sun, Y.; Yang, H.; Ma, R.; Zhai, S. Does Dietary Administration of Lactococcus lactis Modulate the Gut Microbiota of Grouper, Epinephelus coioides. J. World Aquac. Soc. 2012, 43, 198–207. [Google Scholar] [CrossRef]
- Beck, B.R.; Kim, D.; Jeon, J.; Lee, S.M.; Kim, H.K.; Kim, O.; Lee, J.I.; Suh, B.S.; Ki, H.; Lee, K.H.; et al. The effects of combined dietary probiotics Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 on innate immunity and disease resistance in olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2015, 42, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Márquez-Couturier, G.; Álvarez-González, C.A.; Contreras-Sánchez, W.M.; Hernández-Vidal, U.; Hernández-Franyutti, A.; Mendoza-Alfaro, R.; Goytortúa-Bores, E. Avances en la Alimentación y Nutrición del Pejelagarto Atractosteus tropicus; Avances En Nutrición Acuícola VIII; Universidad Autónoma de Nuevo León: Monterrey, Mexico, 2006; pp. 446–523. [Google Scholar]
- Nájera-Arzola, I.C.; Álvarez-González, C.A.; Frías-Quintana, C.A.; Peña, E.; Martínez-García, R.; Camarillo-Coop, S.; Méndez-Marín, O.; Gisbert, E. Evaluation of Mannan oligosaccharides (MOS) in balanced diets for tropical gar juveniles (Atractosteus tropicus). Hidrobiológica 2018, 28, 239–246. [Google Scholar] [CrossRef]
- Nieves-Rodríguez, K.N.; Álvarez-González, C.A.; Peña-Marín, E.S.; Vega-Villasante, F.; Martínez-García, R.; Camarillo-Coop, S.; Tovar-Ramírez, D.; Guzmán-Villanueva, L.T.; Andrée, K.B.; Gisbert, E. Effect of β-Glucans in Diets on Growth, Survival, Digestive Enzyme Activity, and Immune System and Intestinal Barrier Gene Expression for Tropical Gar (Atractosteus tropicus) Juveniles. Fishes 2018, 3, 27. [Google Scholar] [CrossRef]
- Sepúlveda-Quiroz, C.A.; Peña-Marín, E.S.; Pérez-Morales, A.; Martínez-García, R.; Álvarez Villagómez, C.S.; Maytorena-Verdugo, C.I.; Camarillo-Coop, S.; Vissio, P.G.; Sirkin, D.I.P.; Tovar-Ramírez, D.; et al. Fructooligosaccharide supplementation in diets for tropical gar (Atractosteus tropicus) juvenile: Effects on morphophysiology and intestinal barrier function. Aquac. Res. 2020, 52, 37–50. [Google Scholar] [CrossRef]
- Pérez-Jiménez, G.M.; Peña-Marín, E.S.; Maytorena-Verdugo, C.I.; Sepúlveda-Quiroz, C.A.; Jiménez-Martínez, L.D.; De la Rosa-García, S.; Asencio-Alcudia, G.G.; Martínez, R.; Tovar-Ramírez, D.; Galavíz, M.A.; et al. Incorporation of Fructooligosaccharides in Diets Influence Growth Performance, Digestive Enzyme Activity, and Expression of Intestinal Barrier Function Genes in Tropical Gar (Atractosteus tropicus) Larvae. Fishes 2022, 7, 137. [Google Scholar] [CrossRef]
- De la Cruz-Marín, E.; Martínez-García, R.; López-Hernández, J.F.; Méndez-Marín, O.; De la Rosa-García, S.; Peña-Marín, E.S.; Tovar-Ramírez, D.; Sepúlveda-Quiroz, C.A.; Pérez-Jiménez, G.M.; Jiménez-Martínez, L.D.; et al. Inulin Supplementation in Diets for Tropical Gar (Atractosteus tropicus) Larvae: Effects on Growth, Survival, and Digestive and Antioxidant Enzyme Activities. Aquac. J. 2023, 3, 43–55. [Google Scholar] [CrossRef]
- Cigarroa-Ruiz, L.; Toledo-Solís, F.J.; Frías-Gómez, S.A.; Guerrero-Zárate, R.; Camarillo-Coop, S.; Álvarez-Villagómez, C.S.; Peña-Marín, E.S.; Galavíz, M.A.; Martínez-García, R.; Álvarez-González, C.A. Addition of β-glucans in diets for tropical gar (Atractosteus tropicus) larvae: Effects on growth, digestive enzymes and gene expression of intestinal epithelial integrity and immune system. Fish Physiol. Biochem. 2023, 49, 613–626. [Google Scholar] [CrossRef]
- Hernández-López, I.A.; Tovar-Ramírez, D.; De la Rosa-García, S.; Álvarez-Villagómez, C.S.; Asencio-Alcudia, G.G.; Martínez-Burguete, T.; Galavíz, M.A.; Guerrero-Zárate, R.; Martínez-García, R.; Peña-Marín, E.S.; et al. Dietary live yeast (Debaryomyces hansenii) provides no advantages in tropical gar, Atractosteus tropicus (Actinopterygii: Lepisosteiformes: Lepisosteidae), juvenile aquaculture. Acta Ichthyol. Piscat. 2021, 51, 311–320. [Google Scholar] [CrossRef]
- Palma-Cancino, D.J.; Martínez-García, R.; Álvarez-González, C.A.; Camarillo-Coop, S.; Peña-Ma, E.S. Evaluation of feeding strategies in tropical gar (Atractosteus tropicus Gill) larvae: Growth, survival and cannibalism. Ecosistemas Recur. Agropecu. 2019, 6, 273–281. Available online: https://www.cabdirect.org/cabdirect/abstract/20203438791 (accessed on 27 January 2024). [CrossRef]
- Jiménez-Martínez, L.D.; Tovar-Ramírez, D.; Álvarez-González, C.A.; Peña-Marín, E.S.; Camarillo-Coop, S.; Martínez-García, R.; Elena, P.; Martínez-Yáñez, R.; Concha-Frías, B. Assessment of dietary lipid sources in tropical gar, Atractosteus tropicus larvae: Growth parameters and intermediary lipogenic gene expression. Aquac. Res. 2020, 51, 2629–2640. [Google Scholar] [CrossRef]
- Sepúlveda-Quiroz, C.A.; Pérez-Jiménez, G.M.; Asencio-Alcudia, G.G.; Mendoza-Porras, O.; Jiménez-Martínez, L.D.; Galaviz-Espinoza, M.A.; Tovar-Ramírez, D.; Martínez, R.; Álvarez-Villagómez, C.S.; Álvarez-González, C.A. Tryptophan Reduces Intracohort Cannibalism Behavior in Tropical Gar (Atractosteus tropicus) Larvae. Fishes 2024, 9, 40. [Google Scholar] [CrossRef]
- Méndez-Pérez, R.; García-López, R.; Bautista-López, J.S.B.; Vázquez-Castellanos, J.F.; Álvarez-González, C.A.; Peña-Marín, E.S.; Baltierra-Trejo, E.; Adams-Schroeder, R.; Domínguez-Rodríguez, V.I.; Melgar-Valdés, C.E.; et al. High-throughput sequencing of the 16S rRNA gene to analyze the gut microbiome in juvenile and adult tropical gar (Atractosteus tropicus). Lat. Am. J. Aquat. Res. 2020, 48, 456–479. [Google Scholar] [CrossRef]
- Hoben, H.J.; Somasegaran, P. Comparison of the pour, spread, and drop plate methods for enumeration of Rhizobium spp. In inoculants made from presterilized peatt. Appl. Environ. Microbiol. 1982, 44, 1246–1247. [Google Scholar] [CrossRef] [PubMed]
- Álvarez-González, C.A.; Civera-Cerecedo, R.; Galindo, J.L.O.; Dumas, S.; Moreno Legorreta, M.; Álamo, T.G. Effect of dietary protein level on growth and body composition of juvenile spotted sand bass, Paralabrax maculatofasciatus, fed practical diets. Aquaculture 2001, 194, 151–159. [Google Scholar] [CrossRef]
- AOAC (Association of Official Analytical Chemists). Official Methods of Analysis, 17th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2000. [Google Scholar]
- NOM-062-ZOO-1999. Norma Oficial Mexicana: Especificaciones Técnicas para la Producción, Cuidado y Uso de los Animales de Laboratorio. 2001. Available online: https://www.gob.mx/senasica/documentos/nom-062-zoo-1999 (accessed on 15 February 2024).
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Anson, M.L. The estimation of pepsin, trypsin, papain, and cathepsin with hemoglobin. J. Gen. Physiol. 1938, 22, 79–89. [Google Scholar] [CrossRef]
- Walter, H. Proteinases: Methods with hemoglobin, casein and azocoll as substrates. In Methods of Enzymatic Analysis; Verlag Chemie: Weinheim, Germany, 1984; pp. 270–277. [Google Scholar]
- Erlanger, B.F.; Kokowsky, N.; Cohen, W.W. The preparation and properties of two new chromogenic substrates of trypsin. Arch. Biochem. Biophys. 1961, 95, 271–278. [Google Scholar] [CrossRef]
- Del Mar, E.G.; Largman, C.; Brodrick, J.; Geokas, M.C. A sensitive new substrate for chymotrypsin. Anal. Biochem. 1979, 99, 316–320. [Google Scholar] [CrossRef]
- Versaw, W.K.; Cuppett, S.L.; Winters, D.; Williams, L.E. An Improved Colorimetric Assay for Bacterial Lipase in Nonfat Dry Milk. J. Food Sci. 1989, 54, 1557–1558. [Google Scholar] [CrossRef]
- Maroux, S.; Louvard, D.; Barath, J. The aminopeptidase from hog intestinal brush border. Biochim. Biophys. Acta–Enzymol. 1973, 321, 282–295. [Google Scholar] [CrossRef]
- Jiménez-Martínez, L.; Morales, V.; Frías-Quintana, C.; Castillo, A.; Ascencio-Alcudia, G.; Alvarez-Villagomez, C.; Peña-Marín, E.; Concha-Frías, B.; Alvarez-González, C.A. Quality Evaluation of Reference Gene Expression on Different Tissues in Adults of Tropical Gar Atractosteus tropicus. Pak. J. Zool. 2021, 54, 363–372. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Huse, S.M.; Dethlefsen, L.; Huber, J.A.; Welch, D.B.M.; Relman, D.A.; Sogin, M.L. Exploring Microbial Diversity and Taxonomy Using SSU rRNA Hypervariable Tag Sequencing. PLoS Genet. 2008, 4, e1000255. [Google Scholar] [CrossRef]
- Ibrahem, M.D. Evolution of probiotics in aquatic world: Potential effects, the current status in Egypt and recent prospectives. J. Adv. Res. 2015, 6, 765–791. [Google Scholar] [CrossRef]
- Xia, Y.; Lu, M.; Chen, G.; Cao, J.; Gao, F.; Wang, M.; Liu, Z.; Zhang, D.; Zhu, H.; Yi, M. Effects of dietary Lactobacillus rhamnosus JCM1136 and Lactococcus lactis subsp. lactis JCM5805 on the growth, intestinal microbiota, morphology, immune response and disease resistance of juvenile Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2018, 76, 368–379. [Google Scholar] [CrossRef] [PubMed]
- Heo, W.; Kim, Y.; Kim, E.Y.; Bai, S.C.; Kong, I. Effects of dietary probiotic, Lactococcus lactis subsp. lactis I2, supplementation on the growth and immune response of olive flounder (Paralichthys olivaceus). Aquaculture 2013, 376–379, 20–24. [Google Scholar] [CrossRef]
- Kong, Y.; Gao, C.X.; Zhao, J.; Li, M.; Shan, X.; Wang, G. Effects of single or conjoint administration of lactic acid bacteria as potential probiotics on growth, immune response and disease resistance of snakehead fish (Channa argus). Fish Shellfish Immunol. 2020, 102, 412–421. [Google Scholar] [CrossRef]
- Sun, Y.; He, M.; Cao, Z.; Xie, Z.; Liu, C.; Wang, S.; Guo, W.; Zhang, X.; Zhou, Y. Effects of dietary administration of Lactococcus lactis HNL12 on growth, innate immune response, and disease resistance of humpback grouper (Cromileptes altivelis). Fish Shellfish Immunol. 2018, 82, 296–303. [Google Scholar] [CrossRef]
- Li, X.; Ringø, E.; Hoseinifar, S.H.; Lauzon, H.L.; Birkbeck, H.; Yang, D. The adherence and colonization of microorganisms in fish gastrointestinal tract. Rev. Aquac. 2018, 11, 603–618. [Google Scholar] [CrossRef]
- Ringø, E.; Hoseinifar, S.H.; Ghosh, K.; Van Doan, H.; Beck, B.R.; Song, S.K. Lactic Acid Bacteria in Finfish—An Update. Front. Microbiol. 2018, 9, 1818. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Zheng, Y.; Gao, Y.; Wang, X. Dietary fiber intake and gut microbiota in human health. Microorganisms 2022, 10, 2507. [Google Scholar] [CrossRef]
- Sun, Y.; Yang, H.; Ma, R.; Song, K.; Li, J. Effect of Lactococcus lactis and Enterococcus faecium on growth performance, digestive enzymes and immune response of grouper Epinephelus coioides. Aquac. Nutr. 2011, 18, 281–289. [Google Scholar] [CrossRef]
- Yeganeh, S.; Adel, M.; Nosratimovafagh, A.; Dawood, M.A.O. The Effect of Lactococcus lactis subsp. lactis PTCC 1403 on the Growth Performance, Digestive Enzymes Activity, Antioxidative Status, Immune Response, and Disease Resistance of Rainbow Trout (Oncorhynchus mykiss). Probiotics Antimicrob. Proteins 2021, 13, 1723–1733. [Google Scholar] [CrossRef] [PubMed]
- LeBlanc, J.G.; Chain, F.; Martín, R.; Bermúdez-Humarán, L.G.; Courau, S.; Langella, P. Beneficial effects on host energy metabolism of short-chain fatty acids and vitamins produced by commensal and probiotic bacteria. Microb. Cell Fact. 2017, 16, 79. [Google Scholar] [CrossRef] [PubMed]
- Dawood, M.A.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
- Misra, S.; Pandey, P.; Mishra, H.N. Novel approaches for co-encapsulation of probiotic bacteria with bioactive compounds, their health benefits and functional food product development: A review. Trends Food Sci. Technol. 2021, 109, 340–351. [Google Scholar] [CrossRef]
- Assan, D.; Kuebutornye, F.K.A.; Hlordzi, V.; Chen, H.; Mraz, J.; Mustapha, U.F.; Abarike, E.D. Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: A mini review. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2022, 257, 110653. [Google Scholar] [CrossRef]
- Taoka, Y.; Maeda, H.; Jo, J.; Sakata, T. Influence of commercial probiotics on the digestive enzyme activities of tilapia, Oreochromis niloticus. Aquac. Sci. 2007, 55, 183–189. [Google Scholar] [CrossRef]
- Mirghaed, A.T.; Yarahmadi, P.; Hosseinifar, S.H.; Tahmasebi, D.; Gheisvandi, N.; Ghaedi, A. The effects singular or combined administration of fermentable fiber and probiotic on mucosal immune parameters, digestive enzyme activity, gut microbiota and growth performance of Caspian white fish (Rutilus frisii kutum) fingerlings. Fish Shellfish Immunol. 2018, 77, 194–199. [Google Scholar] [CrossRef]
- Wang, J.; Feng, J.; Liu, S.; Cai, Z.; Song, D.; Yang, L.; Nie, G. The probiotic properties of different preparations using Lactococcus lactis Z-2 on intestinal tract, blood and hepatopancreas in Cyprinus carpio. Aquaculture 2021, 543, 736911. [Google Scholar] [CrossRef]
- Won, S.; Hamidoghli, A.; Choi, W.; Park, Y.; Jang, W.J.; Kong, I.; Bai, S.C. Effects of Bacillus subtilis WB60 and Lactococcus lactis on Growth, Immune Responses, Histology and Gene Expression in Nile Tilapia, Oreochromis niloticus. Microorganisms 2020, 8, 67. [Google Scholar] [CrossRef] [PubMed]
- Moroni, F.; Naya-Català, F.; Piazzon, M.C.; Rimoldi, S.; Calduch-Giner, J.; Giardini, A.; Martínez, I.; Brambilla, F.; Pérez-Sánchez, J.; Terova, G. The Effects of Nisin-Producing Lactococcus lactis Strain Used as Probiotic on Gilthead Sea Bream (Sparus aurata) Growth, Gut Microbiota, and Transcriptional Response. Front. Mar. Sci. 2021, 8, 659519. [Google Scholar] [CrossRef]
- Kong, Y.; Kong, N.; Liu, H.; Han, M.; Peng, S.; Fang, Q.; Chen, X.; Wang, G.; Li, M. Molecular mechanism of homologous lactic acid bacteria regulating liver cell injury of snakehead fish. Aquac. Rep. 2024, 34, 101905. [Google Scholar] [CrossRef]
- Tanekhy, M.; Khalil, R.; Hofi, H.; Hashish, E. The Biochemical, Pathological and Immunological Effectiveness of Commercial Probiotics in Nile Tilapia, Oreochromis niloticus. Pak. J. Zool. 2016, 48, 1269–1282. [Google Scholar]
- Dighiesh, H.S.; Alharbi, N.A.; Awlya, O.F.; Alhassani, W.E.; Hassoubah, S.A.; Albaqami, N.M.; Aljahdali, N.; El-Aziz, Y.M.A.; Eissa, E.H.; Munir, M.B.; et al. Dietary multi-strains Bacillus spp. enhanced growth performance, blood metabolites, digestive tissues histology, gene expression of Oreochromis niloticus, and resistance to Aspergillus flavus infection. Aquac. Int. 2024, 1–22. [Google Scholar] [CrossRef]
- Ismail, M.; Wahdan, A.; Mohamed, S.Y.; Metwally, E.; Mabrok, M. Effect of dietary supplementation with a synbiotic (Lacto Forte) on growth performance, haematological and histological profiles, the innate immune response and resistance to bacterial disease in Oreochromis niloticus. Aquac. Res. 2019, 50, 2545–2562. [Google Scholar] [CrossRef]
- Abomughaid, M.M. Isolation and Identification of Some Probiotic Bacteria and Their Potential Role in Improving Immune Response and Resistance of Nile Tilapia (Oreochromis niloticus) in Comparison with a Commercial Product. Int. J. Microbiol. 2020, 865456, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Arsène, M.M.J.; Davares, A.K.L.; Andreevna, S.L.; Vladimirovich, E.A.; Carime, B.Z.; Marouf, R.; Khelifi, I. The use of probiotics in animal feeding for safe production and as potential alternatives to antibiotics. Vet. World 2021, 14, 319–328. [Google Scholar] [CrossRef]
- Merrifield, D.L.; Rodiles, A. The fish microbiome and its interactions with mucosal tissues. In Mucosal Health in Aquaculture; Elsevier eBooks; Academic Press: Cambridge, MA, USA, 2015; pp. 273–295. [Google Scholar] [CrossRef]
- Shephard, K.L. Mucus on the epidermis of fish and its influence on drug delivery. Adv. Drug Deliv. Rev. 1993, 11, 403–417. [Google Scholar] [CrossRef]
- Dash, S.; Das, S.; Samal, J.; Thatoi, H. Epidermal mucus, a major determinant in fish health: A review. Iran. J. Vet. Res. 2018, 19, 72–81. [Google Scholar] [PubMed] [PubMed Central]
- Lee, S.J.; Jeon, H.S.; Yoo, J.Y.; Kim, J.H. Some Important Metabolites Produced by Lactic Acid Bacteria Originated from Kimchi. Foods 2021, 10, 2148. [Google Scholar] [CrossRef] [PubMed]
- García-Hernández, V.; Quiros, M.; Nusrat, A. Intestinal epithelial claudins: Expression and regulation in homeostasis and inflammation. Ann. N. Y. Acad. Sci. 2017, 1397, 66–79. [Google Scholar] [CrossRef] [PubMed]
- Abbas, A.K.; Lichtman, A.H.; Pillai, S. Cellular and Molecular Immunology; Elsevier: São Paulo, Brazil, 2014. [Google Scholar]
- Beck, B.R.; Song, J.H.; Park, B.; Kim, D.; Kwak, J.-H.; Ki, H.; Ki Do, H.; Kim, A.; Kim, W.-J.; Song, S.K. Distinct immune tones are established by Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 in the gut of olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2017, 55, 434–443. [Google Scholar] [CrossRef] [PubMed]
- Servin, A.L. Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS Microbiol. Rev. 2004, 28, 405–440. [Google Scholar] [CrossRef]
- Gómez, G.D.; Balcázar, J.L. A review on the interactions between gut microbiota and innate immunity of fish. FEMS Immunol. Med. Microbiol. 2008, 52, 145–154. [Google Scholar] [CrossRef]
- Dong, Y.; Yang, Y.; Liu, J.; Awan, F.; Lu, C.; Liu, Y. Inhibition of Aeromonas hydrophila-induced intestinal inflammation and mucosal barrier function damage in crucian carp by oral administration of Lactococcus lactis. Fish Shellfish Immunol. 2018, 83, 359–367. [Google Scholar] [CrossRef]
- Wang, X.; Jiang, W.; Feng, L.; Wu, P.; Liu, Y.; Zeng, Y.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; et al. Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2018, 78, 202–221. [Google Scholar] [CrossRef]
- Wang, G.; Huang, S.; Wang, Y.; Cai, S.; Yu, H.; Liu, H.; Zeng, X.; Zhang, G.; Qiao, S. Bridging intestinal immunity and gut microbiota by metabolites. Cell. Mol. Life Sci. 2019, 76, 3917–3937. [Google Scholar] [CrossRef]
- Fang, G.; Rocha, E.; Danchin, A. How Essential Are Nonessential Genes? Mol. Biol. Evol. 2005, 22, 2147–2156. [Google Scholar] [CrossRef]
- Sylvain, F.; Derome, N. Vertically and horizontally transmitted microbial symbionts shape the gut microbiota ontogenesis of a skin-mucus feeding discus fish progeny. Sci. Rep. 2017, 7, 5263. [Google Scholar] [CrossRef]
- Sonnenburg, E.D.; Zheng, H.; Joglekar, P.; Higginbottom, S.K.; Firbank, S.J.; Bolam, D.N.; Sonnenburg, J.L. Specificity of Polysaccharide Use in Intestinal Bacteroides Species Determines Diet-Induced Microbiota Alterations. Cell 2010, 141, 1241–1252. [Google Scholar] [CrossRef] [PubMed]
- Ringø, E.; Zhou, Z.; Vecino, J.; Wadsworth, S.; Romero, J.; Krogdahl, Å.; Olsen, R.; Dimitroglou, A.; Foey, A.; Davies, S.; et al. Effect of dietary components on the gut microbiota of aquatic animals. A never-ending story? Aquac. Nutr. 2015, 22, 219–282. [Google Scholar] [CrossRef]
- Sourjik, V.; Wingreen, N.S. Responding to chemical gradients: Bacterial chemotaxis. Curr. Opin. Cell Biol. 2012, 24, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Aldridge, P.; Hughes, K.T. Regulation of flagellar assembly. Curr. Opin. Microbiol. 2002, 5, 160–165. [Google Scholar] [CrossRef]
- Yoshida, K.; Hashimoto, M.; Hori, R.; Adachi, T.; Okuyama, H.; Orikasa, Y.; Nagamine, T.; Shimizu, S.; Ueno, A.; Morita, N. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use. Mar. Drugs 2016, 14, 94. [Google Scholar] [CrossRef]
- Amorim-Franco, T.M.; Blanchard, J.S. Bacterial Branched-Chain Amino Acid Biosynthesis: Structures, Mechanisms, and Drugability. Biochemistry 2017, 56, 5849–5865. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information. PubChem Pathway Summary for Pathway SMP0012440, C5-Branched Dibasic Acid Metabolism, Source: PathBank. Available online: https://pubchem.ncbi.nlm.nih.gov/pathway/PathBank:SMP0012440 (accessed on 20 July 2024).
Ingredients (g kg diet−1) | Lactococcus lactis PH3-05 CFU/g | |||
---|---|---|---|---|
Control Diet | 104 | 106 | 108 | |
Fish meal a | 350 | 350 | 350 | 350 |
Pork meal a | 270.9 | 270.9 | 270.9 | 270.9 |
Poultry meal a | 150 | 150 | 150 | 150 |
Starch b | 100 | 100 | 100 | 100 |
Fish oil a | 36.5 | 36.5 | 36.5 | 36.5 |
Lactococcus lactis | 0 | 0.001 | 0.01 | 0.1 |
Wheat meal c | 37.6 | 36.6 | 37.59 | 37.6 |
Grenetin d | 20 | 20 | 20 | 20 |
Vit-min premix e | 15 | 15 | 15 | 15 |
Soy lecithin f | 15 | 15 | 15 | 15 |
Vitamin C g | 5 | 5 | 5 | 5 |
Chemical composition (g 100 g diet−1 Dry Matter) | ||||
Crude protein | 50.1 | 50.2 | 49.8 | 49.9 |
Crude lipid | 14.2 | 14.1 | 13.9 | 14.2 |
Fiber | 10.1 | 10.2 | 9.9 | 10.0 |
Ashes | 14.0 | 13.9 | 14.1 | 14.2 |
Humidity | 8.1 | 8.0 | 8.4 | 8.2 |
NFE | 11.6 | 11.6 | 12.3 | 11.7 |
Target Gene | Gene Function | Primer Sequence (5′-3′) | Amplification Efficiency (%) | Amplicon Size (bp) | Reference |
---|---|---|---|---|---|
muc-2 | mucus layer protein (mucin 2) | FW: GGCCTCCTCAAGAGCACGGTG RV: TCTGCACGCTGGAGCACTCAATG | 90.94 | 100 | [26] |
zo-2 | tight junction protein | FW: TACCCATGGAAAATGTGCCTCA RV: CGGGGTCTCTTCACGGTAA | 95.29 | 88 | [28] |
il-8 | pro-inflammatory cytokine | FW: ATATTCACTGGTGGGCGGAG RV: GTGCGGCCTGAGATTGTTT | 94.18 | 369 | [28] |
il-10 | anti-inflammatory cytokine | FW: TTATAAAGCCATGGGGGAGCTG RV: CTGCACAGTCTGCCTCTAGT | 94.47 | 91 | This study |
β-actin | cytoskeletal actin | FW: GAGCTATGAGCTGCCTGAGTGG RV: GTGGTCTCATGAATGCCACAGG | 97.10 | 119 | [47] |
Lactococcus lactis PH3-05 (CFU/g) | ||||
---|---|---|---|---|
Control Diet | 104 | 106 | 108 | |
Initial weight (g) | 0.002 ± 0.007 | 0.002 ± 0.007 | 0.002 ± 0.007 | 0.002 ± 0.007 |
Final weight (g) | 0.031 ± 0.002 b | 0.034 ± 0.0004 b | 0.040 ± 0.00 a | 0.041 ± 0.00 a |
Initial length (cm) | 1.8 ± 0.18 | 1.8 ± 0.18 | 1.8 ± 0.18 | 1.8 ± 0.18 |
Final length (cm) | 2.09 ± 0.05 b | 2.13 ± 0.12 a | 2.18 ± 0.09 a | 2.38 ± 0.09 a |
SGR (% d−1) | 1.53 ± 0.07 b | 1.64 ± 0.07 b | 2.75 ± 0.15 a | 2.83 ± 0.003 a |
WG (%) | 25.75 ± 1.35 b | 27.74 ± 1.46 b | 50.33 ± 3.50 a | 52.14 ± 0.06 a |
S (%) | 31.11 ± 1.92 b | 33.75 ± 1.82 b | 46.36 ± 4.34 a | 32.56 ± 6.72 b |
Activities (U mg protein−1) | Lactococcus lactis PH3-05 (CFU/g) | |||
---|---|---|---|---|
Control Diet | 104 | 106 | 108 | |
Acid protease | 490.79 ± 36.69 b | 490.27 ± 76.22 b | 716.99 ± 5.57 a | 235.30 ± 66.15 c |
Alkaline protease | 41.14 ± 4.68 b | 44.45 ± 0.02 b | 55.45 ± 1.82 a | 37.46 ± 11.82 b |
Trypsin | 0.12 ± 0.02 b | 0.22 ± 0.10 ab | 0.28 ± 0.05 ab | 0.35 ± 0.07 a |
Chymotrypsin | 79.57 ± 2.70 ab | 87.45 ± 2.86 a | 89.06 ± 0.78 a | 65.86 ± 10.60 b |
Lipase | 17.52 ± 0.21 b | 27.17 ± 1.21 b | 37.75 ± 0.3 a | 15.79 ± 8.64 b |
Leucine aminopeptidase | 60. 21 ± 11.18 b | 83.66 ± 1.96 a | 81. 21 ± 3.58 ab | 71.72 ± 11.01 ab |
Morphological Analysis | Lactococcus lactis PH3-05 (CFU/g) | |||
---|---|---|---|---|
Control Diet | 104 | 106 | 108 | |
Area MMC (%/Area) | 1.01 ± 0.43 b | 1.45 ± 0.14 ab | 1.91 ± 0.48 a | 1.94 ± 0.31 a |
Hepatocyte area (µm2) | 5.48 ± 0.84 b | 5.72 ± 0.81 ab | 5.37 ± 0.66 b | 7.36 ± 0.25 a |
Enterocyte height (µm) | 10.40 ± 0.40 d | 12.61 ± 0.22 c | 17.88 ± 0.40 a | 14.23 ± 0.33 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Jiménez, G.M.; Alvarez-Villagomez, C.S.; Martínez-Porchas, M.; Garibay-Valdez, E.; Sepúlveda-Quiroz, C.A.; Méndez-Marín, O.; Martínez-García, R.; Jesús-Contreras, R.; Alvarez-González, C.A.; De la Rosa-García, S.d.C. The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae. Animals 2024, 14, 2663. https://doi.org/10.3390/ani14182663
Pérez-Jiménez GM, Alvarez-Villagomez CS, Martínez-Porchas M, Garibay-Valdez E, Sepúlveda-Quiroz CA, Méndez-Marín O, Martínez-García R, Jesús-Contreras R, Alvarez-González CA, De la Rosa-García SdC. The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae. Animals. 2024; 14(18):2663. https://doi.org/10.3390/ani14182663
Chicago/Turabian StylePérez-Jiménez, Graciela María, Carina Shianya Alvarez-Villagomez, Marcel Martínez-Porchas, Estefanía Garibay-Valdez, César Antonio Sepúlveda-Quiroz, Otilio Méndez-Marín, Rafael Martínez-García, Ronald Jesús-Contreras, Carlos Alfonso Alvarez-González, and Susana del Carmen De la Rosa-García. 2024. "The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae" Animals 14, no. 18: 2663. https://doi.org/10.3390/ani14182663
APA StylePérez-Jiménez, G. M., Alvarez-Villagomez, C. S., Martínez-Porchas, M., Garibay-Valdez, E., Sepúlveda-Quiroz, C. A., Méndez-Marín, O., Martínez-García, R., Jesús-Contreras, R., Alvarez-González, C. A., & De la Rosa-García, S. d. C. (2024). The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae. Animals, 14(18), 2663. https://doi.org/10.3390/ani14182663