Next Article in Journal
Epidemiology, Transmission Mode, and Pathogenesis of Chlamydia pecorum Infection in Koalas (Phascolarctos cinereus): An Overview
Previous Article in Journal
Influence of 17α-Methyltestosterone on Morphological Deformities and Pigmentation Development in Juvenile Japanese Eels, Anguilla japonica
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 18
10.3390/ani14182685
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers

by
Shravani Veluri
1,*,
Mike R. Bedford
2,
Gemma Gonzalez-Ortiz
2 and
Oluyinka Abiona Olukosi
1
1
Department of Poultry Science, University of Georgia, Athens, GA 30602, USA
2
AB Vista, Marlborough, Wiltshire SN8 4AN, UK
*
Author to whom correspondence should be addressed.
Animals 2024, 14(18), 2685; https://doi.org/10.3390/ani14182685
Submission received: 12 August 2024 / Revised: 5 September 2024 / Accepted: 11 September 2024 / Published: 15 September 2024
(This article belongs to the Section Animal Nutrition)
Versions Notes

Abstract

:

Simple Summary

Wheat bran inclusion beneficially affects the gut health of broilers at low inclusion levels, along with the supplementation of feed additives such as with a stimbiotic It was hypothesized that the coarse or fine particle size of the wheat bran has a significant influence and interaction with stimbiotic on the performance of, and gut-health beneficial effects, in broilers. Coarse- or fine-wheat-bran inclusion or stimbiotic inclusion increased the feed intake and FCR for younger broilers; however, fine wheat bran and stimbiotic inclusion increased the overall weight gain of broilers without influencing their feed intake and FCR. Fine-wheat-bran inclusion increased the jejunum villi height and ileal nutrient digestibility compared to coarse wheat bran or diets without wheat bran in broilers at day 18. Stimbiotic supplementation increased ileal nutrient digestibility at day 42. The particle size of the wheat bran or stimbiotic supplementation had no effects on the cecal total short-chain fatty acid concentration; however, stimbiotic supplementation or wheat bran inclusion tended to decrease the branched-chain fatty acid concentration. Stimbiotic supplementation and inclusion of wheat bran with a reduced particle size into broiler diets have beneficial effects on the overall performance and ileal nutrient digestibility.

Abstract

A 42-day study was conducted with 720-day-old Cobb male broiler chicks allocated to treatments in a 3 × 2 factorial, with the factors as wheat bran (WB) inclusion (no WB, 50 g/kg coarse WB, or 50 g/kg fine WB) and stimbiotic (STB) supplementation in corn-based diets. The inclusion of WB (p < 0.05) or STB supplementation (p < 0.05) increased the FCR and feed intake in the day 0–10 phase. During the day 0–28 phase, coarse-WB inclusion increased (p < 0.05) the FCR, compared to fine WB or diets without WB. In the day 0–42 phase, WB marginally decreased weight gain in diets without STB supplementation, but the STB-supplemented diet, weight gain was greater (p < 0.05) the diet with fine WB compared with diets with coarse WB. Fine-WB inclusion increased the ileal nitrogen and energy digestibility determined at day 18 compared to coarse WB or diets without WB. Supplementation with STB (p < 0.05) or fine WB (p < 0.05) inclusion increased the villi height compared to diets without STB supplementation or coarse WB, or the diet without WB. Coarse or fine WB decreased (p < 0.05) cecal branched-chain fatty acids compared to diets without WB. In conclusion, stimbiotic supplementation to fine WB improved the performance and nutrient digestibility of broilers compared to coarse WB with no effects on the caeca total SCFA concentration.

1. Introduction

Supplementing broiler diets with xylanase and xylooligosaccharides (XOS) yields positive effects through a stimbiotic mechanism, a term recently introduced to describe feed additives that enhance the activity of fiber-fermenting microbiota in the ceca without significantly contributing to cecal short-chain fatty acid (SCFA) production [1]. Xylanase and XOS, integral components of stimbiotics, work synergistically: xylanase breaks down soluble arabinoxylan in the feed into insoluble arabinoxylo-oligosaccharides for fermentation in the ceca, promoting the development of a fiber-fermenting microbiome. The fiber fermentation capacity of young broiler chickens is naturally limited due to a deficiency in enzymes required for fiber hydrolysis [2]. Adding extra XOS stimulates the fiber-fermenting microbiome in the ceca, fostering the establishment of a microbiome with enhanced fiber-fermenting capabilities. This microbiome accelerates the fermentation of the soluble arabinoxylans, the amount of which is increased through xylanase use. The prebiotic nature of XOS is well documented, and selectively utilized by lactate and butyrate-producing bacteria, with lactate serving as a cross-feeding substrate for butyrate-producing bacteria [3]. An increase in fiber fermentation increases the production of SCFAs and bacterial xylanase and cellulases, which can further act on dietary fiber in the digesta. Consequently, arabinoxylo-oligosaccharides released from arabinoxylan by xylanase can be utilized by the established fiber-fermenting microbes to produce SCFA as fermentation end-products. This increase in oligosaccharide and SCFA production offers multiple benefits, including the maintenance of gut integrity and immunity, and promoting overall gut health.
Corn-based diets have lower arabinoxylan and fiber contents for xylanase to act on and increase fiber fermentation. The inclusion of additional fiber sources like wheat bran increases the substrates for stimbiotics to act on. Wheat bran is a source of insoluble dietary fiber and is rich in arabinoxylans. The arabinoxylan content of wheat bran is estimated to be around 23.2% [4]. Wheat bran, when included at appropriate levels in broiler diets, promotes gizzard development and the secretion of endogenous enzymes [5]. This altogether increases the nutrient digestibility and performance of broilers [6]. Other beneficial effects of wheat bran include immune modulatory effects and anti-oxidative capacity, which comes from the free-radical-scavenging activity of the phenolic compounds present, tocopherol and carotenoid [7,8]. Wheat bran, when included along with stimbiotic supplementation into corn-based diets, was hypothesized to improve the performance of broilers through an increase in the fermentation capacity of the ceca.
Wheat bran particle size has also been shown to influence the fermentation capacity in the ceca of broilers [9]. A coarse particle size of the wheat bran was shown to stimulate gizzard development and increase the digestibility of nutrients by stimulating the release of cholecystokinin, which increases the release of digestive enzymes. A fine particle size of the wheat bran has a higher fermentation capacity in the ceca because its reduced particle size allows it to enter the ceca easily to undergo fermentation [9]. Reduced- or fine-particle-size wheat bran also has a higher antioxidant capacity compared to the coarse size [10] and also increases the surface area for xylanase or exogenous enzymes to act on [11]. The hypothesis of this experiment is that the fine particle size of the wheat bran increases the fermentation capacity in the ceca compared to a coarse particle size when supplemented with stimbiotics in corn-based diets. An increase in fermentation capacity leads to an increase in the total SCFA content, whose beneficial effects include improvements in the performance of broiler chickens through an increase in nutrient digestibility and jejunum histomorphology. The objective of the current study was to determine and compare the effects of coarse- or fine-wheat-bran inclusion with or without stimbiotic supplementation into broiler diets on growth performance, ileal nutrient digestibility and oligosaccharide concentration, jejunum morphometrics, and cecal SCFA concentration.

2. Materials and Methods

2.1. Experimental Design

The study was approved by the Institutional Animal Care and Use Committee at the University of Georgia (Athens, GA, USA; IACUC number: A2021-06-006). The 720 zero-day-old male broiler chicks (male by-products of the female line) from a commercial breeder were allocated to 48 floor pens with 15 birds/pen. There were 6 treatments arranged in a 3 × 2 factorial arrangement with 8 replicates/ treatment. Factors included wheat bran inclusion (0 or 50 g/kg coarse, or 50 g/kg fine wheat bran) and stimbiotic supplementation (Signis, β-1,4-endo-xylanase, and xylo-oligosaccharides, AB Vista, Marlborough, UK) inclusion (0 or 100 g/ton of feed). The study lasted for 42 days, and diets were fed in three phases as starter (days 0 to 10), grower (days 10 to 28), and finisher (days 28 to 42) phases. The diet formulas are presented in Table 1, Table 2 and Table 3, respectively.
Titanium dioxide was added at 0.3% into the diets only in the grower and finisher phases for nutrient digestibility purposes. Ad libitum access to feed and water was given to the birds, and temperature and lighting schedules were followed according to the Cobb Broilers management guide (2021) [12] Phytase and xylanase activity (in the stimbiotic supplementation) in the diet samples were determined using ELISA (AB Vista, Plantation, FL, USA) and are presented in Table 4.
Body weight and feed intake data were collected on day 10, day 28, and day 42 to determine weight gain, feed intake, and the mortality-corrected FCR. On day 18 and day 42, gizzard, jejunum, ileum, and cecal contents were collected and placed on dry ice, and later transferred to a freezer at –20 °C pending further analysis. The mid-section of the jejunum tissue was collected and part of it was placed in 10% neutral buffered formalin for histomorphology purposes, and another was snap frozen in liquid nitrogen for mRNA expression analysis and later transferred to a freezer at –80 °C for storage.

2.2. Particle Size Analysis of Wheat Bran

The particle size analysis of WB was carried out in the Poultry Science Department at the North Carolina State University and the procedure followed was according to the protocol described in [13] using a 15-sieve stack and a Ro-Tap shaker (Model RX-29 W. S. Tyler’s Ro-Tap®, Mentor, OH). Calculations of geometric mean particle size and the geometric standard deviation of particle diameter by mass were carried out using the ASABE method S319.4 [14]. The geometric mean diameters (GMDs) of the coarse and fine WB used for this study were 1044 µm and 460 µm, respectively.

2.3. Chemical Analyses

2.3.1. Digestibility

Ileal digesta samples were freeze-dried using (Labconco Freeze Dryer: Console Freeze Dryer, Model: 710621115) and then ground using a 0.5 mm sieve (Retsch ZM 200, Retsch GmbH and Co., KG, Germany). To determine the dry matter, 1 g of the diets and 0.6 g of the digesta were dried in a drying oven at 100 °C for 24 h (VWR International Radnor, PA) and the weight difference was noted to determine the dry matter content of the sample using the AOAC method (Method 934.01). The concentration of the external indicator TiO2 was determined following the method of Short et al. [15] with modifications as described by Veluri and Olukosi [16]. The gross energy of the diets and digesta in 1 g of a sample was determined using an isoperibol bomb calorimeter (Model 6200, Parr Instruments, Moline, IL, USA) using benzoic acid as a calibration standard, and each sample was run in duplicate. The nitrogen contents of the samples were determined using a LECO FP 828-MC nitrogen analyzer (Method 968.06).
Ileal nutrient digestibility calculations:
DMD   ( % ) = D M d i e t − D M i l e a l   d i g e s t a × C d i e t C i l e a l   d i g e s t × 100
IDE   ( MJ / kg ) = G E d i e t − G E i l e a l   d i g e s t a × C d i e t C i l e a l   d i g e s t
IND   ( % ) = N d i e t − N i l e a l   d i g e s t a × C d i e t C i l e a l   d i g e s t × 100
where
DMD = dry matter digestibility
DMdiet = dry matter content in the diet
DMileal digesta = dry matter content in the ileal digesta
Cdiet = TiO2 content in the diet
Cileal digesta = TiO2 content in the ileal digesta
IDE = ileal digestible energy
GEdiet = gross energy content in the diet
Gileal digesta = gross energy content in the ileal digesta
IND = ileal nitrogen digestibility
Ndiet = nitrogen content in the diet
Nileal digesta = nitrogen content in the ileal digesta

2.3.2. The pH of Gizzard, Jejunum, and Cecal Contents

Gizzard, jejunum, and cecal contents were thawed after removing from the freezer at −20 °C to determine the pH. Samples were weighed out and diluted with water in a 1:9 ratio and later stirred with a magnetic stirrer for 5 min for uniform distribution. Then, a pH probe was placed into the solution and the reading was determined with a digital analog pH meter (Thermofisher Scientific, Waltham, MA, USA).

2.3.3. Jejunum Histomorphology

Jejunum tissue samples preserved in 10% neutral buffered formalin underwent dehydration using varying alcohol concentrations of 70%, 80%, and 95%. Subsequently, alcohol-cleared samples were embedded in paraffin wax, and the subsequent procedures were carried out following the protocol outlined by Olukosi [17]. Thinly sliced wax blocks were then transferred into a hot water bath and then into the slide. All the slides were stained with hematoxylin and eosin and viewed under a light microscope with 4X magnification (BZ-X800, Keyence Inc., Itasca, IL), and images were captured with a Leica DC500 camera. Using NIH Image J software, a minimum of five random measurements for villi height (VH), crypt depth, and villi width (VW) were taken for each sample.

2.3.4. Real-Time PCR Analysis

For mRNA expression analysis, RNA was extracted from the jejunum tissue using a QIAzol lysis reagent. Approximately 0.1 g of the jejunum tissue samples were homogenized in QIAzol lysis reagent using a bead beater. After homogenization, 200 µL of chloroform was added and centrifuged at 12,000× g for 15 min. The top layer with nucleic acids was transferred to another tube, and to this, one volume of isopropanol was added and placed on ice for 10 min and centrifuged again at 12,000× g for 10 min to obtain the RNA pellet at the bottom of the tube. Later, the RNA pellet was washed with ethanol two to three times, and then, the RNA pellet was dissolved in 50–100 μL of nuclease-free water. Using a Nanodrop 2000 spectrophotometer, the quantity and quality of the RNA were determined. Reverse transcription of the RNA into cDNA was performed using a high-capacity cDNA reverse-transcription kit (Applied Biosystems, Life Technologies, Carlsbad, CA, USA). The cDNA samples were run in duplicate for real-time PCR analysis using the iTAQ SYBR green master mix (Bio-Rad, Hercules, CA, USA). The aβ-actin gene was used as housekeeping gene for normalization across the samples and a fold change was calculated using the formula 2 − Δ Δ C t [18]. The primer sequence of the housekeeping gene, glucose, and protein/amino acid transporters, and tight junction genes are presented in Table 5.

2.3.5. Cecal Short-Chain-Fatty-Acid Analysis

Thawed cecal contents were mixed with distilled water in a 1:3 ratio and centrifuged to clear the dense particles. To the supernatant, freshly prepared metaphosphoric acid was added in a 1:5 ratio and subsequently frozen overnight to facilitate protein precipitation. The next day, the samples were thawed and centrifuged, and ethyl acetate was added to the supernatant to extract short-chain fatty acids into the top layer, and this was later transferred to a screw-thread glass vial for gas chromatography (Shimadzu GC-2010 plus; Shimadzu Corporation, Kyoto, Japan) as described by Lourenco et al. [19].

2.3.6. Oligosaccharide Analysis

Ileal digesta oligosaccharide analysis was conducted using matrix-assisted laser desorption–ionization mass spectrometry, following a protocol adapted from Lin and Olukosi [20]. Freeze-dried and finely ground ileal digesta samples (30 mg) were dispersed in 7 mL of ethyl alcohol, chilled at 4 °C for 1 h, and subsequently centrifuged at 1200× g for 20 min at 4 °C. The resulting supernatant was dried down using nitrogen gas, resuspended in 1 mL of water, and lyophilized for permethylation. Permethylated oligosaccharides were then purified using dichloromethane (DCM) and extracted through centrifugation. The top layer, containing permethylated glycans, was transferred to a clean glass tube, dried under nitrogen, and subjected to structural analysis using MALDI-TOF MS (AB SCIEX TOF/TOF 5800 instrument). Analyzed oligosaccharides included hexose (Hex) and pentose (Pen) oligosaccharides, specifically (Hex)3, (Hex)4, (Hex)5, (Hex)6, (Pen)3, (Pen)4, (Pen)5, and (Pen)6. Data on ileal oligosaccharide content were presented both corrected and uncorrected for the titanium marker, and correction was performed using the following formula:
M a r k e r = c o r r e c t e d   o l i g o s a c c h a r i d e   c o n t e n t = O d i e t × C d i e t C d i g e s t a
Cdiet = TiO2 content in the diet
Cdigesta = TiO2 content in the ileal digesta
Odiet = oligosaccharide content in the diet

2.4. Statistical Analysis

Data were analyzed as a 3 × 2 factorial using the PROC GLM procedure of SAS (version 9.4, SAS Institute Inc., Cary, NC, USA). The factors included wheat bran (0%, 5% coarse WB, 5% fine WB) and stimbiotic supplementation (0 or 100g/ton of feed). Significance was set at p ≤ 0.05 and tendency was declared at 0.05 < p ≤ 0.1. Significantly different means were separated using Tukey’s HSD.

3. Results

3.1. Growth Performance of Broilers in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There was a significant main effect of WB (p < 0.01) and STB supplementation (p < 0.005) on feed intake and the FCR during starter phase (Table 6). Feed intake and the FCR were increased with coarse or fine-WB inclusion compared to diets without either of these, whereas the main effect of STB supplementation increased feed intake (p < 0.01) and the FCR (p = 0.013). There was a tendency for interaction between STB supplementation and WB for weight gain (p = 0.053). Supplementation with STBs had no effect on weight gain in broilers receiving diets without WB or in fine-WB-based diets; however, STB supplementation decreased weight gain in coarse-WB-based diets (p = 0.120).
There was an interaction between factors for feed intake from day 0 to 28, where STB supplementation had no effect on feed intake in diets without WB, whereas STB supplementation to coarse WB diets tended to decrease feed intake but increased feed intake in broilers fed fine-WB-based diets (p = 0.036). There was only a tendency for a significant main effect of WB on weight gain (p = 0.084), where coarse WB supplementation tended to decrease weight gain, but fine-WB inclusion tended to increase weight gain. There was a significant main effect of WB on FCR (p = 0.047) where coarse WB inclusion increased FCR compared to diets without any WB or with fine WB.
For the overall phase (day 0 to 42), a tendency was observed for WB (p = 0.086) in relation to feed intake, where there was a decrease in feed intake in broilers receiving coarse-WB-based diets compared to diets without WB or fine-WB-based diets. There was a significant interaction between factors for weight gain (p = 0.023); STB supplementation tended to decrease weight gain in diets without WB or diets with coarse WB compared to fine WB. There was no significant main effect nor interaction between factors for the FCR.

3.2. Digesta pH in Response to Dietary Supplementation of Stimbiotic or Wheat Bran Inclusion

There were no significant interactions nor main effects between the factors for jejunum and gizzard pH measured at day 18 (Table 7). There was only a tendency for a significant main effect of STB supplementation on cecal pH (p = 0.067), where STB supplementation tended to decrease the pH. There was a significant interaction between WB and STB supplementation for jejunum pH determined at day 42 (p = 0.042), where in diets without WB, supplementation with STB had only a tendency for a decrease in the jejunum digesta pH. Supplementation with STB of coarse- or fine-WB-based diets decreased the jejunum pH compared to diets without STB supplementation (p = 0.001). There was a significant main effect of STB supplementation of a decreased gizzard pH compared to diets without STB supplementation. There was no significant interaction nor main effects between factors for cecal pH.

3.3. Ileal Nutrient Digestibility in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There were no significant interactions nor significant main effects for DMD determined at day 18 (Table 8). There was a significant main effect of WB on ND (p = 0.010) and IDE (p < 0.01), where fine-WB inclusion increased ND and IDE compared to coarse-WB inclusion or diets without WB. There was no significant interaction nor significant main effect between factors for DMD and ND determined at day 42. There was only a significant main effect of STB supplementation on IDE (p = 0.011), where STB supplementation increased the IDE compared to diets without STB supplementation.

3.4. Jejunum Histomorphology in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There was no significant interaction between factors for VH, CD, VW, and VH:CD determined at day 18 and day 42 (Table 9). There was a tendency for a significant main effect of WB inclusion (p = 0.051) where fine WB increased the VH compared to diets without WB and diets with coarse-WB inclusion. A significant main effect of STB supplementation (p = 0.048) increased VH in broiler chickens receiving STB supplementation compared to those without STB supplementation. There was no significant main effect of WB or STB supplementation for CD, VW, and VH:CD determined at day 18. There was no significant main effect of WB or STB supplementation for VH, CD, VW, and VH:CD determined at day 42, except for a tendency for an increase in VW (p = 0.076) in broilers receiving fine-WB-based diets compared to coarse WB or diets without WB.

3.5. Jejunum mRNA Expression of Nutrient Transporters in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There were no significant significant main effects nor interactions between factors for glucose and amino acid transporters determined both on day 18 (Table 10).
There were no significant main effects nor significant interactions between factors for glucose and amino acid transporters determined on day 42 (Table 11). There was only a tendency for an interaction between factors for the mRNA expression of GLUT-5 (p = 0.057). Supplementation with STBs or WB inclusion tended to decrease the mRNA expression of GLUT-5; however, STB supplementation to coarse WB tended to increase mRNA expression.

3.6. Profile of Cecal Short-Chain Fatty Acids in Response to Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There were no significant interactions nor main effects between factors for the cecal concentrations of acetate, propionate, butyrate, isovalerate, and valerate determined at day 18 (Table 12). There was only a tendency for an interaction between factors for acetate (p = 0.061), where fine-WB inclusion tended to decrease the acetate concentration compared to coarse WB or diets without WB in diets not supplemented with STBs. However, in diets supplemented with STBs, fine WB tended to increase the acetate concentration. The significant main effect of WB on isobutyrate (p = 0.015) was that it decreased its concentration with coarse or fine-WB inclusion compared to diets without WB. There was only a tendency for a decrease in isobutyrate (p = 0.086) and isovalerate (p = 0.081) with STB supplementation. There was a significant interaction between factors for the total SCFA (p = 0.045). Supplementation with STB had no effect on the total SCFA in diets without WB. However, STB supplementation of coarse WB tended to decrease the total SCFA, while in fine-WB-based diets, it tended to increase the cecal total SCFA concentration (p = 0.045). The total BCFA concentration was significantly decreased with dietary WB inclusion, regardless of WB particle size.
There were no significant main effects nor significant interactions between factors for the cecal concentration of acetate, propionate, isobutyrate, butyrate, isovalerate, and valerate determined on day 42 (Table 13). There was only a tendency for a decrease in the cecal concentrations of isobutyrate (p = 0.086) and valerate at day 42 (p = 0.099) with STB supplementation.

3.7. The Oligosaccharide Profile in the Ileal Digesta of Broiler Chickens Receiving Dietary Supplementation of Stimbiotics or Wheat Bran Inclusion

There was no significant interaction between factors for marker-corrected ileal digesta hexose and pentose oligosaccharides determined on day 42 (Table 14). There was no significant main effect of WB nor significant main effect of STB supplementation on (Hex)3, (Hex)4, (Hex)5, (Pent)4, or (Pent)5. There was a significant main effect of WB (p = 0.007) on (Hex)6, where fine-WB inclusion increased its concentration in the ileum compared to coarse WB or diets without WB. There was only a tendency for a significant main effect of STB supplementation (p = 0.097) on the (Pent)3 concentration in the ileum. Supplementation with STBs (p = 0.097) tended to increase the (Pent)3 concentration in the ileum compared to diets without STB supplementation.

4. Discussion

Moderate inclusion of fibers into broiler diets has been shown to be beneficial; however, there is still no consensus on the effect of the particle size of the fiber. So, the objective of this study was to determine the impact of the particle size of WB and its interactive effect with STB supplementation in broilers. All the experimental diets were formulated to provide similar amounts of nutrients and energy to broilers, but there were differences in the performance of broilers. Coarse or fine WB at a 50 g/kg inclusion level increased the feed intake and FCR of broilers in the starter phase. From the current literature, a decrease or no effect on feed intake was observed in most studies when WB was included at ≤50 g/kg levels into broiler diets [11,21,22], whereas inclusion of WB at >50 g/kg or more into broiler diets increased feed intake and the FCR [23,24,25,26,27]. Our data suggest that the current inclusion rate of WB was at the threshold and mimicked the responses where more than 50 g/kg WB was used. Increased fiber inclusion levels at more than 50 g/kg significantly increase the fiber level in the diet, which can reduce feed intake by increasing the digesta viscosity and bulkiness, and decreasing the digesta flow rate. However, at an inclusion level of less than 50 g/kg, the level of fiber may not be sufficient to decrease the digesta flow rate, so an increase in feed intake was not usually observed at this inclusion level.
At a 50 g/kg inclusion level of WB, the effect on broiler growth performance is not apparent. In the current study, at a 50 g/kg inclusion level, the antinutritive effects of either coarse or fine WB were observed for the FCR of broiler chickens during the starter phase. However, during the grower phase, the negative effect of feeding coarse, but not fine, WB was manifested as decreased nutrient digestibility and villi height. So, this suggests that during the starter phase, broilers try to maintain their weight gain by increasing their feed intake, which increases the FCR both with the coarse or fine particle size of the fiber. However, during the grower phase, the particle size of the fiber makes a huge difference in how broilers react to their inclusion. Grower-phase broiler chickens fed fine-WB-based diets were able to maintain their weight gains without increasing their feed intake. Reducing the particle size of the WB results in a low water-holding capacity compared to the coarse particle size, which also reduces the viscosity of the digesta [9]. One possible reason for no negative effect on feed intake and weight gain in grower-phase broiler chockens due to fine-wheat-bran inclusion could be attributed to (1) an adaptation to fiber, (2) an increase in nutrient digestibility, and (3) an increase in villi height. An increase in villi height increases the surface area for the absorption of nutrients, which likely partly explains the increase in ileal digestibility of energy and nitrogen observed in this study, which led to a decrease in the FCR. Along a similar line, an increase in starter-phase FCR and feed intake, was observed with STB supplementation only in starter-phase broilers but not in grower-phase broilers, and similar effects have been reported in previous studies [28,29]. A previous study from our lab [22] also found no effects on the performance of broilers with STB supplementation (with or without WB inclusion) in starter-phase (day 0 to 10) broilers. There is no clear explanation for such an effect but it could be due to the adaptation or immaturity of the gut of young broilers to utilize STB fully and beneficially.
An increase in the nutrient digestibility and jejunum villi height on day 18 with fine-WB inclusion did not translate into an increase in weight gain in the corresponding grower phase. A tendency for a numerical increase in body-weight gains were observed with fine-WB inclusion compared to coarse-WB inclusion. This could be because the coarse particle size of any fiber was shown to increase the relative weights of gizzards, which may translate to an increase in weight gain [30,31]. But, the relative weight of the gizzard decreases with a decrease in the particle size of the fiber [32]. In contrast, fine WB increased the weight gains by increasing nutrient digestibility. In a study by Novotný et al. [33] an increase in gizzard weight with coarse-particle-size feed was observed, while a decrease was observed with fine particle size of the feed. In the same study, the overall body-weight gain of broilers receiving coarse- or fine-particle-size WB was not different, but the carcass weight was increased by 9% in fine- compared to coarse-particle-size feed. It is possible that the increased gizzard weight of birds receiving diets containing coarse wheat bran is the reason why the birds in those groups were heavier. To clearly differentiate the mechanism of the increase in body-weight gain with the coarse or fine particle size of fiber inclusion, one should determine the weight gains without the gizzard, or weights after processing.
An increase in hexose and pentose oligosaccharides were observed with WB inclusion and a tendency for a further increase was observed with fine-WB inclusion. Although not significant, there was a numerical increase in (Pent)3 concentration in the ileal digesta with WB when supplemented with STB. As hypothesized, reducing the particle size of WB increases the surface area for the enzyme component of the STB to act on and increases the concentration of ileal oligosaccharides. Supplementation with STB did not have any effect on the total SCFA in diets without WB. There was no clear understanding of why a decrease in the total SCFA was observed with fine-WB inclusion. However, a decrease in total SCFA with fine-WB inclusion was reversed with STB supplementation. The fine particle size of the WB increases the surface for the STB to act on and facilitates the hydrolysis of complex fiber into oligosaccharides [11].
The current hypothesis is that oligosaccharides released in the ileal digesta with fine WB will be utilized in the ceca and this leads to an increase in concentration of SCFA. Contrary to expectations, no such effect was observed on the concentration of SCFA in the ceca. This could be due to two reasons: (1) these oligosaccharides might have been already fermented by microbes in the ileum or (2) they could have been fermented in the ceca, leading to the release of short-chain fatty acids. However due to their rapid absorption [34,35], an increase in concentration was not observed. However, during day 18 or 42, there was a decrease in the concentration of isobutyrate and isovalerate (which belong to the branched-chain fatty acids) either with WB inclusion or with STB supplementation. A similar trend was observed in a similar study reported earlier [22]. A reduction in BCFA levels indicates decreased protein fermentation, suggesting that less protein was being fermented in the ceca, either due to enhanced protein utilization in the upper gastrointestinal tract (GIT) resulting in less protein to ferment, or increased levels or fermentable fiber, which is preferentially fermented over protein. The beneficial effects of a decrease in BCFAs include a reduction in the production of harmful byproducts, which have negative effect of gut health of broilers [36,37,38]. A decrease in the pH of the gizzard, jejunum, and cecum with STB supplementation potentially reduces the growth of pathogenic bacteria and increases the secretion of digestive enzymes, which increases nutrient digestibility [39,40]. This also partly explains an increase in IDE on day 42 with STB supplementation.

5. Conclusions

In conclusion, wheat bran inclusion or stimbiotic supplementation increased the FCR in young broilers, but during the grower or finisher phases, reducing the particle size of the wheat bran along with stimbiotic supplementation had no negative effect in terms of performance and nutrient digestibility. Stimbiotic supplementation or coarse- or fine-wheat-bran inclusion did not influence the total short-chain fatty acid concentration.

Author Contributions

Methodology, M.R.B., G.G.-O., S.V. and O.A.O.; Formal analysis, S.V.; Investigation, S.V. and O.A.O.; Writing—original draft, S.V.; Writing—review and editing, S.V., M.R.B., G.G.-O. and O.A.O.; Supervision, O.A.O.; Project administration, O.A.O. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the AB Vista [NSPASEE46]. This work was supported by the United States Department of Agriculture (USDA) National Institute of Food and Agriculture, Hatch project 1021533. The work was also supported in part by a cooperative agreement, 58-6040-8-034, from the USDA—Agricultural Research Service, and by the U. S. Department of Energy, Office of Science, Basic Energy Sciences, under Award DE-SC0015662 to Parastoo Azadi at the Complex Carbohydrate Research Center, USA.

Institutional Review Board Statement

This study was approved by the Institutional Animal Care and Use Committee at the University of Georgia (Athens, GA, USA; IACUC number: A2021-06-006).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors gratefully acknowledge the assistance of Adeleye Ajao, Mohammad Pilevar, Hanna Phillipi, Iyabo Oluseyifunmi, and Bhargavi Kasireddy for helping with samplings and animal trial, and Lindsey Racket for their assistance with animal care. The authors also acknowledge Andrea Rubio from North Carolina State University for helping us with the particle-size analysis of wheat bran. The authors also acknowledge the assistance of Parastoo Azadi, Ian Black, and Grace Lu in providing equipment and technical support for oligosaccharides analysis.

Conflicts of Interest

Mike R. Bedford and Gemma Gonzalez Ortiz are employees of AB Vista company, which provided the stimbiotic (Signis, β-1,4-endo-xylanase, and xylo-oligosaccharide-oligosaccharides, AB Vista, Marlborough, UK) used in this study. Other authors declare no conflicts of interest.

References

  1. Cho, H.M.; Gonzalez-Ortiz, G.; Melo-Duran, D.; Heo, J.M.; Cordero, G.; Bedford, M.R.; Kim, J.C. Stimbiotic supplementation improved performance and reduced inflammatory response via stimulating fiber fermenting microbiome in weaner pigs housed in a poor sanitary environment and fed an antibiotic-free low zinc oxide diet. PLoS ONE 2020, 15, e0240264. [Google Scholar] [CrossRef] [PubMed]
  2. Bautil, A.; Verspreet, J.; Buyse, J.; Goos, P.; Bedford, M.; Courtin, C. Arabinoxylan-oligosaccharides kick-start arabinoxylan digestion in the aging broiler. Poult. Sci. 2020, 99, 2555–2565. [Google Scholar] [CrossRef] [PubMed]
  3. Ribeiro, T.; Cardoso, V.; Ferreira, L.; Lordelo, M.; Coelho, E.; Moreira, A.; Domingues, M.; Coimbra, M.; Bedford, M.; Fontes, C. Xylo-oligosaccharides display a prebiotic activity when used to supplement wheat or corn-based diets for broilers. Poult. Sci. 2018, 97, 4330–4341. [Google Scholar] [CrossRef] [PubMed]
  4. Knudsen, K.E.B. Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets. Poult. Sci. 2014, 93, 2380–2393. [Google Scholar] [CrossRef] [PubMed]
  5. Shang, Q.; Wu, D.; Liu, H.; Mahfuz, S.; Piao, X. The Impact of Wheat Bran on the Morphology and Physiology of the Gastrointestinal Tract in Broiler Chickens. Animals 2020, 10, 1831. [Google Scholar] [CrossRef]
  6. Jiménez-Moreno, E.; González-Alvarado, J.; de Coca-Sinova, A.; Lázaro, R.; Cámara, L.; Mateos, G. Insoluble fiber sources in mash or pellets diets for young broilers. 2. Effects on gastrointestinal tract development and nutrient digestibility. Poult. Sci. 2019, 98, 2531–2547. [Google Scholar] [CrossRef]
  7. Saleh, A.A.; Zaki, A.; El-Awady, A.; Amber, K.; Badwi, N.; Eid, Y.; Ebeid, T.A. The effect of substituting wheat bran with cumin seed meal on laying performance, egg quality characteristics and fatty acid profile in laying hens. Vet. Arh. 2020, 90, 47–56. [Google Scholar] [CrossRef]
  8. Akhtar, M.; Tariq, A.F.; Awais, M.M.; Iqbal, Z.; Muhammad, F.; Shahid, M.; Hiszczynska-Sawicka, E. Studies on wheat bran Arabinoxylan for its immunostimulatory and protective effects against avian coccidiosis. Carbohydr. Polym. 2012, 90, 333–339. [Google Scholar] [CrossRef]
  9. Vermeulen, K.; Verspreet, J.; Courtin, C.M.; Haesebrouck, F.; Ducatelle, R.; Van Immerseel, F. Reduced particle size wheat bran is butyrogenic and lowers Salmonella colonization, when added to poultry feed. Vet. Microbiol. 2017, 198, 64–71. [Google Scholar] [CrossRef]
  10. Brewer, L.R.; Kubola, J.; Siriamornpun, S.; Herald, T.J.; Shi, Y.-C. Wheat bran particle size influence on phytochemical extractability and antioxidant properties. Food Chem. 2014, 152, 483–490. [Google Scholar] [CrossRef]
  11. Bautil, A.; Bedford, M.R.; Buyse, J.; Courtin, C.M. Reduced-particle size wheat bran and endoxylanase supplementation in broiler feed affect arabinoxylan hydrolysis and fermentation with broiler age differently. Anim. Nutr. 2023, 12, 308–320. [Google Scholar] [CrossRef] [PubMed]
  12. Rubio Molina, A.A. The Effects of Mixing and Pelleting Technological Applications on Feed Quality Parameters and Broiler Growth Performance. Master’s Thesis, North Carolina State University, Raleigh, NC, USA, 2022. [Google Scholar]
  13. ANSI/ASAE S319.5 AUG2023; Method of Determining and Expressing Fineness of Feed Materials by Sieving. American Society of Agricultural and Biological Engineers: St. Joseph, MI, USA, 2008.
  14. Short, F.; Gorton, P.; Wiseman, J.; Boorman, K. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
  15. Veluri, S.; Olukosi, O.A. Metabolizable Energy of Soybean Meal and Canola Meal as Influenced by the Reference Diet Used and Assay Method. Animals 2020, 10, 2132. [Google Scholar] [CrossRef] [PubMed]
  16. Olukosi, O.A.; Dono, N.D. Modification of digesta pH and intestinal morphology with the use of benzoic acid or phytobiotics and the effects on broiler chicken growth performance and energy and nutrient utilization. J. Anim. Sci. 2014, 92, 3945–3953. [Google Scholar] [CrossRef] [PubMed]
  17. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  18. Lourenco, J.M.; Nunn, S.C.; Lee, E.J.; Dove, C.R.; Callaway, T.R.; Azain, M.J. Effect of supplemental protease on growth performance and excreta microbiome of broiler chicks. Microorganisms 2020, 8, 475. [Google Scholar] [CrossRef]
  19. Lin, Y.; Olukosi, O.A. Qualitative and quantitative profiles of jejunal oligosaccharides and cecal short-chain fatty acids in broiler chickens receiving different dietary levels of fiber, protein and exogenous enzymes. J. Sci. Food Agric. 2021, 101, 5190–5201. [Google Scholar] [CrossRef]
  20. Shang, Q.; Liu, S.; He, T.; Liu, H.; Mahfuz, S.; Ma, X.; Piao, X. Effects of wheat bran in comparison to antibiotics on growth performance, intestinal immunity, barrier function, and microbial composition in broiler chickens. Poult. Sci. 2020, 99, 4929–4938. [Google Scholar] [CrossRef]
  21. Veluri, S.; Gonzalez-Ortiz, G.; Bedford, M.R.; Olukosi, O.A. Interactive effects of a Stimbiotic supplementation and wheat bran inclusion in corn- or wheat-based diets on growth performance, ileal digestibility, and expression of nutrient transporters of broilers chickens. Poult. Sci. 2023, 103, 103178. [Google Scholar] [CrossRef]
  22. Rabie, M.; Dorra, T.; EI-Serwy, A.; El-Gogary, M. The Use of Rice Bran or Wheat Bran in Diets of Broiler Chicks. J. Anim. Poult. Prod. 2005, 30, 801–818. [Google Scholar] [CrossRef]
  23. Salami, S.A.; Agbonlahor, E.M.; Salako, A.O.; Sideeq, B.A.; Agboola, J.O.; Atteh, J.O. Nutritive values of wheat bran-based broiler diet supplemented with different classes of enzymes. Trop. Agric. 2018, 95, 12. [Google Scholar]
  24. Singh, A.K.; Mandal, R.K.; Bedford, M.R.; Jha, R. Xylanase improves growth performance, enhances cecal short-chain fatty acids production, and increases the relative abundance of fiber fermenting cecal microbiota in broilers. Anim. Feed Sci. Technol. 2021, 277, 114956. [Google Scholar] [CrossRef]
  25. Ketaren, P. Optimizing wheat bran utilization for poultry production through enzyme supplementation: 1. Broiler chicken. In Proceedings of the International Seminar on Tropical Animal Production (ISTAP), Yogyakarta, Indonesia, 8–9 November 2006; pp. 368–373. [Google Scholar]
  26. Li, B.; Schroyen, M.; Leblois, J.; Beckers, Y.; Bindelle, J.; Everaert, N. The use of inulin and wheat bran only during the starter period or during the entire rearing life of broilers: Effects on growth performance, small intestinal maturation, and cecal microbial colonization until slaughter age. Poult. Sci. 2019, 98, 4058–4065. [Google Scholar] [CrossRef] [PubMed]
  27. Jacobs, P.J.; Hemdane, S.; Dornez, E.; Delcour, J.A.; Courtin, C.M. Study of hydration properties of wheat bran as a function of particle size. Food Chem. 2015, 179, 296–304. [Google Scholar] [CrossRef] [PubMed]
  28. González-Ortiz, G.; Dos Santos, T.T.; Bedford, M.R. Evaluation of xylanase and a fermentable xylo-oligosaccharide on performance and ileal digestibility of broiler chickens fed energy and amino acid deficient diets. Anim. Nutr. 2021, 7, 488–495. [Google Scholar] [CrossRef] [PubMed]
  29. Šimić, A.; González-Ortiz, G.; Mansbridge, S.C.; Rose, S.P.; Bedford, M.R.; Yovchev, D.; Pirgozliev, V.R. Broiler chicken response to xylanase and fermentable xylooligosaccharide supplementation. Poult. Sci. 2023, 102, 103000. [Google Scholar] [CrossRef]
  30. Amerah, A.; Ravindran, V.; Lentle, R. Influence of insoluble fibre and whole wheat inclusion on the performance, digestive tract development and ileal microbiota profile of broiler chickens. Br. Poult. Sci. 2009, 50, 366–375. [Google Scholar] [CrossRef]
  31. Longe, O. Effects of increasing the fibre content of a layer diet. Br. Poult. Sci. 1984, 25, 187–193. [Google Scholar] [CrossRef]
  32. Jiménez-Moreno, E.; González-Alvarado, J.M.; González-Sánchez, D.; Lázaro, R.; Mateos, G.G. Effects of type and particle size of dietary fiber on growth performance and digestive traits of broilers from 1 to 21 days of age 1. Poult. Sci. 2010, 89, 2197–2212. [Google Scholar] [CrossRef]
  33. Novotný, J.; Horáková, L.; Řiháček, M.; Zálešáková, D.; Šťastník, O.; Mrkvicová, E.; Kumbár, V.; Pavlata, L. Effect of Different Feed Particle Size on Gastrointestinal Tract Morphology, Ileal Digesta Viscosity, and Blood Biochemical Parameters as Markers of Health Status in Broiler Chickens. Animals 2023, 13, 2532. [Google Scholar] [CrossRef]
  34. Stumpff, F. A look at the smelly side of physiology: Transport of short chain fatty acids. Pflügers Arch. Eur. J. Physiol. 2018, 470, 571–598. [Google Scholar] [CrossRef] [PubMed]
  35. Ruppin, H.; Bar-Meir, S.; Soergel, K.H.; Wood, C.M.; Schmitt Jr, M.G. Absorption of short-chain fatty acids by the colon. Gastroenterology 1980, 78, 1500–1507. [Google Scholar] [CrossRef] [PubMed]
  36. Elling-Staats, M.; Gilbert, M.; Smidt, H.; Kwakkel, R. Caecal protein fermentation in broilers: A review. World’s Poult. Sci. J. 2022, 78, 103–123. [Google Scholar] [CrossRef]
  37. Qaisrani, S.; Van Krimpen, M.; Kwakkel, R.; Verstegen, M.; Hendriks, W. Dietary factors affecting hindgut protein fermentation in broilers: A review. World’s Poult. Sci. J. 2015, 71, 139–160. [Google Scholar] [CrossRef]
  38. Gilbert, M.S.; Ijssennagger, N.; Kies, A.K.; van Mil, S.W. Protein fermentation in the gut; implications for intestinal dysfunction in humans, pigs, and poultry. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G159–G170. [Google Scholar] [CrossRef]
  39. Nguyen, H.; Wu, S.-B.; Bedford, M.; Nguyen, X.; Morgan, N. Dietary soluble non-starch polysaccharide level and xylanase influence the gastrointestinal environment and nutrient utilisation in laying hens. Br. Poult. Sci. 2022, 63, 340–350. [Google Scholar] [CrossRef]
  40. Van Hoeck, V.; Papadopoulos, G.A.; Giannenas, I.; Lioliopoulou, S.; Tsiouris, V.; Mantzios, T.; Kiskinis, K.; Grivas, I.; Gonzalez Sanchez, A.L.; Vasanthakumari, B.L. New Intrinsically Thermostable Xylanase Improves Broilers’ Growth Performance, Organ Weights, and Affects Intestinal Viscosity and pH. Agriculture 2021, 11, 1235. [Google Scholar] [CrossRef]
Table 1. Feedstuff and chemical composition (g/kg) of the starter-phase (d 0 to 10) diets.
Table 1. Feedstuff and chemical composition (g/kg) of the starter-phase (d 0 to 10) diets.
ItemsControlControl + Coarse WBControl + Fine WB
Wheat bran (WB)—coarse 50
Wheat bran—fine 50
Corn617560560
Soybean meal (48%)325319319
Soya oil21.43535
NaCl3.63.63.6
Limestone4.34.64.6
Dicalcium phosphate12.311.811.8
Lysine HCl2.32.42.4
DL-Methionine2.92.92.9
Threonine0.60.70.7
Valine0.60.70.7
Mineral premix 15.05.05.0
Vitamin premix 25.05.05.0
Quantum Blue 5G 30.10.10.1
Total100010001000
Calculated nutrient content, g/kg
Crude protein215215215
ME kcal/kg305030503050
Dry matter 870872872
Ca 9.09.09.0
Total P 7.78.07.0
Non-phytate P5.15.15.1
Digestible amino acids, g/kg
Methionine 6.06.16.1
Cysteine3.73.73.7
Lysine 13.413.413.4
Threonine8.78.78.7
Tryptophan 2.52.62.6
Arginine14.114.214.2
Valine 10.410.410.4
Isoleucine 8.88.88.8
Analyzed nutrient content
DM880880880
Crude protein220220220
Phytate P 3.03.13.1
Acid detergent fiber34.236.336.3
Neutral detergent fiber 73.889.689.6
1 Vitamin A, 5484 IU; vitamin D3, 2643 ICU; vitamin E, 11 IU; menadione sodium bisulfate, 4.38 mg; riboflavin, 5.49 mg; d-pantothenic acid, 11 mg; niacin, 44.1 mg; choline chloride, 771 mg; vitamin B12, 13.2 µg; biotin, 55.2 µg; thiamine mononitrate, 2.2 mg; folic acid, 990 µg; pyridoxine hydrochloride, 3.3 mg. 2 Iodine, 1.11 mg; manganese, 66.06 mg; copper, 4.44 mg; iron, 44.1 mg; zinc, 44.1 mg; selenium, 300 µg. 3 Quantum Blue phytase supplemental dose of 500 FTU/kg of feed.
Table 2. Feedstuff and chemical composition (g/kg) of the grower-phase (d 10 to 28) diets.
Table 2. Feedstuff and chemical composition (g/kg) of the grower-phase (d 10 to 28) diets.
ItemsControlControl + Coarse WBControl + Fine WB
Wheat bran (WB)—coarse 50
Wheat bran—fine 50
Corn683626626
Soybean meal (48%)261255255
Soya oil203333
NaCl3.73.73.7
Limestone4.14.44.4
Dicalcium Phosphate10.910.410.4
Lysine HCl2.92.92.9
DL-Methionine2.52.62.6
Threonine0.70.70.7
Valine0.80.80.8
Mineral premix 15.05.05.0
Vitamin premix 25.05.05.0
Quantum Blue 5G 30.10.10.1
Total100010001000
Calculated nutrient content, g/kg
Crude protein 190190190
ME, kcal/kg310031003100
Dry matter869870870
Ca8.48.48.4
Total P7.17.47.4
Non-phytate P 4.74.64.6
Digestible amino acids, g/kg
Methionine 5.45.45.4
Cysteine 3.43.43.4
Lysine 12.012.112.1
Threonine 7.87.87.8
Tryptophan2.22.22.2
Arginine 12.012.112.1
Valine 9.49.49.4
Isoleucine 7.67.67.6
Analyzed nutrient content, g/kg
Dry matter890890890
Crude protein170160160
Phytate P2.62.72.7
Acid detergent fiber37.036.536.5
Neutral detergent fiber78.285.985.9
1 Vitamin A, 5484 IU; vitamin D3, 2643 ICU; vitamin E, 11 IU; menadione sodium bisulfate, 4.38 mg; riboflavin, 5.49 mg; d-pantothenic acid, 11 mg; niacin, 44.1 mg; choline chloride, 771 mg; vitamin B12, 13.2 µg; biotin, 55.2 µg; thiamine mononitrate, 2.2 mg; folic acid, 990 µg; pyridoxine hydrochloride, 3.3 mg. 2 Iodine, 1.11 mg; manganese, 66.06 mg; copper, 4.44 mg; iron, 44.1 mg; zinc, 44.1 mg; selenium, 300 µg. 3 Quantum Blue phytase equivalent to the supplemental dose of 500 FTU/kg of feed.
Table 3. Feedstuff and chemical composition (g/kg) of finisher-phase (d 28 to 42) diets.
Table 3. Feedstuff and chemical composition (g/kg) of finisher-phase (d 28 to 42) diets.
ItemsControlControl + Coarse WBControl + Fine WB
Wheat bran (WB)—coarse 50
Wheat bran—fine 50
Corn704647647
Soybean meal (48%)241234234
Soya oil253838
NaCl3.73.73.7
Limestone3.74.04.0
Dicalcium phosphate8.58.08.0
Lysine HCl2.02.12.1
DL-Methionine2.12.22.2
Threonine0.50.50.5
Valine0.10.20.2
Mineral premix 15.05.05.0
Vitamin premix 25.05.05.0
Quantum Blue 5G 30.10.10.1
Total100010001000
Calculated nutrient content, g/kg
Crude protein180180180
ME, kcal/kg315031503150
Dry matter869871871
Calcium 7.67.67.6
Total P6.66.96.9
Non-phytate P4.24.14.1
Phytate 2.42.82.8
Digestible amino acids, g/kg
Methionine 4.94.94.9
Cysteine 3.33.33.3
Lysine 10.810.810.8
Threonine7.37.37.3
Tryptophan 2.02.12.1
Arginine 11.411.511.5
Valine 8.38.48.4
Isoleucine 7.27.27.2
Analyzed nutrient content, g/kg
Dry matter880880880
Crude protein160160160
Phytate P2.72.82.8
Acid detergent fiber36.037.537.5
Neutral detergent fiber75.983.883.8
1 Vitamin A, 5484 IU; vitamin D3, 2643 ICU; vitamin E, 11 IU; menadione sodium bisulfate, 4.38 mg; riboflavin, 5.49 mg; d-pantothenic acid, 11 mg; niacin, 44.1 mg; choline chloride, 771 mg; vitamin B12, 13.2 µg; biotin, 55.2 µg; thiamine mononitrate, 2.2 mg; folic acid, 990 µg; pyridoxine hydrochloride, 3.3 mg. 2 Iodine, 1.11 mg; manganese, 66.06 mg; copper, 4.44 mg; iron, 44.1 mg; zinc, 44.1 mg; selenium, 300 µg. 3 Quantum Blue phytase equivalent to the supplemental dose of 500 FTU/kg of feed.
Table 4. Analyzed enzyme activity of the diets.
Table 4. Analyzed enzyme activity of the diets.
Diet PhaseDietXylanase (BXU 1/kg)Phytase (FTU 2/kg)
StarterBasal<2000964
Basal + Coarse WB<2000875
Basal + Fine WB<20001050
Basal + STB19,800870
Basal + Coarse WB+ STB22,2001100
Basal + Fine WB+ STB22,7001040
GrowerBasal<2000950
Basal + Coarse WB<2000888
Basal + Fine WB<20001150
Basal + STB15,600843
Basal + Coarse WB+ STB16,000928
Basal + Fine WB+ STB16,3001040
FinisherBasal<2000849
Basal + Coarse WB<20001290
Basal + Fine WB<20001220
Basal + STB12,500960
Basal + Coarse WB+ STB14,300991
Basal + Fine WB+ STB16,4001010
1 One unit of BXU is defined as the amount of enzyme that produces 1 nmol of reducing sugar from xylan as xylo-oligosaccharidese at pH 5.3 and 50 °C. 2 One unit of FTU is defined as the amount of enzyme required to release 1 µmol of inorganic phosphorus per minute from sodium phytate at pH 5.5 and 37 °C.
Table 5. List of primers used for qRT-PCR.
Table 5. List of primers used for qRT-PCR.
GeneFull NameFunctionForward PrimerReverse Primer
-actinBeta-actinHousekeeping geneCAACACAGTGCTGTCTGGTGGTAATCGTACTCCTGCTTGCTGATCC
b0+ATSolute carrier family 7-member 9Na+-independent neutral/cysteine, cationic
amino
acid exchanger		CAGTAGTGAATTCTCTGAGTGTGAAGCTGCAATGATTGCCACAACTACCA
GLUT-1Glucose
Transporter 1		Glucose
transporter		CTTTGTCAACCGCTTTGGCAGAATACAGGCCG
ATGAT
GLUT-2Glucose transporter 2Glucose
transporter		TTCATTGTAGCTGAGCTGTTCGAAGACAACGAACACATAC
GLUT-5Glucose transporter 5Glucose
transporter		TTGCTGGCTTTGGGTTGTGGGAGGTTGAGGGCCAAAGTC
rBATSolute carrier family 3
member 1		Dimerize with bo,+ATCCCGCCGTTCAACAAGAGAATTAAATCCATCGACTCCTTTGC
pepT-1Peptide
transporter 1		Peptide
transporter		CCCCTGAGGAGGATCACTGTTCAAAAGAGCAGCAGCAACGA
SGLT-1Sodium glucose transporter 1Glucose
transporter		GCCGTGGCCAGGGCTTACAATAACCTGATCTGTGACCAGT
SGLT-4Sodium glucose transporter 4Glucose
transporter		ATACCCAAGGTAATAGTCCCAAACTGGGTCCCTGAACAAATGAAA
y+ LAT1y+ L amino acid transporter 1Na+-dependent neutral/cationic amino
acid exchanger		CAGAAAACCTCAGAGCTCCCTTTTGAGTACAGAGCCAGCGCAAT
CAT2Cationic amino acid transporter 2Amino acid transporterTGGATCAGGTTTAGCATCTGCGGAACAAGAATCTCCATCT
Table 6. Influence of wheat bran particle size and stimbiotic supplementation on growth performance of broiler chickens.
Table 6. Influence of wheat bran particle size and stimbiotic supplementation on growth performance of broiler chickens.
WB, g/kgSTBDay 0–10Day 0–28Day 0–42
FI, gGain, gFCRFI, gGain, gFCRFI, gGain, gFCR
Means for main effect of wheat bran
0 249 b1861.34 b216715141.43 b507429351.74
50 g/kg Coarse 278 a1871.50 a214914711.46 a490128871.70
50 g/kg Fine 289 a1951.48 a222915581.43 b510329221.76
Pooled SEM 4.673.460.0429260.0165620.04
p-Value <0.0010.1200.0130.1440.0840.0470.0860.7890.486
Means for main effect of STB
−2641901.40219115161.45504129441.72
+2801891.49217315131.44501028861.74
Pooled SEM 3.812.820.0323210.0153510.03
p-ValueSTB0.0050.7920.0460.6060.9180.4910.6890.3280.590
Means for interaction effects
0−244184 a1.332155 ab14851.4550783014 a1.69
50 g/kg Coarse−272193 a1.412221 ab15211.4650182986 ab1.69
50 g/kg Fine−276191 a1.452195 ab15411.4350282832 ab1.79
0+255188 a1.362180 ab15441.4150702856 ab1.79
50 g/kg Coarse+284179 b1.602077 b14201.4647832789 b1.72
50 g/kg Fine+302199 a1.522262 a15741.4451773012 a1.73
Pooled SEM 6.604.890.0640370.0192880.05
p-Value 0.4230.0530.3780.0360.0890.1460.1420.0230.257
WB, wheat bran; STB, stimbiotic; FI, feed intake; FCR, feed conversion ratio. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively. a,b Means in a column, within a group, with different superscripts are significantly different (p < 0.05).
Table 7. Influence of wheat bran particle size and stimbiotic supplementation on pH of gastrointestinal tract in broiler chickens.
Table 7. Influence of wheat bran particle size and stimbiotic supplementation on pH of gastrointestinal tract in broiler chickens.
WB, g/kgSTBDay 18Day 42
JejunumGizzardCecumJejunumGizzardCecum
Means for main effect of wheat bran
0 6.343.486.306.563.537.52
50 g/kg Coarse 6.333.406.266.503.507.44
50 g/kg Fine 6.413.266.296.533.467.47
Pooled SEM 0.0380.1460.1050.0370.0770.080
p-Value 0.2940.5850.8830.5790.8170.742
Means for main effect of STB
−6.373.396.386.613.647.55
+6.353.376.186.453.357.40
Pooled SEM 0.0310.1200.0860.0310.0630.066
p-Value 0.6660.9380.0670.0010.0020.108
Means for interaction effects
0−6.343.576.406.56 a3.737.62
50 g/kg Coarse−6.333.416.356.62 a3.677.44
50 g/kg Fine−6.443.186.386.66 a3.537.60
0+6.333.396.196.56 ab3.337.43
50 g/kg Coarse+6.343.396.156.39 c3.337.43
50 g/kg Fine+6.383.346.216.41 bc3.407.34
Pooled SEM 0.050.210.150.050.110.11
p-Value 0.7790.7190.9870.0420.4410.540
WB, wheat bran; STB, stimbiotic. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively. a–c Means in a column, within a group, with different superscripts are significantly different (p < 0.05).
Table 8. Influence of wheat bran particle size and stimbiotic supplementation on apparent ileal nutrient digestibility in broiler chickens.
Table 8. Influence of wheat bran particle size and stimbiotic supplementation on apparent ileal nutrient digestibility in broiler chickens.
WB, g/kgSTBDay 18Day 42
DMD%ND%IDE, MJ/kgDMD%ND%IDE, MJ/kg
Means for main effect of wheat bran
0 70.576.2 b13.36 b73.380.212.21
50 g/kg Coarse 70.077.3 b13.59 b73.681.212.10
50 g/kg Fine 71.779.2 a14.39 a74.682.512.48
Pooled SEM 0.890.660.1590.840.860.120
p-Value 0.4410.010< 0.010.6140.1880.177
Means for main effect of STB
−70.177.013.7473.480.912.04
+71.478.113.8274.281.712.47
Pooled SEM 0.730.540.1300.680.700.098
p-ValueSTB0.1760.1330.6840.3990.4910.011
Means for interaction effects
0−68.774.413.0972.579.611.96
50 g/kg Coarse−70.077.613.6873.380.911.95
50 g/kg Fine−71.679.014.4674.582.112.25
0+72.478.013.6474.180.712.43
Coarse+70.077.013.5073.981.512.28
Fine+71.979.414.3274.782.812.64
Pooled SEM 1.260.930.2251.191.210.169
p-Value 0.2520.0880.2020.7620.9730.923
STB, stimbiotic; DMD, dry mater digestibility; ND, nitrogen digestibility; IDE, ileal digestible energy. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively. a,b Means in a column, within a group, with different superscripts are significantly different (p < 0.05).
Table 9. Influence of wheat bran particle size and stimbiotic supplementation on jejunum histomorphology in broiler chickens.
Table 9. Influence of wheat bran particle size and stimbiotic supplementation on jejunum histomorphology in broiler chickens.
WB, g/kgSTBDay 18Day 42
VH, μmCD, μmVW, μmVH/CDVH, μmCD, μmVW, μmVH/CD
Means for main effect of wheat bran
0 1230 b1451578.70159618014010.95
50 g/kg Coarse 1248 b1531548.53159014613811.09
50 g/kg Fine 1346 a1471569.18162915515310.94
Pooled SEM 34.37.235.070.3759.320.94.640.66
p-Value 0.0510.5460.9120.4570.8810.4990.0760.984
Means for main effect of STB
−12351461568.67160317514510.69
+13141511558.93160714614211.29
Pooled SEM 28.05.914.140.3148.517.13.790.54
p-Value 0.0480.7490.8990.5530.9550.2360.6470.430
Means for interaction effects
0−12121411558.8515572251459.53
50 g/kg Coarse−12331541628.35156314213911.11
50 g/kg Fine−12601431508.82168915615111.43
0+12491491588.56163413413612.36
50 g/kg Coarse+12631521458.70161714913711.07
50 g/kg Fine+14311521629.53157015415410.45
Pooled SEM 55.011.88.280.6196.934.27.571.08
p-Value 0.2920.8250.1280.6400.4510.2000.6870.116
STB, stimbiotic; VH, villi heigh; CD, crypt depth; V, villi width. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively.
Table 10. Influence of wheat bran particle size and stimbiotic supplementation on jejunum expression of nutrient transporters in broiler chickens at day 18.
Table 10. Influence of wheat bran particle size and stimbiotic supplementation on jejunum expression of nutrient transporters in broiler chickens at day 18.
WB, g/kgSTBb0+ATGLUT-1GLUT-2GLUT-5rBATpepT-1SGLT-1SGLT-4y+ LAT1CAT2
Means for main effect of wheat bran
0 1.181.211.332.340.551.011.952.421.791.22
50 g/kg Coarse0.990.840.840.880.010.940.930.710.901.02
50 g/kg Fine0.960.730.941.070.030.990.920.890.901.84
Pooled SEM 0.1330.2090.1940.6780.2440.1040.4890.8790.4830.579
p-Value 0.5220.2950.2440.4010.3980.8910.3120.4030.3950.630
Means for main effect of STB
−0.930.850.830.980.320.910.940.840.940.99
+1.151.021.251.800.011.051.611.811.441.73
Pooled SEM 0.1090.1710.1590.5530.1990.0850.3990.7180.3940.473
p-ValueSTB0.2240.5980.1020.3430.2980.3320.3110.3870.4070.315
Means for interaction effects
0−1.001.001.001.001.001.001.001.001.001.00
50 g/kg Coarse−1.000.880.710.810.010.750.840.470.820.82
50 g/kg Fine−0.800.690.791.140.061.000.981.111.001.13
0+1.361.401.623.340.021.022.783.652.481.41
50 g/kg Coarse+0.970.790.960.960.011.121.020.990.991.21
50 g/kg Fine+1.100.781.110.990.010.990.850.690.792.55
Pooled SEM 0.1880.2960.2750.9580.3450.1470.6921.2430.6820.818
p-Value 0.6270.7390.7950.4140.4150.4280.3730.4790.4550.801
b0+AT, solute carrier family 7-member 9; GLUT-1, glucose tranporter-1; GLUT-2, glucose transporter-2; GLUT-5, glucose transporter-5; rBAT, solute carrier family member 3; pepT-1 – peptide transporter-1; y+ LAT1: Na+-dependent cationic amino acid transporter; SGLT-1: Na–glucose transporter-1; SGLT-4: Na–glucose transporter-4; CAT2: cationic amino acid transporter 2. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively.
Table 11. Influence of wheat bran particle size and stimbiotic supplementation on jejunum expression of nutrient transporters in broiler chickens at day 42.
Table 11. Influence of wheat bran particle size and stimbiotic supplementation on jejunum expression of nutrient transporters in broiler chickens at day 42.
WB, g/kgSTBb0+ATGLUT-1GLUT-2GLUT-5rBATpepT-1SGLT-1 SGLT-4y+LAT1CAT2
Means for main effect of wheat bran
0 0.991.040.980.861.021.021.051.041.090.92
50 g/kg Coarse 0.891.000.860.831.091.421.121.061.120.82
50 g/kg Fine 0.950.940.940.740.971.381.011.171.120.83
Pooled SEM 0.0930.1030.0690.0660.0690.1330.0780.0940.0790.114
p-Value 0.7790.7980.4960.5710.5920.1250.7420.6490.9900.755
Means for main effect of STB
−0.990.970.930.851.011.200.991.071.090.83
+0.901.010.920.771.031.341.121.111.120.89
Pooled SEM 0.0760.0840.0560.0540.0570.1080.0630.0760.0650.093
p-ValueSTB0.4540.7460.9640.4180.8080.4210.1510.7850.8380.677
Means for interaction effects
0−1.001.001.001.001.001.001.001.001.001.00
50 g/kg Coarse−0.890.990.810.711.021.270.931.071.080.59
50 g/kg Fine−1.070.920.970.791.021.331.031.161.210.87
0+0.981.080.960.691.041.041.111.091.200.84
50 g/kg Coarse+0.891.000.900.911.141.541.281.051.141.00
50 g/kg Fine+0.840.960.910.690.921.411.001.181.020.80
Pooled SEM 0.1320.1450.0980.0940.0980.1880.1100.1320.1120.161
p-Value 0.6750.9720.7510.0570.6130.8370.2820.9340.2560.222
b0+AT, solute carrier family 7-member 9; GLUT-1, glucose tranporter-1; GLUT-2, glucose transporter-2; GLUT-5, glucose transporter-5; rBAT, solute carrier family member 3; pepT-1:y+ LAT1, Na+-dependent cationic amino acid transporter/peptide transporter-1; SGLT-1, Na–glucose transporter-1; SGLT-4, Na–glucose transporter-4; CAT2, cationic amino acid transporter 2. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively.
Table 12. Influence of wheat bran particle size and stimbiotic supplementation on cecal short-chain fatty acids concentration (mM) in broiler chickens on day 18.
Table 12. Influence of wheat bran particle size and stimbiotic supplementation on cecal short-chain fatty acids concentration (mM) in broiler chickens on day 18.
WB, g/kgSTBAcetatePropionateIsobutyrateButyrateIsovalerateValerateTotal SCFAsTotal BCFAs
Means for main effect of wheat bran
0 60.54.981.00 a11.570.851.0380.61.89 a
50 g/kg Coarse58.14.710.79 b11.630.731.0678.61.52 b
50 g/kg Fine 57.54.880.84 b12.030.780.9076.21.67 b
Pooled SEM 3.2450.3480.0490.9870.0440.0554.40.093
p-Value 0.8130.8740.0150.9700.2080.1620.7890.046
Means for main effect of STB
−58.85.210.9310.960.841.0579.01.76
+58.84.520.8312.430.730.9478.11.62
Pooled SEM 2.6500.2840.0400.8060.0360.0453.5720.076
p-Value 0.9420.0850.0860.2200.0810.1300.9080.238
Means for interaction effects
0−60.45.490.9810.700.821.1080.6 ab1.78
50 g/kg Coarse−64.25.410.8912.590.831.1988.1 a1.72
50 g/kg Fine−51.54.770.919.580.870.8568.2 b1.78
0+60.74.471.0112.330.880.9580.5 ab1.97
50 g/kg Coarse+52.74.020.6910.780.630.9270.4 ab1.32
50 g/kg Fine+63.65.000.7814.170.710.9684.2 ab1.57
Pooled SEM 4.5900.4910.0691.3960.0620.0786.1870.132
p-Value 0.0620.2510.2560.0990.1120.0650.0450.096
STB, stimbiotic; SCFA, short-chain fatty acids; BCFA, branched-chain fatty acids. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively. a,b Means in a column, within a group, with different superscripts are significantly different (p < 0.05).
Table 13. Influence of wheat bran particle size and stimbiotic supplementation on cecal short-chain fatty acids concentration (mM) in broiler chickens on day 42.
Table 13. Influence of wheat bran particle size and stimbiotic supplementation on cecal short-chain fatty acids concentration (mM) in broiler chickens on day 42.
WB, g/kgSTBAcetatePropionateIsobutyrateButyrateIsovalerateValerateTotal SCFAsTotal BCFAs
Means for main effect of wheat bran
0 89.54.580.4321.50.331.051140.76
50 g/kg Coarse 84.14.150.4219.70.331.041100.71
50 g/kg Fine 84.54.080.3819.50.320.861100.67
Pooled SEM 4.20.3830.0581.3710.0470.0754.9390.107
p-Value 0.6110.6240.7630.4820.9580.1920.8370.807
Means for main effect of STB
−86.144.520.4821.240.361.051140.80
+86.054.020.3519.210.290.911090.63
Pooled SEM 3.4630.3130.0471.1200.0380.0614.0330.087
p-Value 0.9630.2720.0860.1890.2350.0990.3950.193
Means for interaction effects
0−92.824.770.5323.380.371.171230.90
50 g/kg Coarse−79.354.750.4819.330.391.131050.77
50 g/kg Fine−86.264.040.4221.020.330.881120.75
0+86.194.380.3619.680.290.911040.65
50 g/kg Coarse+88.753.550.3720.030.280.951140.65
50 g/kg Fine+82.804.130.3317.500.310.841080.60
Pooled SEM 5.9990.5420.0821.9390.0660.1066.9850.151
p-Value 0.3800.4970.9060.4550.8000.6450.1530.915
STB, stimbiotic; SCFAs, short-chain fatty acids; BCFAs, branched-chain fatty acids. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively.
Table 14. Influence of wheat bran particle size and stimbiotic supplementation on marker-corrected ileal digesta hexose and pentose oligosaccharides (μg/100g DM intake) on day 42 of age of the broiler chickens.
Table 14. Influence of wheat bran particle size and stimbiotic supplementation on marker-corrected ileal digesta hexose and pentose oligosaccharides (μg/100g DM intake) on day 42 of age of the broiler chickens.
WB, g/kgSTB(Hex)3 (Hex)4 (Hex)5 (Hex)6(Pent)3(Pent)4(Pent)5
Means for main effects of wheat bran
0 409123321825 b582028
50 g/kg Coarse 662130325174 ab663445
50 g/kg Fine 4831240244112 a1192330
Pooled SEM 10626848.016.218.86.127.57
p-Value 0.2540.9690.8740.0070.1090.3170.272
Means for main effect of STB
−544121024870562040
+4931294228771013028
Pooled SEM 86.221939.213.315.45.006.18
p-Value 0.7150.8320.7130.9780.0970.2410.209
Means for interaction effects
0−266129615828.726.715.532.6
50 g/kg Coarse−806136433488.479.632.654.8
50 g/kg Fine−55798125193.266.832.534.7
0+532116927021.880.933.636.9
50 g/kg Coarse+539125916761.255.534.536.3
50 g/kg Fine+410143323712916329.738.2
Pooled SEM 14937967.923.026.68.6510.7
p-Value 0.2550.7330.2090.4570.1620.7610.903
STB, stimbiotic; SCFAs, short-chain fatty acids; BCFAs, branched-chain fatty acids. n = 16, 24, and 6 for the main effect means of WB, STB, and interaction effect means, respectively. a,b Means in a column, within a group, with different superscripts are significantly different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Veluri, S.; Bedford, M.R.; Gonzalez-Ortiz, G.; Olukosi, O.A. Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals 2024, 14, 2685. https://doi.org/10.3390/ani14182685

AMA Style

Veluri S, Bedford MR, Gonzalez-Ortiz G, Olukosi OA. Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals. 2024; 14(18):2685. https://doi.org/10.3390/ani14182685

Chicago/Turabian Style

Veluri, Shravani, Mike R. Bedford, Gemma Gonzalez-Ortiz, and Oluyinka Abiona Olukosi. 2024. "Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers" Animals 14, no. 18: 2685. https://doi.org/10.3390/ani14182685

APA Style

Veluri, S., Bedford, M. R., Gonzalez-Ortiz, G., & Olukosi, O. A. (2024). Interaction of Wheat Bran Particle Size and Stimbiotic Supplementation on Growth Performance and Gut Health Parameters in Broilers. Animals, 14(18), 2685. https://doi.org/10.3390/ani14182685

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop