Bacillus velezensis TCS001 Enhances the Resistance of Hickory to Phytophthora cinnamomi and Reshapes the Rhizosphere Microbial Community

Abstract

Phytophthora cinnamomi causes significant root rot in hickory, leading to substantial yield losses. While Bacillus spp. are recognized as beneficial rhizosphere microorganisms, their application against hickory root rot and their impact on rhizosphere microbial communities remain under-investigated. This study demonstrated that Bacillus velezensis TCS001 significantly inhibited P. cinnamomi ST402 growth in vitro, and achieved 71% efficacy in root rot disease management. Scanning electron microscopy (SEM) revealed that TCS001 fermentation filtrate induced mycelial deformities in P. cinnamomi. An analysis of α and β diversity indicated a significant impact of TCS001 on rhizosphere bacterial community richness and diversity, with minimal effects on the fungal community. Moreover, TCS001 altered the hickory rhizosphere microbiome co-occurrence network. The differential abundance analysis suggests that TCS001 promotes the recruitment of beneficial microbes associated with disease resistance, thereby suppressing disease development. These findings underscore the influence of TCS001 on the hickory rhizosphere microbiome in the presence of pathogens, providing valuable data for future research and the development of effective biocontrol strategies for hickory root rot.

1. Introduction

Hickory (Carya cathayensis) is a common nutritional nut produced from a deciduous tree with feathered compound leaves and nuts, belonging to the Juglandaceae family, and it widely grows in the Zhejiang and Anhui provinces of China [1]. Currently, more than 15,000 ha of hickory are cultivated in Zhejiang Province, China, providing income to local farmers and conferring ecological protection in the mountainous areas of eastern China. However, traditional cultivation practices, such as monoculture, over-fertilization, and excessive herbicide application, have resulted in significant phytosanitary issues [2]. Recently, dieback disease caused by Phytophthora cinnamomi has posed a serious threat to hickory cultivation. A distinction was made between soilborne Phytophthora species, which primarily cause fine root losses, root and collar rots, and bleeding bark cankers, and airborne Phytophthora species, which are responsible for leaf necrosis, shoot blights, and fruit rot, as well as bleeding bark cankers, depending on whether their lifecycle occurs mainly above or below ground [3]. Dieback disease caused by P. cinnamomi broke out in multiple orchards across Linan County, China’s main production area [4]. The hickory leaves turn to yellow, wilt, and eventually fall off, leading to the death of the plants.

P. cinnamomi is a soil-borne pathogen whose life cycle consists of both sexual and asexual stages. It can grow saprophytically on dead organic matter and can also parasitize susceptible hosts. Typically, the pathogen infects fine lateral roots, but it can also invade woody stems, particularly through wounds or natural fractures in the epidermis. Growth within the root system can lead to root rot, disrupting water absorption and transport to the branches, resulting in wilting and yellowing of the leaves. Plants may die rapidly or survive for many years, but symptoms of the disease often do not appear. The ability of P. cinnamomi to grow saprophytically in soil or asymptomatically in infected plants is a key factor in its long-term survival. The affected plants exhibited necrotic symptoms on the same side of the basal stem as the defoliated leaves, resulting in significant crop loss and severely impacting the income of local farmers and environmental safety.

The rhizosphere microbiome confers numerous benefits to plants, including enhanced nutrient acquisition, stress tolerance, and disease suppression [5,6]. Plant-associated microbes are increasingly recognized for their crucial role in disease resistance [7,8,9]. This influence is mediated through mechanisms such as microbial competition and antagonism toward pathogens [10,11,12], and the recruitment of beneficial microbes to enhance root colonization and mitigate pathogen attacks [13]. Growing interest in rhizosphere microbial communities reflects the increasing emphasis on ecological agriculture and sustainable development. Among beneficial bacteria, Bacillus velezensis has emerged as a key research subject due to its significant impact on plant health and disease resistance [14,15]. The robust spore-forming capability of B. velezensis ensures survival in diverse environments, while its production of various metabolites, including antibiotics and antifungal compounds, contributes to enhanced plant disease resistance [16,17]. Although the biocontrol potential and plant-growth-promoting effects of Bacillus spp. are well documented, the impact of B. velezensis on hickory dieback disease and its effects on the rhizosphere microbiome remain unexplored.

Microbial inoculants exert their influence not only directly on host plants, but also indirectly, by modulating the composition of the soil microbiome, thereby fostering the proliferation of advantageous microbes and contributing to disease suppression and growth enhancement. In this study, we verified the antifungal effect of B. velezensis TCS001 against the pathogen Phytophthora cinnamomi ST402 by treating hickory plants with TCS001. We also analyzed the impact of TCS001 on the microbial community in the rhizosphere of hickory through high-throughput sequencing of the rhizosphere soil, providing valuable insights for the future development of biocontrol agents against pathogens like Phytophthora in important forestry crops, such as hickory.

2. Materials and Methods

2.1. Plant Materials, Pathogen, and Soil Selection

Hickory seedlings were cultivated in a greenhouse with 24 °C day/night temperatures for 16 h/d with 80% relative humidity in the greenhouse. Bacillus velezensis TCS001 was isolated and identified in our laboratory (CGMCC No. 8921).

Phytophthora cinnamomi ST402 (obtained from Prof. Yongjun Wang, Zhejiang Agriculture and Forestry University), was used in this study. Phytophthora cinnamomi ST402 was cultured on V8 agar (3 g/L CaCO₃, 100 mL/L V8′s 100% vegetable juice, 20 g/L agar) at 25 °C in the dark. Mycelial growth and phenotypic changes were assessed on V8 agar plates after seven days.

After streaking the strain B. velezensis TCS001 on LB agar and incubating for 48 h, a single colony was selected and inoculated into 80 mL of MLB seed medium (7 g/L peptone, 2 g/L yeast extract, 6 g/L NaCl, 2 g/L glucose, 0.06 g/L KCl, 0.5 g/L MgCl₂·6H₂O) and incubated at 27 °C and 145 rpm for 16 h. This seed culture was subsequently used as a 3% inoculum for a lipopeptide production medium (10.5 g/L soluble starch, 18.5 g/L peanut meal, 3 g/L NaCl, 32% v/v, pH 7.0), and incubated at 31 °C and 164 rpm for 48 h. The resulting fermentation broth was centrifuged (7830 rpm, 4 °C, 30 min) and then filter-sterilized (0.22 µm filter) four times using a sterile syringe and filter membrane to obtain the supernatant.

The supernatant was incorporated into molten potato dextrose agar (PDA) at a temperature range of 45–50 °C, achieving a final concentration of 20% (v/v). A mycelial plug, measuring 5 mm in diameter, from each pathogenic strain was positioned at the center of PDA plates containing the bacterial filtrate. These plates were then incubated at 25 °C for a period of five days. For comparison, control plates were prepared without the addition of the bacterial filtrate. Each experimental condition was replicated three times to ensure reliability. The inhibitory effect was quantified using the following formula: y = (A − B)/A × 100% (A: growth radius of pathogen in control and B: growth radius of pathogen in different treatments).

To control for soil heterogeneity, a mixture of autoclaved nutrient substrate and air-dried soil (<4 mm) was used. Uniform Carya seedlings had their roots washed with sterile water before being transplanted into 0.5 L pots filled with sterilized soil substrate. One week post-transplantation, the control group (CK) received sterile water, while the treatment group (T6) received root irrigation with a B. velezensis TCS001 suspension (1 × 10⁶ CFU/mL). The irrigation volume for both sterile water and TCS001 suspension was 200 mL. After a further week, both groups were inoculated with P. cinnamomi. The spore irrigation inoculation method was used to inoculate Phytophthora cinnamomi. Phytophthora cinnamomi V8 plates, cultured in the dark at 22 °C for 3–5 days, were soaked in 500 mL of ddH₂O. The water was replaced every 12 h to promote sporangium formation. Sterilized toothpicks were used to scrape the hyphae from the V8 medium containing sporangia into 500 mL of ddH₂O, which served as the irrigation solution. Each pot of hickory was inoculated by irrigating with 200 mL of the spore suspension. Disease Incidence = number of infected plants/total number of plants × 100%.

The seedlings were cultivated in a greenhouse with regulated environmental parameters, including a temperature of 24 °C, a 16 h light cycle, and 80% relative humidity. They were irrigated using sterile double-distilled water (ddH₂O). The watering strategy was to maintain the surface soil of the pots in a moist condition. Rhizosphere soil samples were collected 45 days after inoculation with Phytophthora cinnamomi. Following the meticulous removal of surface soil, the plants were delicately uprooted. Any soil clinging to the roots was subsequently cleared using a sterilized brush. The rhizosphere soil samples were placed into 50 mL polypropylene tubes, rapidly frozen using liquid nitrogen, and then preserved at −80 °C. Each experimental condition included three biological replicates, with five plants pooled for each replicate (Figure 1).

2.2. DNA Extraction, PCR Amplification, and High-Throughput Sequencing

Genomic DNA was extracted from six soil samples using the E.Z.N.A.^® Soil DNA Kit (Omega Bio-tek, Guangzhou, China), following the manufacturer’s protocol. DNA quality and concentration were determined via 1% agarose gel electrophoresis and NanoDrop^® ND-2000 spectrophotometry (Thermo Scientific, Wilmington, NC, USA) before storage at −80 °C. Bacterial 16S rDNA and fungal ITS rDNA amplicons were generated using the primer pairs (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′), and for the ITS rDNA gene, the amplification was conducted with the primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4-R (TCCTCCGCTTATTGATATGC), with an ABI GeneAmp^® 9700 PCR thermocycler (Thermo Fisher Scientific, Eugene, OR USA). Each 20 µL PCR reaction contained 4 µL of 5× Fast Pfu buffer, 2 µL of 2.5 mM dNTPs, 0.8 µL of each primer (5 µM), 0.4 µL of Fast Pfu polymerase, 10 ng of template DNA, and ddH₂O. Thermal cycling conditions were as follows: 95 °C for 3 min, followed by 27 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s, with a final extension at 72 °C for 10 min and a 4 °C hold. All samples were amplified in triplicate. PCR products were gel-extracted (2% agarose) using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Hangzhou, China) and quantified using a Quantus™ Fluorometer (Promega, Beijing, China).

The purified amplicons were sequenced on the Illumina NovaSeq PE250 platform by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) using standard protocols. Raw data were deposited in the NCBI Sequence Read Archive (SRA).

2.3. Data Processing and Bioinformatics Analysis

The raw FASTQ files were demultiplexed employing a custom Perl script developed in-house. Quality filtering and merging of paired-end reads were performed using fastp v0.19.6 and FLASH v1.2.7, respectively, applying the following criteria: (i) reads were trimmed at average quality scores <20 over a 50 bp sliding window, and those <50 bp were discarded, along with reads containing ambiguous bases; (ii) overlapping sequences ≥10 bp with a maximum mismatch ratio of 0.2 in the overlap region were merged; (iii) samples were demultiplexed based on barcode and primer sequences (exact barcode match, ≤2 nucleotide primer mismatches). Operational taxonomic units (OTUs) were derived from the analyzed sequences using UPARSE v7.1 [18,19], with a 97% sequence similarity threshold. The most frequently occurring sequence in each OTU was selected as its representative. To normalize sequencing depth, the 16S rRNA gene sequences were rarefied to 44,980 reads, and the ITS rDNA sequences to 84,995 reads, resulting in an average Good’s coverage of 99.09%.

Taxonomic classification of OTU representative sequences was performed using RDP Classifier v2.2 against the SILVA database (v138.1 for bacteria) and UNITE database (v138.1 for fungi), with a confidence threshold of 0.7. The metagenome’s functional potential was predicted using PICRUSt2 (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) [20]. The analysis utilized its integrated pipeline, which includes HMMER for sequence alignment, EPA-NG and Gappa for phylogenetic placement, castor for 16S gene copy normalization, and MinPath for predicting gene families and pathways. All steps adhered to the standard PICRUSt2 protocol.

Bioinformatic analysis of the soil microbiota was carried out using the Majorbio Cloud platform (https://cloud.majorbio.com). Based on the OTUs information, rarefaction curves and alpha diversity indices, including observed OTUs, Chao1 richness, Shannon index, and Good’s coverage, were calculated with Mothur v1.30.1 [21]. The similarity among the microbial communities in different samples was determined by principal coordinate analysis (PCoA) based on Bray–Curtis dissimilarity using Vegan v2.5-3 package. The Welch t-test was used to calculate the significance of the differences between the two treatments using STAMP. The variations in the relative abundance of OTUs across different treatments were analyzed using likelihood ratio tests within the “EdgeR” package. A Manhattan plot was created utilizing the “ggplot2” package for visualization purposes.

2.4. Co-Occurrence Network Analysis

Co-occurrence networks for bacterial and fungal communities in control (CK) and treatment (T6) groups were constructed to investigate changes in microbial community interactions. Networks were generated using R (v4.3.1) based on Spearman correlation coefficients; only significant (p < 0.05) correlations with |R| > 0.6 were included [22]. Network visualization employed a Fruchterman–Reingold layout in Gephi.

2.5. Scanning Electron Microscopy (TEM) Observation

Fresh mycelia of P. cinnamomi ST402 on V8, treated with TCS001 fermentation filtrate, were collected and carefully fixed in 2.5% glutaraldehyde in phosphate buffer for at least 4 h. Samples were then processed and imaged via transmission electron microscopy (Hitachi H-7650) at Zhejiang University.

3. Results

3.1. The Biocontrol Effect of TCS001 on Hickory Diseases

Bacillus velezensis TCS001 and Phytophthora cinnamomi ST402 were used to assess biocontrol efficacy. A dual-culture assay demonstrated significant inhibition of P. cinnamomi ST402 growth by TCS001 (Figure 2A). Further, in planta experiments (Figure 1) showed that root irrigation with TCS001 (treatment T6) significantly reduced disease incidence (63%) in the presence of P. cinnamomi ST402, compared to the uninoculated control (CK), at over 86.5% (Figure 2B). The diseased leaves turn yellow and their roots rot, becoming black (Figure 2C). These findings demonstrated the effective biocontrol of P. cinnamomi ST402-induced hickory disease by TCS001 (Figure 2C,D and Figure S1).

3.2. The Effect of TCS001 Fermentation Filtrate on the Growth of Phytophthora Cinnamomi

The antifungal activity of different concentrations of the TCS001 fermentation filtrate against P. cinnamomi ST402 was evaluated on a V8 medium (Figure 3A). As shown in Figure 3, different concentrations of fermentation filtrate have varying inhibitory effects on the pathogen P. cinnamomi ST402, with values of 68%, 49%, and 36%, respectively (Figure 3B). Additionally, the optimal treatment condition for the TCS001 fermentation filtrate was determined to be a liquid-to-water dilution ratio of 1:5. The results indicated that TCS001 fermentation filtrate can inhibit the development growth of Phytophthora cinnamomi.

3.3. Scanning Electron Microscopy (SEM) Observation of Hyphae Cultured on a Medium Diluted Fivefold with Fermentation Filtrate

Scanning electron microscopy (SEM) was used to examine P. cinnamomi ST402 hyphae grown on a V8 medium containing a fivefold dilution of TCS001 fermentation filtrate. The control hyphae exhibited smooth surfaces (Figure 4A), while the hyphae treated with TCS001 filtrate showed breakage, twisting, and deformation (Figure 4B). These findings indicated that the TCS001 fermentation filtrate altered the P. cinnamomi ST402 hyphal morphology.

3.4. Characterization of Amplicon Sequencing Datasets

To examine the influence of B. velezensis TCS001 on the hickory rhizosphere microbiome, high-throughput sequencing was conducted on six rhizosphere soil samples. Rarefaction curves for both 16S rRNA and ITS gene amplicons indicated sufficient sequencing depth to capture community diversity (Figure S1). A total of 379,897 high-quality 16S rRNA sequences (59,430–69,804 per sample; average length 412.40 bp) and 559,998 high-quality ITS sequences (85,193–97,923 per sample; average length 241.52 bp) were obtained (Table S1). Taxonomic assignment was performed using SILVA (bacteria) and UNITE (fungi) databases with a 97% similarity threshold, employing a Bayesian classifier and BLAST. This resulted in 1283 bacterial and 522 fungal OTUs, representing 35 bacterial and 15 fungal phyla, respectively. A further analysis focused on OTUs with a relative abundance >0.05%, yielding 401 bacterial and 474 fungal OTUs. These data were used to assess the effects of TCS001 on the hickory rhizosphere microbiome.

3.5. CK and T6 Have Significantly Different Rhizosphere Microbial Communities

To characterize the effects of TCS001 on the changes in the rhizosphere microbial communities of hickory after inoculation with pathogenic fungi P. cinnamomi, the α diversity of the fungal and bacterial communities was analyzed using the Chao1 index and Shannon index. Our analyses showed that after inoculation with P. cinnamomi, TCS001 had a significant impact on the diversity and richness of the hickory bacterial community (p < 0.05), but it did not have a significant effect on the fungal community (Figure 5 and Figure 6). The bacterial Chao1 index and Shannon index in the CK were significantly higher than those in the rhizosphere soil treated with TCS001 (p < 0.05) (Figure 5A,B). For the fungal community, the Chao index of the CK group rhizosphere soil was lower than that of the T6 group, while the Shannon index showed the opposite trend, although this change was not significant (p > 0.05) (Figure 6A). Furthermore, a principal coordinate analysis (PCoA) based on Bray–Curtis distance further revealed significant differences in the rhizosphere microbial communities of hickory due to TCS001 (Figure 6B). We found that samples inoculated with pathogenic fungi P. cinnamomi could be distinguished from those inoculated with the pathogenic fungi P. cinnamomi and TCS001 in bacterial communities (Figure 5C), while in fungal communities, the six samples clustered together and could not be distinguished (Figure 6C). This result, combined with the Chao and Shannon index results, indicated that TCS001 significantly affects the composition of the rhizosphere bacterial community.

We further assessed the relative abundance of bacteria at both the phylum and genus levels. The composition of the bacterial community was examined at these taxonomic levels. Proteobacteria, Actinobacteriota, and Acidobacteriota were the dominant phyla in both control (CK) and treatment (T6) groups (Figure 5D; Table S2), with similar relative abundances, as follows: Proteobacteria (CK: 26.04%; T6: 25.36%), Actinobacteriota (CK: 23.28%; T6: 22.12%), and Acidobacteriota (CK: 15.81%; T6: 14.98%). At the genus level, the Welch’s t test revealed significant differences (p < 0.05) in the relative abundance of ten genera between CK and T6 (Figure 5E). Seven genera showed significantly increased abundance in T6 compared to CK (Figure 5E), including Acidothermus, Sphingomonas, and Bacillus (increases of 2.40%, 1.39%, and 0.45%, respectively; Table S2).

In the fungal community, Ascomycota and Basidiomycota were the dominant phyla in both control (CK) and treatment (T6) groups (Figure 6D; Table S2), with similar relative abundances, a follows: Ascomycota (CK: 61.52%; T6: 61.89%) and Basidiomycota (CK: 26.30%; T6: 26.10%). While Ascomycota showed a slightly higher relative abundance in T6, this difference was not statistically significant (p > 0.05). At the genus level, five fungal genera showed significant differences between CK and T6 (Figure 6E). Unclassified Sordariomycetes, Conlarium, Arthrinium, and Hawksworthiomyces exhibited significantly higher relative abundances in CK (increases of 0.47%, 0.02%, 0.08%, and 0.04%, respectively; Figure 6E; Table S2), while Entrophospora showed a significantly higher relative abundance in T6 (0.02% increase). These results indicate that TCS001 modifies the structure of bacterial and fungal communities within the hickory rhizosphere.

3.6. Specific Differences in Rhizosphere Soil Microbiomes

To further characterize microbial community shifts, we compared the OTU abundance between the control (CK; pathogen-inoculated) and treatment (T6; pathogen and TCS001-inoculated) hickory rhizosphere samples using Manhattan and scatter plots. Significantly differentially abundant OTU values were identified (p < 0.05; Figure 7A,B; Tables S4 and S5): 144 bacterial OTUs and 81 fungal OTUs. These belonged to 20 bacterial phyla (Table S3), with Proteobacteria (33 OTUs), Chloroflexi (25 OTUs), and Acidobacteriota (15 OTUs) showing the most significant differences. The 81 differentially abundant fungal OTUs represented six known phyla and one unclassified phylum (Table S3), with Ascomycota (39 OTUs), Basidiomycota (17 OTUs), and unclassified fungi (16 OTUs) exhibiting the greatest differences (Table S4). T6 showed enrichment of 72 bacterial and 48 fungal OTUs compared to the CK (Tables S3 and S4), while the top 10 differentially abundant OTUs included more fungi than bacteria (32 vs. 16; Figure 7C,D), suggesting that bacteria may harbor more low-abundance differentially abundant OTUs. Notably, the potential pathogen Aspergillus (OTU1300) was significantly less abundant in T6 (Table S4), while beneficial bacteria such as Sphingomonas (OTU3182) and Bacillus (OTU2812) were enriched in T6 (Table S3). These results indicate that co-inoculation with TCS001 promotes the recruitment of beneficial microbes in the rhizosphere in response to pathogen challenge.

3.7. Characterization of the Rhizosphere Microbiome Co-Occurrence Networks

To investigate the effect of TCS001 on hickory rhizosphere microbial co-occurrence networks, bacterial and fungal networks were constructed (Figure 8). We analyzed the proportion of the fungal and bacterial network graphs at the phylum level. In the bacterial co-occurrence network, compared with CK, the proportions of Actinobacteriota, Chloroflexi, Gemmatimonadota, Firmicutes, Myxococcota, and WPS-2 increased in the T6 group. Similarly, in the fungal network, after inoculating TCS001, the proportion of five fungal phyla (unclassified fungi, Chytridiomycota, Kickxellomycota, Rozellomycota, and Glomeromycota) increased, and the ranking of eight bacterial phyla and seven fungal phyla also underwent changes (Figure 8A,C, Table S5).

We also analyzed the topology of the co-occurrence networks. The control (CK) bacterial network comprised 377 nodes and 9440 edges, while the fungal network comprised 299 nodes and 3182 edges (Table S6). Following TCS001 inoculation (T6), the bacterial network had 367 nodes and 6371 edges, and the fungal network had 437 nodes and 6444 edges (Table S6). These changes suggest stronger connectivity within the CK bacterial network compared to the T6 bacterial network, and the opposite trend for the fungal networks. The T6 bacterial network displayed a higher proportion of positive edges (CK: 52.87%; T6: 56.34%) and the T6 fungal network exhibited a higher average degree (CK: 21.28; T6: 29.49; Figure 8C, Table S6). Both bacterial and fungal networks showed reduced density following TCS001 inoculation (bacterial: CK 0.138, T6 0.094; fungal: CK 0.071, T6 0.068; Table S6). We also found that after inoculation with the antagonistic bacterium TCS001, the modularity of the bacterial network became more concentrated. In the bacterial network, the CK group had five modules, the T6 group had four modules, and the fungal network was exactly the opposite of the bacterial network (Figure 8B,D). These findings demonstrate that TCS001 application alters the structure of the rhizosphere microbial network.

4. Discussion

Members of the genus Bacillus are widely recognized for their potential as biocontrol agents due to their robust growth, stable physicochemical properties, and broad antimicrobial spectrum [23]. Numerous studies have demonstrated the plant-growth-promoting and disease-suppressing capabilities of various Bacillus strains, highlighting their versatility in different agricultural systems. For instance, Bacillus amyloliquefaciens FZB42 and FZB24 have been extensively studied for their ability to suppress diseases in potatoes [24], cotton [25], strawberries [26], wheat [27], lettuce [28], and tomatoes [29]. These strains produce a variety of secondary metabolites, including lipopeptides and polyketides, which exhibit strong antifungal and antibacterial activities, thereby protecting plants from soilborne pathogens [16,17]. Similarly, Bacillus velezensis AP-3 has been shown to enhance salt stress tolerance in tomatoes by modulating the plant’s antioxidant defense system and improving nutrient uptake [30]. In another study, Bacillus velezensis K-9 demonstrated significant efficacy against potato scab, a disease caused by Streptomyces scabies, by producing antimicrobial compounds that inhibit pathogen growth [31]. Furthermore, Bacillus velezensis VJH504 has been reported to control cucumber Fusarium wilting by inducing systemic resistance in the plant and altering the rhizosphere microbiome to favor beneficial microbes [23]. This study further demonstrates the efficacy of Bacillus velezensis TCS001 against Phytophthora cinnamomi, the causal agent of hickory root rot, through both plate confrontation and pot experiments. The findings align with previous research on Bacillus species, reinforcing their potential as biocontrol agents in diverse agricultural systems.

Phytophthora cinnamomi infection primarily occurs via the active movement of biflagellate zoospores, although mycelial growth also contributes to disease spread [32]. Zoospores are chemotactically attracted to the root elongation zone, preferentially settling in grooves above anticlinal epidermal cell walls. At high densities, zoospores exhibit self-aggregation and clustering, influenced by chemotaxis and bioconvection. Attachment to the root surface is mediated by the 250 kDa adhesive protein PcVsv1 [33], secreted from ventral vesicles. Subsequent penetration and colonization involve the action of various plant-cell-wall-degrading enzymes [34]. Following attachment, mycelial growth proceeds through the root cortex, both inter- and intracellularly, ultimately reaching the vascular bundle. Xylem blockage by the mycelium disrupts water transport, leading to water stress and plant death.

Bacillus species offer a promising biocontrol strategy by interfering with multiple stages of Phytophthora infection [10,11]. Studies have shown that Bacillus amyloliquefaciens can inhibit Phytophthora zoospore germination and motility, limiting their ability to infect host plants [12]. In this study, Bacillus velezensis TCS001 likely disrupts P. cinnamomi infection by producing antifungal metabolites that inhibit zoospore germination and hyphal growth, as evidenced by SEM observations of deformed hyphae. TCS001 may also enhance the plant’s innate immune response, reducing susceptibility to P. cinnamomi infection, aligning with previous research on Bacillus species’ ability to combat soilborne pathogens.

Microbial inoculants, including Bacillus spp., can enhance beneficial rhizosphere microbial communities, such as Flavobacterium, Pseudomonas, Agrobacterium, and Lysobacter, while suppressing soilborne pathogens [13,35]. Bacillus spp. promote rhizobial colonization, enhance the abundance of Flavobacterium johnsoniae, and stimulate local Pseudomonas populations, contributing to disease suppression [36,37,38]. For example, B. velezensis SQR9 increases the relative abundance of Pseudomonas, Bacillus, and Lysobacter, synergistically promoting plant growth with native Pseudomonas stutzeri [39]. This study shows that TCS001 application increases the relative abundance of Sphingomonas, a genus consistently enriched in healthy plants, including ginger [40] and disease-resistant tomatoes [41]. In rice, Sphingomonas melonis enhances resistance to Burkholderia plantarii [42]. These findings suggest that TCS001 may suppress P. cinnamomi infection by promoting Sphingomonas enrichment in the rhizosphere. Additionally, recent research has demonstrated that Bacillus-mediated changes in the rhizosphere microbiome can lead to long-term disease suppression by enhancing the abundance of antagonistic microbes and improving plant immune responses [39,43].

The fungal community in the hickory rhizosphere showed minimal changes in response to Bacillus velezensis TCS001 treatment. Certain fungal taxa, such as Aspergillus, exhibited reduced abundance in the TCS001-treated rhizosphere, indicating that TCS001 may indirectly suppress some fungal pathogens by promoting beneficial bacteria that compete with or antagonize these fungi [40,41]. Additionally, the increased connectivity and modularity of the bacterial co-occurrence network in TCS001-treated soils may create a more resilient microbial environment that limits the establishment of fungal pathogens [44,45]. While the overall fungal community remained relatively stable, the specific reduction in potential fungal pathogens suggests that TCS001 could still play a role in managing fungal diseases, albeit indirectly, through its impact on the rhizosphere microbiome. Recent studies have highlighted the critical role of microbial modulations in plant stress responses, particularly under conditions such as drought, salinity, and pathogen attack [46,47,48].

This study investigated the impact of B. velezensis TCS001 on the structure of bacterial and fungal co-occurrence networks in the hickory rhizosphere to elucidate its mechanism of action against environmental perturbations. Meanwhile, the inhibitory effect of TCS001 fermentation products on P. cinnamomi suggests their potential as a biocontrol agent for hickory root rot. Higher average degree and network density indicate increased sensitivity to environmental change, while high connectivity provides functional redundancy [49]. Network effectiveness was assessed using average degree and network density [43] by comparing co-occurrence networks with and without TCS001 inoculation. The bacterial community exhibited higher average degree and network density than the fungal community, particularly before inoculation, indicating a more robust network structure. This aligns with previous findings, such as the disease-suppressing effects of B. velezensis ZN-S10 against tomato bacterial necrosis [50], highlighting the importance of antagonistic bacteria in shaping soil microbial community structure. The increased bacterial connectivity provides functional redundancy, enhancing resilience to pathogen infection. TCS001 inoculation thus altered the rhizosphere microbial network structure and enhanced disease resistance, offering valuable insights for future research.

5. Conclusions

In summary, our study suggests that TCS001 enhances the recruitment of beneficial microbes associated with disease resistance, thereby inhibiting disease development. These results highlight that TCS001 restructures the rhizosphere microbial community in the presence of P. cinnamomi, offering critical insights for future studies and the advancement of effective biocontrol approaches to combat hickory root rot.