N-Acetylcysteine Counteracts Immune Dysfunction and Autism-Related Behaviors in the Shank3b Mouse Model of Autism Spectrum Disorder
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Tissue Harvesting
2.3. RNA Isolation and Quantitative RT-PCR (qRT-PCR)
2.4. Flow Cytometry
2.5. NAC Treatment and Behavioral Tests
2.6. Behavioral Tests
2.7. Open Field Test
2.8. Rotarod Test
2.9. Marble Burying Test
2.10. Three-Chamber Social Test
2.11. Thiol Determination
2.12. Statistics
3. Results
3.1. Molecules Related to Inflammation Increase in the Cerebella of Mutant Shank3b Mice
3.2. Immune Dysfunction Is Present in the Bone Marrow and Spleen of Mutant Shank3b Mice
3.3. N-Acetyl-Cysteine Improves ASD-Related Behaviors in Shank3b−/− Mice
3.4. NAC Reduces Pro-Inflammatory Impairments in the Cerebellum and Peripheral Blood of Shank3b−/− Mice
3.5. NAC Counteracts Immune Dysfunction in the Bone Marrow of Shank3b−/− Mice
3.6. NAC Boosts Pro-Inflammatory Processes in the Spleen of Shank3b−/− Mice
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, 5th ed.; American Psychiatric Publishing: Washington, DC, USA, 2013. [Google Scholar]
- Zeidan, J.; Fombonne, E.; Scorah, J.; Ibrahim, A.; Durkin, M.S.; Saxena, S.; Yusuf, A.; Shih, A.; Elsabbagh, M. Global prevalence of autism: A systematic review update. Autism Res. 2022, 15, 778–790. [Google Scholar] [CrossRef] [PubMed]
- Khachadourian, V.; Mahjani, B.; Sandin, S.; Kolevzon, A.; Buxbaum, J.D.; Reichenberg, A.; Janecka, M. Comorbidities in autism spectrum disorder and their etiologies. Transl. Psychiatry 2023, 13, 71. [Google Scholar] [CrossRef] [PubMed]
- Maenner, M.J. Prevalence and Characteristics of Autism Spectrum Disorder Among Children Aged 8 Years—Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2020. MMWR. Surveill. Summ. 2023, 72, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Chaste, P.; Leboyer, M. Autism risk factors: Genes, environment, and gene-environment interactions. Dialog. Clin. Neurosci. 2012, 14, 281–292. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.M.; Satterstrom, F.K.; Peng, M.; Brand, H.; Collins, R.L.; Dong, S.; Wamsley, B.; Klei, L.; Wang, L.; Hao, S.P.; et al. Rare coding variation provides insight into the genetic architecture and phenotypic context of autism. Nat. Genet. 2022, 54, 1320–1331. [Google Scholar] [CrossRef]
- Pangrazzi, L.; Balasco, L.; Bozzi, Y. Oxidative stress and immune system dysfunction in autism spectrum disorders. Int. J. Mol. Sci. 2020, 21, 3293. [Google Scholar] [CrossRef]
- Ashwood, P.; Krakowiak, P.; Hertz-Picciotto, I.; Hansen, R.; Pessah, I.; Van de Water, J. Elevated plasma cytokines in autism spectrum disorders provide evidence of immune dysfunction and are associated with impaired behavioral outcome. Brain Behav. Immun. 2011, 25, 40–45. [Google Scholar] [CrossRef]
- Jácome, M.C.I.; Chacòn, L.M.M.; Cuesta, H.V.; Rizo, C.M.; Santiesteban, M.W.; Hernandez, L.R.; García, E.N.; Fraguela, M.E.G.; Verdecia, C.I.F.; Hurtado, Y.V.; et al. Peripheral inflammatory markers contributing to comorbidities in autism. Behav. Sci. 2016, 6, 29. [Google Scholar] [CrossRef]
- Li, X.; Chauhan, A.; Sheikh, A.M.; Patil, S.; Chauhan, V.; Li, X.-M.; Ji, L.; Brown, T.; Malik, M. Elevated immune response in the brain of autistic patients. J. Neuroimmunol. 2009, 207, 111–116. [Google Scholar] [CrossRef]
- Vargas, D.L.; Nascimbene, C.; Krishnan, C.; Zimmerman, A.W.; Pardo, C.A. Neuroglial activation and neuroinflammation in the brain of patients with autism. Ann. Neurol. 2005, 57, 67–81. [Google Scholar] [CrossRef]
- Pangrazzi, L.; Cerilli, E.; Balasco, L.; Tobia, C.; Dall’O’, G.M.; Chelini, G.; Perini, S.; Filosi, M.; Ravizza, T.; Vezzani, A.; et al. The interplay between oxidative stress and inflammation supports autistic-related behaviors in mice. Biorxiv 2023. [Google Scholar] [CrossRef]
- James, S.J.; Melnyk, S.; Jernigan, S.; Cleves, M.A.; Halsted, C.H.; Wong, D.H.; Cutler, P.; Bock, K.; Boris, M.; Bradstreet, J.J.; et al. Metabolic endophenotype and related genotypes are associated with oxidative stress in children with autism. Am. J. Med Genet. Part B Neuropsychiatr. Genet. 2006, 141B, 947–956. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Shi, X.-J.; Liu, H.; Mao, X.; Gui, L.-N.; Wang, H.; Cheng, Y. Oxidative stress marker aberrations in children with autism spectrum disorder: A systematic review and meta-analysis of 87 studies (N = 9109). Transl. Psychiatry 2021, 11, 15. [Google Scholar] [CrossRef] [PubMed]
- Rose, S.; Melnyk, S.; Pavliv, O.; Bai, S.; Nick, T.G.; Frye, R.E.; James, S.J. Evidence of oxidative damage and inflammation associated with low glutathione redox status in the autism brain. Transl. Psychiatry 2012, 2, e134. [Google Scholar] [CrossRef]
- Liu, X.; Lin, J.; Zhang, H.; Khan, N.U.; Zhang, J.; Tang, X.; Cao, X.; Shen, L. Oxidative stress in autism spectrum disorder—Current progress of mechanisms and biomarkers. Front. Psychiatry 2022, 13, 813304. [Google Scholar] [CrossRef]
- Lee, T.-M.; Lee, K.-M.; Lee, C.-Y.; Lee, H.-C.; Tam, K.-W.; Loh, E.-W. Effectiveness of N-acetylcysteine in autism spectrum disorders: A meta-analysis of randomized controlled trials. Aust. N. Z. J. Psychiatry 2021, 55, 196–206. [Google Scholar] [CrossRef]
- Peça, J.; Feliciano, C.; Ting, J.T.; Wang, W.; Wells, M.F.; Venkatraman, T.N.; Lascola, C.D.; Fu, Z.; Feng, G. Shank3 mutant mice display autistic-like behaviours and striatal dysfunction. Nature 2011, 472, 437–442. [Google Scholar] [CrossRef]
- Balasco, L.; Pagani, M.; Pangrazzi, L.; Chelini, G.; Chama, A.G.C.; Shlosman, E.; Mattioni, L.; Galbusera, A.; Iurilli, G.; Provenzano, G.; et al. Abnormal Whisker-Dependent Behaviors and Altered Cortico-Hippocampal Connectivity in Shank3b−/− Mice. Cereb. Cortex 2022, 32, 3042–3056. [Google Scholar] [CrossRef]
- Phelan, K.; McDermid, H. The 22q13.3 Deletion Syndrome (Phelan-McDermid Syndrome). Mol. Syndr. 2012, 2, 186–201. [Google Scholar] [CrossRef]
- Pangrazzi, L.; Genovesi, S.; Balasco, L.; Cerilli, E.; Robol, C.; Zunino, G.; Piazza, S.; Provenzano, G.; Bozzi, Y. Immune dysfunction in the cerebellum of mice lacking the autism candidate gene Engrailed 2. J. Neuroimmunol. 2022, 367, 577870. [Google Scholar] [CrossRef]
- Caston, J.; Jones, N.; Stelz, T. Role of preoperative and postoperative sensorimotor training on restoration of the equilibrium behavior in adult mice following cerebellectomy. Neurobiol. Learn. Mem. 1995, 64, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Moy, S.S.; Nadler, J.J.; Perez, A.; Barbaro, R.P.; Johns, J.M.; Magnuson, T.R.; Piven, J.; Crawley, J.N. Sociability and preference for social novelty in five inbred strains: An approach to assess autistic-like behavior in mice. Genes Brain Behav. 2004, 3, 287–302. [Google Scholar] [CrossRef] [PubMed]
- Pastore, A.; Panera, N.; Mosca, A.; Caccamo, R.; Camanni, D.; Crudele, A.; De Stefanis, C.; Alterio, A.; Di Giovamberardino, G.; De Vito, R.; et al. Changes in total homocysteine and glutathione levels after laparoscopic sleeve gastrectomy in children with metabolic-associated fatty liver disease. Obes. Surg. 2021, 32, 82–89. [Google Scholar] [CrossRef]
- Hughes, C.E.; Nibbs, R.J.B. A guide to chemokines and their receptors. FEBS J. 2018, 285, 2944–2971. [Google Scholar] [CrossRef]
- Lee, E.J.; Han, J.E.; Woo, M.S.; Shin, J.A.; Park, E.M.; Kang, J.L.; Moon, P.G.; Baek, M.C.; Son, W.S.; Ko, Y.T.; et al. Matrix met-alloproteinase-8 plays a pivotal role in neuroinflammation by modulating TNF-α activation. J. Immunol. 2014, 193, 2384–2393. [Google Scholar] [CrossRef]
- Jurk, D.; Wang, C.; Miwa, S.; Maddick, M.; Korolchuk, V.; Tsolou, A.; Gonos, E.S.; Thrasivoulou, C.; Saffrey, M.J.; Cameron, K.; et al. Postmitotic neurons develop a p21-dependent senescence-like phenotype driven by a DNA damage response. Aging Cell 2012, 11, 996–1004. [Google Scholar] [CrossRef]
- Cui, G.; Hara, T.; Simmons, S.; Wagatsuma, K.; Abe, A.; Miyachi, H.; Kitano, S.; Ishii, M.; Tani-Ichi, S.; Ikuta, K. Characterization of the IL-15 niche in primary and secondary lymphoid organs in vivo. Proc. Natl. Acad. Sci. USA 2014, 111, 1915–1920. [Google Scholar] [CrossRef]
- Meryk, A.; Grasse, M.; Balasco, L.; Kapferer, W.; Grubeck-Loebenstein, B.; Pangrazzi, L. Antioxidants N-Acetylcysteine and Vitamin C Improve T Cell Commitment to Memory and Long-Term Maintenance of Immunological Memory in Old Mice. Antioxidants 2020, 9, 1152. [Google Scholar] [CrossRef]
- Ament, S.A.; Cortes-Gutierrez, M.; Herb, B.R.; Mocci, E.; Colantuoni, C.; McCarthy, M.M. A single-cell genomic atlas for matura-tion of the human cerebellum during early childhood. Sci. Transl. Med. 2023, 15, eade1283. [Google Scholar] [CrossRef]
- Peñagarikano, O.; Abrahams, B.S.; Herman, E.I.; Winden, K.D.; Gdalyahu, A.; Dong, H.; Sonnenblick, L.I.; Gruver, R.; Almajano, J.; Bragin, A.; et al. Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities, and core autism-related deficits. Cell 2011, 147, 235–246. [Google Scholar] [CrossRef]
- Wang, X.; Xu, Q.; Bey, A.L.; Lee, Y.; Jiang, Y.-H. Transcriptional and functional complexity of Shank3 provides a molecular framework to understand the phenotypic heterogeneity of SHANK3 causing autism and Shank3 mutant mice. Mol. Autism 2014, 5, 30. [Google Scholar] [CrossRef] [PubMed]
- Janova, H.; Böttcher, C.; Holtman, I.R.; Regen, T.; van Rossum, D.; Götz, A.; Ernst, A.; Fritsche, C.; Gertig, U.; Saiepour, N.; et al. CD14 is a key organizer of microglial responses to CNS infection and injury. Glia 2016, 64, 635–649. [Google Scholar] [CrossRef] [PubMed]
- Beschorner, R.; Schluesener, H.J.; Gözalan, F.; Meyermann, R.; Schwab, J.M. Infiltrating CD14+ monocytes and expression of CD14 by activated parenchymal microglia/macrophages contribute to the pool of CD14+ cells in ischemic brain lesions. J. Neuroimmunol. 2002, 126, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Banisor, I.; Leist, T.P.; Kalman, B. Involvement of β-chemokines in the development of inflammatory demyelination. J. Neuroinflammation 2005, 2, 7. [Google Scholar] [CrossRef]
- Hieshima, K.; Imai, T.; Opdenakker, G.; Van Damme, J.; Kusuda, J.; Tei, H.; Sakaki, Y.; Takatsuki, K.; Miura, R.; Yoshie, O.; et al. Molecular cloning of a novel human CC chemokine liver and activation-regulated chemokine (LARC) expressed in liv-er. Chemotactic activity for lymphocytes and gene localization on chromosome 2. J. Biol. Chem. 1997, 272, 5846–5853. [Google Scholar] [CrossRef]
- Murooka, T.T.; Rahbar, R.; Platanias, L.C.; Fish, E.N. CCL5-mediated T-cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1. Blood 2008, 111, 4892–4901. [Google Scholar] [CrossRef]
- Škuljec, J.; Sun, H.; Pul, R.; Bénardais, K.; Ragancokova, D.; Moharregh-Khiabani, D.; Kotsiari, A.; Trebst, C.; Stangel, M. CCL5 induces a pro-inflammatory profile in microglia in vitro. Cell. Immunol. 2011, 270, 164–171. [Google Scholar] [CrossRef]
- Page-McCaw, A.; Ewald, A.J.; Werb, Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat. Rev. Mol. Cell Biol. 2007, 8, 221–233. [Google Scholar] [CrossRef]
- González-Gualda, E.; Baker, A.G.; Fruk, L.; Muñoz-Espín, D. A guide to assessing cellular senescence in vitro and in vivo. FEBS J. 2021, 288, 56–80. [Google Scholar] [CrossRef]
- Lai, C.-C.; Baskaran, R.; Tsao, C.-Y.; Tuan, L.-H.; Siow, P.-F.; Palani, M.; Lee, L.J.-H.; Liu, C.-M.; Hwu, H.-G.; Lee, L.-J. Chronic N-Acetylcysteine Treatment Prevents Amphetamine-Induced Hyperactivity in Heterozygous Disc1 Mutant Mice, a Putative Prodromal Schizophrenia Animal Model. Int. J. Mol. Sci. 2022, 23, 9419. [Google Scholar] [CrossRef]
- Dhamne, S.C.; Silverman, J.L.; Super, C.E.; Lammers, S.H.T.; Hameed, M.Q.; Modi, M.E.; Copping, N.A.; Pride, M.C.; Smith, D.G.; Rotenberg, A.; et al. Replicable in vivo physiological and behavioral phenotypes of the Shank3B null mutant mouse model of autism. Mol. Autism 2017, 8, 26. [Google Scholar] [CrossRef] [PubMed]
- Villanueva, C.; Kross, R.D. Antioxidant-Induced Stress. Int. J. Mol. Sci. 2012, 13, 2091–2109. [Google Scholar] [CrossRef] [PubMed]
- Dündar, Y.; Aslan, R. Antioxidative stress. East. J. Med. 2000, 5, 45–47. [Google Scholar]
- Kannan, N.; Nguyen, L.V.; Makarem, M.; Dong, Y.; Shih, K.; Eirew, P.; Raouf, A.; Emerman, J.T.; Eaves, C.J. Glutathione-dependent and -independent oxidative stress-control mechanisms distinguish normal human mammary epithelial cell subsets. Proc. Natl. Acad. Sci. USA 2014, 111, 7789–7794. [Google Scholar] [CrossRef]
- Lewis, S.M.; Williams, A.; Eisenbarth, S.C. Structure and function of the immune system in the spleen. Sci. Immunol. 2019, 4, eaau6085. [Google Scholar] [CrossRef]
Target Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
TNF 21926 | CAAAATTCGAGTGACAAGCC | TGTCTTTGAGATCCATGCCG |
IFNγ 15978 | CCCTATGGAGATGACGGAGA | CTGTCTGCTGGTGGAGTTCA |
IL-6 16193 | GCCTTCTTGGGACTGATGCT | GACAGGTCTGTTGGGAGTGG |
IL-1β 16176 | ACGGACCCCAAAAGATGAAG | TTCTCCACAGCCACAATGAG |
CCL3 20302 | TGAAACCAGCAGCCTTTGCT | AGGCATTCAGTTCCAGGTCAGTG |
CCL5 20304 | AGAATACATCAACTATTTGGAGA | CCTTGCATCTGAAATTTTAATGA |
CCL20 20297 | CTTGCTTTGGCATGGGTACT | TCAGCGCACACAGATTTTCT |
MMP8 17394 | AATCCTTGCCCATGCCTTTCAACC | CCAAATTCATGAGCAGCCACGAGA |
p21(CDKN1A) 12575 | GACAAGAGGCCCAGTACTTC | GCTTGGAGTGATAGAAATCTGTC |
IL-15 16168 | ATCCATCTCGTGCTACTTGTGTT | CATCTATCCAGTTGGCCTCTGTTT |
SOD3 20657 | CCAGCTTCGACCTAGCAGACA | CAGCGTGGCTGATGGTTGTA |
β actin 11461 | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Antigen | Fluorochrome | Company | Clone |
---|---|---|---|
CD3 | APC-Vio770 | Miltenyi; Cologne, Germany | REA641 |
CD8 | PerCp | Biolegend, San Diego, CA, USA | 53–6.7 |
CD4 | VioGreen | Miltenyi Cologne, Germany | REA1211 |
CD14 | Pecy7 | Biolegend, San Diego, CA, USA | Sa14–2 |
TNF | PE | Biolegend, San Diego, CA, USA | MP6-XT22 |
IFNγ | FITC | Miltenyi Cologne, Germany | REA638 |
IL-6 | APC | Biolegend, San Diego, CA, USA | MP5-20F3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pangrazzi, L.; Cerilli, E.; Balasco, L.; Dall’O’, G.M.; Chelini, G.; Pastore, A.; Weinberger, B.; Bozzi, Y. N-Acetylcysteine Counteracts Immune Dysfunction and Autism-Related Behaviors in the Shank3b Mouse Model of Autism Spectrum Disorder. Antioxidants 2024, 13, 1390. https://doi.org/10.3390/antiox13111390
Pangrazzi L, Cerilli E, Balasco L, Dall’O’ GM, Chelini G, Pastore A, Weinberger B, Bozzi Y. N-Acetylcysteine Counteracts Immune Dysfunction and Autism-Related Behaviors in the Shank3b Mouse Model of Autism Spectrum Disorder. Antioxidants. 2024; 13(11):1390. https://doi.org/10.3390/antiox13111390
Chicago/Turabian StylePangrazzi, Luca, Enrica Cerilli, Luigi Balasco, Ginevra Matilde Dall’O’, Gabriele Chelini, Anna Pastore, Birgit Weinberger, and Yuri Bozzi. 2024. "N-Acetylcysteine Counteracts Immune Dysfunction and Autism-Related Behaviors in the Shank3b Mouse Model of Autism Spectrum Disorder" Antioxidants 13, no. 11: 1390. https://doi.org/10.3390/antiox13111390
APA StylePangrazzi, L., Cerilli, E., Balasco, L., Dall’O’, G. M., Chelini, G., Pastore, A., Weinberger, B., & Bozzi, Y. (2024). N-Acetylcysteine Counteracts Immune Dysfunction and Autism-Related Behaviors in the Shank3b Mouse Model of Autism Spectrum Disorder. Antioxidants, 13(11), 1390. https://doi.org/10.3390/antiox13111390