Rapamycin Increases the Development Competence of Yak (Bos grunniens) Oocytes by Promoting Autophagy via Upregulating 17β-Estradiol and HIF-1α During In Vitro Maturation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Antibodies
2.2. Collection of Yak COCs
2.3. Yak COCs In Vitro Maturation and Rap, G15, and PX-478 Treatment
2.4. Assessment of the Maturation Rate of Oocytes
2.5. Parthenogenetic Activation and Embryo Culture
2.6. Determination of Estradiol by ELISA
2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.8. Western Blot Analysis
2.9. Immunofluorescence Staining
2.10. Statistical Analyses
3. Results
3.1. Rap Enhanced the Developmental Competence of Yak OOCYTES
3.2. Inhibiting the Endogenous E2 or HIF-1α Affects the Developmental Competence of Oocytes
3.3. Rap Promotes the Level of E2 During Yak COC IVM
3.4. Rap Increased the Expression of HIF-1α During Yak COC IVM
3.5. Rap-Induced Autophagy in Mature COCs and Early Embryos
3.6. Inhibiting the Endogenous E2 Activity Downregulates HIF-1α and Autophagy
3.7. Inhibiting the Levels of HIF-1α Results in Reduced E2 Synthesis and Autophagy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Duan, J.; Chen, H.; Xu, D.; Li, Y.; Li, X.; Cheng, J.; Hua, R.; Zhang, Z.; Yang, L.; Li, Q. 17β-estradiol improves the developmental ability, inhibits reactive oxygen species levels and apoptosis of porcine oocytes by regulating autophagy events. J. Steroid Biochem. Mol. Biol. 2021, 209, 105826. [Google Scholar] [CrossRef] [PubMed]
- Makita, M.; Miyano, T. Steroid hormones promote bovine oocyte growth and connection with granulosa cells. Theriogenology 2014, 82, 605–612. [Google Scholar] [CrossRef] [PubMed]
- Morikawa, R.; Lee, J.; Miyano, T. Effects of oocyte-derived growth factors on the growth of porcine oocytes and oocyte-cumulus cell complexes in vitro. J. Reprod. Dev. 2021, 67, 273–281. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Hua, R.; Ma, J.; Zhou, Y.; Li, P.; Xu, X.; Yu, Z.; Quan, S. Bisphenol A promotes autophagy in ovarian granulosa cells by inducing AMPK/mTOR/ULK1 signalling pathway. Environ. Int. 2021, 147, 106298. [Google Scholar] [CrossRef]
- Kordowitzki, P.; Hamdi, M.; Derevyanko, A.; Rizos, D.; Blasco, M. The effect of rapamycin on bovine oocyte maturation success and metaphase telomere length maintenance. Aging 2020, 12, 7576–7584. [Google Scholar] [CrossRef]
- Mizushima, N.; Komatsu, M. Autophagy: Renovation of cells and tissues. Cell 2011, 147, 728–741. [Google Scholar] [CrossRef]
- Shao, T.; Ke, H.; Liu, R.; Xu, L.; Han, S.; Zhang, X.; Dang, Y.; Jiao, X.; Li, W.; Chen, Z.J.; et al. Autophagy regulates differentiation of ovarian granulosa cells through degradation of WT1. Autophagy 2022, 18, 1864–1878. [Google Scholar] [CrossRef]
- Ravanan, P.; Srikumar, I.F.; Talwar, P. Autophagy: The spotlight for cellular stress responses. Life Sci. 2017, 188, 53–67. [Google Scholar] [CrossRef]
- Li, Q.; Ni, Y.; Zhang, L.; Jiang, R.; Xu, J.; Yang, H.; Hu, Y.; Qiu, J.; Pu, L.; Tang, J.; et al. HIF-1α-induced expression of m6A reader YTHDF1 drives hypoxia-induced autophagy and malignancy of hepatocellular carcinoma by promoting ATG2A and ATG14 translation. Signal Transduct. Target. Ther. 2021, 6, 76. [Google Scholar] [CrossRef]
- Shen, X.; Zhang, N.; Wang, Z.; Bai, G.; Zheng, Z.; Gu, Y.; Wu, Y.; Liu, H.; Zhou, D.; Lei, L. Induction of autophagy improves embryo viability in cloned mouse embryos. Sci. Rep. 2015, 5, 17829. [Google Scholar] [CrossRef]
- Duan, J.; Chen, H.; Li, Y.; Xu, D.; Li, X.; Zhang, Z.; Cheng, J.; Yang, L.; Li, Q. 17β-Estradiol Enhances Porcine Meiosis Resumption from Autophagy-Induced Gap Junction Intercellular Communications and Connexin 43 Phosphorylation via the MEK/ERK Signaling Pathway. J. Agric. Food Chem. 2021, 69, 11847–11855. [Google Scholar] [CrossRef]
- Shen, Q.; Liu, Y.; Li, H.; Zhang, L. Effect of mitophagy in oocytes and granulosa cells on oocyte quality†. Biol. Reprod. 2021, 104, 294–304. [Google Scholar] [CrossRef] [PubMed]
- Almond, P.S.; Moss, A.; Nakhleh, R.E.; Melin, M.; Chen, S.; Salazar, A.; Shirabe, K.; Matas, A.J. Rapamycin: Immunosuppression, hyporesponsiveness, and side effects in a porcine renal allograft model. Transplantation 1993, 56, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Tao, Z.S.; Lu, H.L.; Ma, N.F.; Zhang, R.T.; Li, Y.; Yang, M.; Xu, H.G. Rapamycin could increase the effects of melatonin against age-dependent bone loss. Z. Gerontol. Geriatr. 2020, 53, 671–678. [Google Scholar] [CrossRef]
- Yang, Q.; Xi, Q.; Wang, M.; Long, R.; Hu, J.; Li, Z.; Ren, X.; Zhu, L.; Jin, L. Rapamycin improves the quality and developmental competence of mice oocytes by promoting DNA damage repair during in vitro maturation. Reprod. Biol. Endocrinol. 2022, 20, 67. [Google Scholar] [CrossRef]
- Long, X.; Müller, F.; Avruch, J. TOR action in mammalian cells and in Caenorhabditis elegans. Curr. Top. Microbiol. Immunol. 2004, 279, 115–138. [Google Scholar] [CrossRef]
- Kusch, A.; Schmidt, M.; Gürgen, D.; Postpieszala, D.; Catar, R.; Hegner, B.; Davidson, M.M.; Mahmoodzadeh, S.; Dragun, D. 17ß-Estradiol regulates mTORC2 sensitivity to rapamycin in adaptive cardiac remodeling. PLoS ONE 2015, 10, e0123385. [Google Scholar] [CrossRef]
- Guo, Z.; Chen, X.; Feng, P.; Yu, Q. Short-term rapamycin administration elevated testosterone levels and exacerbated reproductive disorder in dehydroepiandrosterone-induced polycystic ovary syndrome mice. J. Ovarian Res. 2021, 14, 64. [Google Scholar] [CrossRef]
- Ravikumar, B.; Vacher, C.; Berger, Z.; Davies, J.E.; Luo, S.; Oroz, L.G.; Scaravilli, F.; Easton, D.F.; Duden, R.; O‘Kane, C.J.; et al. Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat. Genet. 2004, 36, 585–595. [Google Scholar] [CrossRef]
- Luo, D.; Ren, H.; Li, T.; Lian, K.; Lin, D. Rapamycin reduces severity of senile osteoporosis by activating osteocyte autophagy. Osteoporos. Int. 2016, 27, 1093–1101. [Google Scholar] [CrossRef]
- Lee, J.; Park, J.I.; Yun, J.I.; Lee, Y.; Yong, H.; Lee, S.T.; Park, C.K.; Hyun, S.H.; Lee, G.S.; Lee, E. Rapamycin treatment during in vitro maturation of oocytes improves embryonic development after parthenogenesis and somatic cell nuclear transfer in pigs. J. Vet. Sci. 2015, 16, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Yu, Y.; Han, X.; He, H.; Luo, Y.; Yu, S.; Cui, Y.; Xu, G.; Wang, L.; Pan, Y. The expression of hypoxia-inducible factor-1 alpha in primary reproductive organs of the female yak (Bos grunniens) at different reproductive stages. Reprod. Domest. Anim. 2020, 55, 1371–1382. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.J.; Li, F.D. Profiles of plasma progesterone before and at the onset of puberty in yak heifers. Anim. Reprod. Sci. 2001, 65, 67–73. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Zhang, H.; Pan, Y.; Zhang, T.; Yang, S.; Liu, M.; Robert, N.; Wang, J.; Zhao, T.; Zhao, L.; et al. Low oxygen concentration improves yak oocyte maturation and inhibits apoptosis through HIF-1 and VEGF. Reprod. Domest. Anim. 2022, 57, 381–392. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Wang, M.; Wang, L.; Zhang, Q.; Baloch, A.R.; He, H.; Xu, G.; Soomro, J.; Cui, Y.; Yu, S. Estrogen improves the development of yak (Bos grunniens) oocytes by targeting cumulus expansion and levels of oocyte-secreted factors during in vitro maturation. PLoS ONE 2020, 15, e0239151. [Google Scholar] [CrossRef]
- Mukundan, H.; Kanagy, N.L.; Resta, T.C. 17-beta estradiol attenuates hypoxic induction of HIF-1alpha and erythropoietin in Hep3B cells. J. Cardiovasc. Pharmacol. 2004, 44, 93–100. [Google Scholar] [CrossRef]
- Shi, S.; Zhou, X.; Li, J.; Zhang, L.; Hu, Y.; Li, Y.; Yang, G.; Chu, G. MiR-214-3p promotes proliferation and inhibits estradiol synthesis in porcine granulosa cells. J. Anim. Sci. Biotechnol. 2020, 11, 94. [Google Scholar] [CrossRef]
- Wu, G.; Li, C.; Tao, J.; Liu, Z.; Li, X.; Zang, Z.; Fu, C.; Wei, J.; Yang, Y.; Zhu, Q.; et al. FSH mediates estradiol synthesis in hypoxic granulosa cells by activating glycolytic metabolism through the HIF-1α-AMPK-GLUT1 signaling pathway. J. Biol. Chem. 2022, 298, 101830. [Google Scholar] [CrossRef]
- Al-Omar, Z.; Ozbakir, B.; Tulay, P. Differential expression of genes involved in steroidogenesis pathway in human oocytes obtained from patients with polycystic ovaries. J. Reprod. Immunol. 2020, 142, 103191. [Google Scholar] [CrossRef]
- Frump, A.L.; Selej, M.; Wood, J.A.; Albrecht, M.; Yakubov, B.; Petrache, I.; Lahm, T. Hypoxia Upregulates Estrogen Receptor β in Pulmonary Artery Endothelial Cells in a HIF-1α-Dependent Manner. Am. J. Respir. Cell Mol. Biol. 2018, 59, 114–126. [Google Scholar] [CrossRef]
- Zhang, H.; Wei, Q.; Gao, Z.; Ma, C.; Yang, Z.; Zhao, H.; Liu, C.; Liu, J.; Zhao, X.; Ma, B. G protein-coupled receptor 30 mediates meiosis resumption and gap junction communications downregulation in goat cumulus-oocyte complexes by 17β-estradiol. J. Steroid Biochem. Mol. Biol. 2019, 187, 58–67. [Google Scholar] [CrossRef] [PubMed]
- Palayoor, S.T.; Mitchell, J.B.; Cerna, D.; Degraff, W.; John-Aryankalayil, M.; Coleman, C.N. PX-478, an inhibitor of hypoxia-inducible factor-1alpha, enhances radiosensitivity of prostate carcinoma cells. Int. J. Cancer 2008, 123, 2430–2437. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Lee, S.E.; Hwang, K.C.; Sun, S.C.; Xu, Y.N.; Kim, N.H. Modulation of autophagy influences development and apoptosis in mouse embryos developing in vitro. Mol. Reprod. Dev. 2011, 78, 498–509. [Google Scholar] [CrossRef]
- Li, J.; Balboula, A.Z.; Aboelenain, M.; Fujii, T.; Moriyasu, S.; Bai, H.; Kawahara, M.; Takahashi, M. Effect of autophagy induction and cathepsin B inhibition on developmental competence of poor quality bovine oocytes. J. Reprod. Dev. 2020, 66, 83–91. [Google Scholar] [CrossRef]
- Krisher, R.L. The effect of oocyte quality on development. J. Anim. Sci. 2004, 82 (Suppl. E), E14–E23. [Google Scholar]
- Hale, B.J.; Li, Y.; Adur, M.K.; Keating, A.F.; Baumgard, L.H.; Ross, J.W. Characterization of the effects of heat stress on autophagy induction in the pig oocyte. Reprod. Biol. Endocrinol. 2021, 19, 107. [Google Scholar] [CrossRef]
- Latorraca, L.B.; Feitosa, W.B.; Mariano, C.; Moura, M.T.; Fontes, P.K.; Nogueira, M.F.G.; Paula-Lopes, F.F. Autophagy is a pro-survival adaptive response to heat shock in bovine cumulus-oocyte complexes. Sci. Rep. 2020, 10, 13711. [Google Scholar] [CrossRef]
- Tsukamoto, S.; Kuma, A.; Mizushima, N. The role of autophagy during the oocyte-to-embryo transition. Autophagy 2008, 4, 1076–1078. [Google Scholar] [CrossRef]
- Santos, R.X.; Cardoso, S.; Correia, S.; Carvalho, C.; Santos, M.S.; Moreira, P.I. Targeting autophagy in the brain: A promising approach? Cent. Nerv. Syst. Agents Med. Chem. 2010, 10, 158–168. [Google Scholar] [CrossRef]
- Singha, U.K.; Jiang, Y.; Yu, S.; Luo, M.; Lu, Y.; Zhang, J.; Xiao, G. Rapamycin inhibits osteoblast proliferation and differentiation in MC3T3-E1 cells and primary mouse bone marrow stromal cells. J. Cell. Biochem. 2008, 103, 434–446. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Ye, S. Rapamycin improves insulin resistance and hepatic steatosis in type 2 diabetes rats through activation of autophagy. Cell Biol. Int. 2018, 42, 1282–1291. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.H.; Wang, Y.L.; Wang, H.J.; Wu, J.H.; Tan, Y.Z. Rapamycin-Preactivated Autophagy Enhances Survival and Differentiation of Mesenchymal Stem Cells After Transplantation into Infarcted Myocardium. Stem Cell Rev. Rep. 2020, 16, 344–356. [Google Scholar] [CrossRef] [PubMed]
- Chaurasiya, V.; Kumari, S.; Onteru, S.K.; Singh, D. miR-326 down-regulate CYP19A1 expression and estradiol-17b production in buffalo granulosa cells through CREB and C/EBP-β. J. Steroid Biochem. Mol. Biol. 2020, 199, 105608. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Xu, Z. Lipoxin A4 inhibits the development of endometriosis in a mouse model by suppressing local estradiol synthesis. Prostaglandins Other Lipid Mediat. 2021, 153, 106521. [Google Scholar] [CrossRef]
- Kogasaka, Y.; Hoshino, Y.; Hiradate, Y.; Tanemura, K.; Sato, E. Distribution and association of mTOR with its cofactors, raptor and rictor, in cumulus cells and oocytes during meiotic maturation in mice. Mol. Reprod. Dev. 2013, 80, 334–348. [Google Scholar] [CrossRef]
- Wang, T.; Babayev, E.; Jiang, Z.; Li, G.; Zhang, M.; Esencan, E.; Horvath, T.; Seli, E. Mitochondrial unfolded protein response gene Clpp is required to maintain ovarian follicular reserve during aging, for oocyte competence, and development of pre-implantation embryos. Aging Cell 2018, 17, e12784. [Google Scholar] [CrossRef]
- Ballesteros-Álvarez, J.; Andersen, J.K. mTORC2: The other mTOR in autophagy regulation. Aging Cell 2021, 20, e13431. [Google Scholar] [CrossRef]
- Lu, N.; Li, X.; Tan, R.; An, J.; Cai, Z.; Hu, X.; Wang, F.; Wang, H.; Lu, C.; Lu, H. HIF-1α/Beclin1-Mediated Autophagy Is Involved in Neuroprotection Induced by Hypoxic Preconditioning. J. Mol. Neurosci. 2018, 66, 238–250. [Google Scholar] [CrossRef]
- Song, H.; Chen, X.; Jiao, Q.; Qiu, Z.; Shen, C.; Zhang, G.; Sun, Z.; Zhang, H.; Luo, Q.Y. HIF-1α-Mediated Telomerase Reverse Transcriptase Activation Inducing Autophagy Through Mammalian Target of Rapamycin Promotes Papillary Thyroid Carcinoma Progression During Hypoxia Stress. Thyroid 2021, 31, 233–246. [Google Scholar] [CrossRef]
- Cho, G.J.; Lee, L.H.; Lee, B.; Lee, J.; Ahn, K.H.; Hong, S.C.; Kim, H.J.; Oh, M.J. Effects of estradiol on HIF-1α expression and trophoblast differentiation in first trimester villous explant cultures. Obstet. Gynecol. Sci. 2018, 61, 71–78. [Google Scholar] [CrossRef]
Gene | Primer Sequence | Tm/°C | Amplicon Size (bp) | GenBank Accession No. |
---|---|---|---|---|
CYP11A1 | F: TTTGCCTTTGAGTCCATC | 60 | 273 | NM_176644.2 |
R: CCTAAATTCTGTTTTCCGTC | ||||
CYP17A1 | F: ATGGAAAAGATGAAGGGTT | 60 | 106 | NM_174304.2 |
R: GCAGCAAGTTAGTGATGGA | ||||
CYP19A1 | F: GTAAGCTACTGAGAGTGGAAG | 59 | 290 | NM_174305.1 |
R: GATGTATCTGTGTTGTCAGGTC | ||||
HIF-1α | F: TGAAGGCACAGATGAATTGCTT | 60 | 174 | KU353607.1 |
R: GTTCAAACTGAGTTAATCCCATGT | ||||
LC3-I | F: GTAAAGAGGTGCAGCAGATC | 60 | 143 | NM_001046175.1 |
R: GACCAACTCGCTCATGTTGAC | ||||
LC3-II | F: GTCAACATGAGTGAGCTCATC | 59 | 196 | NM_001001169.1 |
R: CGTATACCATATACAGGAATC | ||||
ATG5 | F: GATGAGATAACTGAACGCGAG | 60 | 225 | NM_001034579.2 |
R: GTTCCTTGGAAGAGCTGAACT | ||||
BECN-1 | F: CCAACAGCTTCACTCTGATTGG | 59 | 186 | NM_001033627 |
R: CAGTGACGTTGAGCTGAGTGTC | ||||
β-actin | F: CTTCAACACCCCTGCCAT | 60 | 238 | JF830811 |
R: CTCGGCTGTGGTGGTGAAG |
Treatment Groups | Total No. of Oocytes | Maturation Oocytes | Maturation Rates (% ± SEM) |
---|---|---|---|
Control | 124 | 106 | 85.48 ± 2.26 b |
0.1 nM Rap | 109 | 100 | 91.74 ± 4.65 a |
1.0 nM Rap | 128 | 117 | 91.40 ± 0.86 a |
10 nM Rap | 116 | 102 | 85.34 ± 1.58 b |
0.1 nM Rap + G15 | 126 | 95 | 75.40 ± 3.02 c |
0.1 nM Rap + PX-478 | 104 | 74 | 71.15 ± 1.80 d |
Treatment Groups | Total No. of Activated Oocyte | No. of Parthenogenetic Embryos at Different Stages | |||
---|---|---|---|---|---|
Two-to-Four Cell Embryos (%) | Four-to-Eight Cell Embryos (%) | Morula (%) | Blastocysts (%) | ||
Control | 106 | 82 (77.35 ± 0.64) b | 72 (67.92 ± 2.51) b | 60 (56.60 ± 4.52) b | 30 (28.32 ± 1.50) b |
0.1 nM Rap | 100 | 82 (82.06 ± 2.04) a | 70 (70.52 ± 3.75) a | 59 (58.95 ± 3.16) a | 32 (32.05 ± 2.84) a |
0.1 nM Rap + G15 | 95 | 64 (67.37 ± 1.05) c | 50 (52.64 ± 1.38) c | 38 (40.02 ± 0.54) c | 20 (21.15 ± 2.63) c |
0.1 nM Rap + PX-478 | 74 | 49 (66.22 ± 5.16) c | 38 (51.40 ± 2.62) d | 29 (39.18 ± 3.06) c | 15 (20.26 ± 1.86) c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.; Ma, X.; Zhang, Q.; Zhang, H.; Qiu, S.; Xu, R.; Pan, Y. Rapamycin Increases the Development Competence of Yak (Bos grunniens) Oocytes by Promoting Autophagy via Upregulating 17β-Estradiol and HIF-1α During In Vitro Maturation. Animals 2025, 15, 365. https://doi.org/10.3390/ani15030365
Wang M, Ma X, Zhang Q, Zhang H, Qiu S, Xu R, Pan Y. Rapamycin Increases the Development Competence of Yak (Bos grunniens) Oocytes by Promoting Autophagy via Upregulating 17β-Estradiol and HIF-1α During In Vitro Maturation. Animals. 2025; 15(3):365. https://doi.org/10.3390/ani15030365
Chicago/Turabian StyleWang, Meng, Xin Ma, Qian Zhang, Hui Zhang, Shantong Qiu, Ruihua Xu, and Yangyang Pan. 2025. "Rapamycin Increases the Development Competence of Yak (Bos grunniens) Oocytes by Promoting Autophagy via Upregulating 17β-Estradiol and HIF-1α During In Vitro Maturation" Animals 15, no. 3: 365. https://doi.org/10.3390/ani15030365
APA StyleWang, M., Ma, X., Zhang, Q., Zhang, H., Qiu, S., Xu, R., & Pan, Y. (2025). Rapamycin Increases the Development Competence of Yak (Bos grunniens) Oocytes by Promoting Autophagy via Upregulating 17β-Estradiol and HIF-1α During In Vitro Maturation. Animals, 15(3), 365. https://doi.org/10.3390/ani15030365