Next Article in Journal
Acinetobacter baumannii under Acidic Conditions Induces Colistin Resistance through PmrAB Activation and Lipid A Modification
Next Article in Special Issue
Effect of Group Housing of Preweaned Dairy Calves: Health and Fecal Commensal Antimicrobial Resistance Outcomes
Previous Article in Journal
Safety Profile of Medicines Used for the Treatment of Drug-Resistant Tuberculosis: A Descriptive Study Based on the WHO Database (VigiBase®)
Previous Article in Special Issue
Genetic Organization of Acquired Antimicrobial Resistance Genes and Detection of Resistance-Mediating Mutations in a Gallibacterium anatis Isolate from a Calf Suffering from a Respiratory Tract Infection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Co-Occurrence of mcr-1 and Carbapenem Resistance in Avian Pathogenic E. coli Serogroup O78 ST95 from Colibacillosis-Infected Broiler Chickens

1
Institute of Microbiology, Government College University Faisalabad, Faisalabad 38000, Pakistan
2
Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650093, China
*
Authors to whom correspondence should be addressed.
Antibiotics 2023, 12(5), 812; https://doi.org/10.3390/antibiotics12050812
Submission received: 9 March 2023 / Revised: 31 March 2023 / Accepted: 11 April 2023 / Published: 26 April 2023
(This article belongs to the Special Issue Antibiotic Resistance in Companion and Food-Producing Animals)

Abstract

:
Avian pathogenic Escherichia coli (APEC) is responsible for significant economic losses in the poultry industry. This study aimed to molecularly detect carbapenem-resistant co-harboring mcr-1 avian pathogenic E. coli in broiler chickens infected with colibacillosis. A total of 750 samples were collected from colibacillosis-infected broilers, and conventional microbiological techniques were used to isolate and identify APEC. MALDI-TOF and virulence-associated genes (VAGs) were used for further identification. Phenotypic carbapenem resistance profiling was followed by molecular detection of carbapenem resistance genes (CRGs) and other resistance genes through PCR using specific primers. Isolates were also subjected to PCR for O typing, followed by allele-specific PCR to detect sequence type (ST) 95. Results showed that 154 (37%) isolates were confirmed as APEC, with 13 (8.4%) isolates found to be carbapenem-resistant (CR)-APEC. Among CR-APEC isolates, 5 (38%) were observed to co-harbor mcr-1. All CR-APEC showed the presence of five markers (ompT, hylF, iutA, iroN, and iss) APEC VAGs, and 89% of CR-APEC isolates displayed O78 type. Furthermore, 7 (54%) CR-APEC isolates were observed with ST95, all displaying O78 type. These results suggest that the improper use of antibiotics in poultry production systems is contributing to the emergence of pathogens such as CR-APEC co-harboring the mcr-1 gene.

1. Introduction

Antibiotic resistance is a global health concern, and the use of antibiotics in food animals is a leading contributing factor to this problem. Due to the high price of mutton, chicken meat is a popular alternative source of animal protein. However, the inappropriate use of antibiotics to treat infectious diseases and promote growth in poultry flocks is a common practice in developing countries, particularly in Pakistan. As a result, the misuse of antibiotics creates selection pressure and leads to the emergence of resistant poultry pathogens. These pathogens not only cause significant production and economic losses but are also associated with public health diseases [1].
Antibiotics are commonly used in livestock to maintain animal health, promote growth, and increase production. However, reports from Pakistan indicate a very high consumption of antibiotics in the broiler production system. Moreover, it has been projected that global antibiotic consumption will rise by 67% by 2030 [2]. Concerningly, most of the antibiotics used in broiler production systems in Pakistan are classified as critically important antimicrobials (CIA) by the World Health Organization (WHO) [3]. This excessive use of antibiotics hinders the control of diseases and accelerates the emergence of resistant bacteria that cause severe infections in poultry, such as colibacillosis.
Avian pathogenic Escherichia coli (APEC) is the causative agent of avian colibacillosis, which is associated with high morbidity and mortality rates, resulting in significant economic losses for the poultry industry worldwide. APEC’s virulence is attributed to various combinations of virulence-associated genes (VAGs) that encode for adhesins, iron scavenging, serum resistance, toxins, and more [4]. Five virulence genes, including ompT, hylF, iutA, ironN, and iss, are located on the ColV plasmid in APEC. APEC shares VAGs-relatedness with the extra-intestinal, pathogenic E. coli, which can infect humans [5]. Therefore, APEC could pose a potential public health concern, as well as a zoonotic risk [6]. Moreover, food-borne uropathogenic E. coli ST95 and ST131 are emerging strains among poultry, and they are listed as strains that can be transmitted among food-producing animals and humans [7].
Escherichia coli has a robust population structure that can be described by different sequence types (STs) based on phylogenetic subgroups. APEC primarily belongs to ST 95, which is listed in group B2 subgroup IX [8]. Multi-locus sequence typing (MLST) is typically used to delineate the subgroups of this pathogen [9]. However, MLST can be expensive and time consuming. In recent times, new and efficient molecular typing tools have been developed and validated. One such tool is allele-specific PCR, which has shown reliable efficacy in detecting STs related to various subgroups of E. coli. This technique has replaced various epidemiologic analyses. It appears that some of these subgroups are found preferentially in various extra-intestinal pathologies [10].
Poultry is a vital industry in Southeast Asia, with notable exports of poultry products coming from countries in the region. However, infectious diseases such as colibacillosis have a significant economic impact on this industry. While several studies have been reported from different parts of the region in the recent past [4,11,12], there is limited data on mcr-1-producing APEC in broilers infected with colibacillosis, particularly co-harboring carbapenem-resistance determinants and associated sequence type (ST). In this study, we report the first molecular detection of carbapenem-resistant, co-harboring mcr-1 APEC, along with ST and O type, among colibacillosis-infected broilers.

2. Results

2.1. CR-APEC O78 among Collected Samples

Overall, from collected samples, 418 (55.7%) were positive for E. coli, and among them, 154 (37%) were confirmed as APEC. The highest distribution of APEC was found in fecal samples, i.e., 47% followed by perihepatic and pericardial swabs at 31% and 28%, respectively (Table 1). Among APEC, a total of 13 (8.4%) were found to be CR-APEC. Likewise, various sample sources showed the same pattern in the case of CR-APEC, the highest (10%) distribution was observed in the case of fecal samples, while perihepatic swabs and pericardial swabs showed a 7% and 6% rate of CR-APEC, respectively. Subsequent to the phenotypic confirmation, VAGs and MALDI-TOF-based validation of the isolates was performed, and findings revealed that all 154 (100%) were confirmed APEC (Table 1).
Overall, 9 (69%) CR-APEC isolates revealed their O types, among them 8 (89%) isolates belong to O78, which include 5 (55 %) from fecal samples, 2 (22%) from the perihepatic swab sample, and 1 (11%) from the pericardial swab sample, respectively. Only 1 (11%) CR-APEC isolate was detected with O1 serogroups among perihepatic samples. However, 4 (31%) out of 13 isolates have remained unassigned, as they were not detected positive for any of the tested O types.

2.2. Source-Wise Distribution of the mcr-1-harboring CR-APEC

Overall, a total of 61 (39.61%) isolates were observed that harbor the mcr-1 gene among confirmed APECs, while 5 (3.2%) isolates were those who were detected as CR-APEC co-harbored mcr-1. Sample-wise distribution of mcr-1-harboring CR-APEC was 7% in perihepatic swabs, followed by 3% in pericardial swabs, and 1% in fecal samples (Table 2). Moreover, O serotyping results revealed that 4 (80%) mcr-1-harboring CR-ACEP belonged to O78 and only 1 (20%) isolate was observed with O1 type, while O2 was not detected in any of the isolates (Table 2).

2.3. Detection of VAGs in APEC Isolates

The VAGs for APEC were detected in all (100%) isolates, i.e., a minimum of three VAGs were present in each of the isolates. Overall, the 28 (18%) isolates showed the presence of all studied VAGs, and 43 (28%) isolates were considered positive for eight VAGs. In addition to that, five VAGs were detected in 56 (36%) isolates, followed by four VAGs in 24 (16%) and three VAGs in 3 (2%) APEC isolates, respectively. In the case of five marker genes, i.e., ompT, hylF, iutA, ironN, and iss, these all were detected in 127 (82%) APEC isolates. Moreover, all CR-APEC (n = 13) showed the presence of five marker APEC VAGs. In addition to the marker genes, iucD was the most common VAG among CR-APEC, followed by astA and tsh, whereas papC and cvi were observed in 6 (46%) CR-APEC isolates (Figure 1).

2.4. Resistance Profile of the Isolates

Resistance profiling of APEC revealed that all 154 (100%) APEC isolates were found to be resistant to ampicillin and cefepime, followed by 137 (89%) to chloramphenicol, 125 (81%) to tetracycline, 101 (65%) to trimethoprim, 84 (54%) to ciprofloxacin, and 72 (46%) to colistin, respectively. Additionally, phenotypic resistance profiling of the isolates through CNPt showed that a total of 18 (11%) APEC isolates were confirmed as CR-APEC and found to be resistant to meropenem, whereas only 4 (2.5%) APEC isolates were found resistant to tigecycline, and among them 2 isolates were mcr-1-harboring CR-APEC (Table 3).

2.5. Distribution of ARGs in APEC Isolates

Overall, APEC isolates were screened for various ARGs. Findings of the molecular detection revealed that the blaCTX-M was detected in 151 (98%) of the isolates, followed by the blaTEM in 114 (74%) isolates, the blaSHV in 88 (57%) isolates, the tetA & tetB in 83 (54%) isolates, the qnrA in 76 (49%) isolates, qnrB 74 (48%) isolates, and mcr-1 in 61 (39%) isolates, respectively.
Moreover, the highest detected resistance determinant among the CR-APEC isolates was blaNMD-1, which was detected in 10 (77%) isolates, which included 1 (50%) from pericardial swabs, 2 (66%) from perihepatic swabs, and 7 (87%) from fecal samples (Table 4). Conversely, the blaoxa-48 was detected in 9 (69%) isolates, which included 2 (66%) from perihepatic swabs and 7 (87%) from fecal samples. Both blaKPC and blaIMP genes were detected in 6 (46%) CR-APEC isolates, respectively (Figure 2).

2.6. CR-APEC ST95

Allele-specific PCR findings revealed that a total of 7 (54%) CR-APEC isolates were observed with an ST95 allelic profile. Among ST95, a total of 5 (71%) isolates were from fecal samples and 2 (28%) isolates were from perihepatic swabs, whereas no ST95 isolate was detected from pericardial swabs. Conversely, from mcr-1-harboring CR-APEC, a total of 3 (60%) isolates showed the allelic profile of ST95, among them 2 (66%) isolates were from perihepatic swabs and 1 (33%) isolate was from fecal samples. Furthermore, all 7 (100%) CR-APEC ST95 isolates were observed with serogroup O78.

3. Discussion

Avian colibacillosis is a leading cause of substantial economic impact on the poultry industry, especially in developing countries with average production facilities. The public health significance of APEC is now recognized and has been reported from various regions of the globe [13]. Literature-based analysis has shown that colibacillosis is an important and leading disease of poultry. The aberrant use of antibiotics to treat such infections in poultry production systems has a direct influence on the emergence and spread of resistant superbugs, such as CR-APEC. Consequently, it becomes a dire health challenge that affects the well-being, health, and economic growth of developing countries [14]. Therefore, studies that delineate the virulence and resistance determinants of APEC may help to curb the damaging economic and health impacts created by this pathogen.
The current study demonstrated the molecular detection of CR-APEC co-harboring mcr-1 along with its prevalent ST (ST95) and serogroup (O78). Overall, 37% of APEC were detected from all the collected samples from various sources, and isolates were confirmed based on VAGs. These results are comparable with already published findings from Pakistan and neighboring regions, such as Bangladesh, India, and Nepal [12,15]. However, the high rate of detection in this study may be due to the use of highly sensitive tools, including MALDI-TOF and PCR-based detection of VAGs, as well as allele-specific PCR and PCR for O typing. Furthermore, differences in geographic location, sanitary facilities, sanitation systems, and additional practices in poultry production systems may be the reason for the observed variations in the findings. It is important to note that only APEC was isolated in the present study, and other pathogenic forms of E. coli, such as uropathogenic E. coli (UPEC) or sepsis-associated E. coli (SEPEC), may also be involved in the infection [15].
Carbapenem-resistant Enterobacteriaceae (CRE) are well-documented in various parts of the world, including Asia [16]. The present study validated that 8% of confirmed avian pathogenic E. coli (APEC) were carbapenem-resistant (CR-APEC), while their detection rate was about 2% among all 750 collected samples (Table 1). In addition to different antibiotic resistance genes (ARGs), various carbapenem resistance genes (CRGs) were identified in the CR-APEC isolates, including blaNMD-1 (77%), blaoxa-48 (69%), blaKPC, and blaIMP (46%) (Figure 2). Similar findings have been reported in a recent systematic review that showed the prevalence of different CRGs among livestock, such as blaNMD-1 and its variants, blaoxa-48, blaKPC and its variants, and blaIMP. A study on different avian species also showed the presence of CRE and various CRGs, such as blaNMD-1 and blaoxa-48, along with their whole genome-based phylogroup and STs [16]. Overall, various ARGs were detected in the present investigation, and a significant correlation was observed between antibiotic resistance profiling of the isolates and distribution of ARGs. For instance, the maximum resistance among APEC was recorded for Ampicillin, and blaTEM was detected in 74% of the isolates. Similarly, 46% of the isolates were found to be resistant to colistin, and mcr-1 was detected in 39% of the resistant isolates. These results are consistent with those of Liao et al., 2019, who also found a high resistance rate and different ARGs among CRE isolated from birds [16].
The imprudent use of antibiotics as growth promoters is a traditional malpractice in poultry production systems, particularly in developing countries located in Southeast Asia [3]. This practice contributes to the emergence of antibiotic-resistant bacterial strains, such as mcr-1-harboring avian pathogenic E. coli (APEC). The present study supported this claim, as approximately 40% of the APEC isolates showed resistance against colistin, which is considered one of the last resort antibiotics for Gram-negative bacilli (GNB). Similar findings, showing almost the same colistin resistance profiling with a 39% detection rate of mcr-1 among APEC, have also been documented from Pakistan [11]. These results are consistent with recent findings reported from Brazil, which documented a high prevalence of colistin (40%) and mcr-1-harboring APEC among commercial poultry [17]. A study from Iran also showed a much higher (68%) prevalence of colistin resistance [17]. Similarly, a study from Tunisia showed a significantly high prevalence of β-lactamase-producing APEC co-harboring mcr-1 among broilers infected with colibacillosis [18]. These findings suggest that colistin resistance among poultry is persistent, particularly in developing countries, and needs to be addressed. The inappropriate use of antibiotics as growth promoters in poultry production should be banned to prevent the emergence of antibiotic-resistant bacterial strains.
This investigation examined ten VAGs and found that all APEC isolates (100%) had at least three VAGs present. The study identified that five marker genes, including ompT, hylF, iutA, ironN, and iss, were present in 82% of APEC isolates. Moreover, all CR-APEC isolates were found to have the marker VAGs. Among CR-APEC isolates, iucD was the most common VAG, while papC and cvi were observed in 46% of the CR-APEC isolates. Previous studies from Pakistan have also reported that the iss gene was the most common VAG among APEC isolated from broilers and layers, as well as in another study conducted on APEC recovered from broilers in Pakistan. [11]. These findings are consistent with studies conducted in other regions, such as Cummins et al. (2019), who reported similar VAG profiles in a diverse APEC population from Australian commercial poultry [19]. Additionally, all the detected VAGs in this study have been previously identified as key players in APEC virulence [20].
The study investigated three types of serogroups (O1, O2, and O78), with O78 being the most prevalent (89%) and only one isolate (11%) exhibiting the O1 serogroup. The selection of these serogroups was based on their reported prevalence in avian pathogenic E. coli (APEC) and the available literature [21,22]. A previous study from Pakistan also reported the detection of O78, but unlike the present study, detected O2 at a rate of 13% [11]. The present study’s findings are consistent with those reported from parts of the Middle East, Europe, and Australia, which documented the detection of O78 serogroups [1,19].
By using allele-specific PCR, the study found that 54% of CR-APEC isolates belong to ST95. ST95 is a common ST among APEC, and many studies have reported its high prevalence among E. coli isolated from various avian sources [23]. The study’s results showing a high abundance of ST95 are not surprising, as this ST is often associated with poultry diseases and has a significant economic impact due to high morbidity and mortality rates in infected birds [24]. These findings are consistent with those reported by Jørgensen et al. (2019), who also detected ST95 in APEC. ST95 has significant population diversity and can overlap hosts between avians and humans [25]. However, the current study has limitations and lacks information about the population structure and comparative genomics of CR-APEC co-harboring mcr-1 isolated from infected broiler chickens. This information may be studied in future research endeavors.
In conclusion, the study provides evidence that the excessive use of antibiotics in poultry production systems is directly linked to the emergence of resistant superbugs, such as CR-APEC co-harboring mcr-1. The high prevalence of these antibiotic-resistant strains of APEC is a significant concern and should be taken seriously. It is imperative to discourage the irresponsible use of antibiotics in poultry farming to control the spread of these pathogens. This would be a beneficial step towards safeguarding public health. Based on these findings, it is recommended that appropriate measures be taken to address this issue to prevent the further spread of antibiotic-resistant APEC strains.

4. Materials and Methods

4.1. Ethical Approval and Study Settings

The current study was carried out after proper approval from the Institutional Review Board (IRB) and Ethical Review Committee (ERC) Ref No. GCUF/ERC/273, Date: 7-09-2020, Government College University Faisalabad. All the samples were collected after permission was granted on the prescribed form shared with the owners of the poultry farms. All the experiments were conducted in the bacteriology laboratory at the Institute of Microbiology, Government College University Faisalabad. The matrix-assisted Laser Deionization-TOF experiment was conducted at the National Institutes of Health, M4QP+GW7 Islamabad, Pakistan.

4.2. Sample Collection, Preliminary Screening, and Transportation

A total of n = 750 samples were collected in sterile containers from colibacillosis-infected broilers, including pericardial swabs, perihepatic swabs, and fecal samples, 250 from each category. Samples were collected after an initial screening based on farm history, typical clinical manifestation, and colibacillosis gross lesions, e.g., perihepatitis and pericarditis observed during post-mortem examination (Figure 3A,B). Samples were enriched in 0.9% normal saline and transported at 4 °C to the bacteriology laboratory, Institute of Microbiology, Government College University Faisalabad for further investigations.

4.3. Isolation and Identification of E. coli

Streaking of enriched samples was conducted on MacConkey agar and EMB agar (OXOID®, Basingstoke, UK), and Petri plates were incubated for 24 h at 37 °C. Samples were observed for cultural (Figure 1C) and morphological characteristics. Biochemical characterization of the isolates was conducted using an API 20E kit (Biomeurex, Craponne, France) according to the manufacturer protocol.

4.4. Matrix-Assisted Laser Desorption/Ionization-Time of Flight (MALDI-TOF) Based Confirmation

The VITEK® MS V3.2 (Biomeurex, Craponne, France) was used for MALDI-TOF confirmation of the isolates, according to the configuration and procedure guide provided by the manufacturer. The E. coli ATCC™8739 was briefly taken as a test control, and a total of 0.01 μL cyanohyrodxycinamic acid (CHCA) was used as a matrix for the bacterial isolate. The VITEK® MS (Biomeurex, Craponne, France) slide was prepared by inoculating the control and the tested isolate using Vitek® PICKME NIBS (Biomeurex, Craponne, France) in their respective and targeted circles, respectively, followed by the addition of matrix e.g., CHCA. Finally, MYLA® software (Biomeurex, Craponne, France)was used to interpret the results.

4.5. VAGs-Based Confirmation of APEC

Overall, different VAGs were detected through PCR, using specific primers in addition to the marker VAGs for APEC, e.g., ompT, hylF, iutA, ironN, and iss, etc. The presence of a minimum of three APEC-specific VAGs was considered for confirmation of the isolate. For this purpose, isolates were subjected to DNA extraction using the GeneJET Genomic DNA purification kit K0722 (Thermo-Scientific™), according to the given protocol.
Subsequently, PCR (T3000, Thermo-cycler:48 Biomerta™, Göttingen, Germany) was carried out with specific conditions for VAGs, along with their respective annealing temperature given in Table 5. The reaction setup was comprised of initial denaturation of template DNA at 94 °C for 5 min, followed by 30 reaction cycles of DNA denaturation at 94 °C for 1 min, specific primer annealing for 85 s, and extension at 72 °C for 60 s. Finally, a 10 min extension was carried out at 72 °C.
The PCR reaction mixture (25 μL) contained: template DNA 5 μL, F&R primers (100 pM) 1 μL each, DreamTaq (Thermo-Scientific™, Waltham, MA, USA) 8 μL, and SuperQ water (Ambion-AM9932, Thermo-Scientific™, Waltham, MA, USA) 10 μL. For the examination of PCR amplicons, agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was carried out and visualized under a gel trans-illuminator (BioRad, Hercules, CA, USA).

4.6. Antibiotic Susceptibility Testing

The Kirby–Bauer disc diffusion assay was performed to study the antibiotic resistance profile of APEC isolates (n = 154) according to the 2021 CLSI guidelines. Antibiotics used in the study include Ampicillin, cefepime, ciprofloxacin, levofloxacin, chloramphenicol, trimethoprim, imipenem, meropenem, colistin, tetracycline, and tigecycline. During the assay, E. coli ATCC™8739 was used as quality control. The Broth microdilution method (BMD) was used to estimate the minimum inhibitory concentration (MIC) as per CLSI guidelines, while colistin and tigecycline were estimated according to the EUCAST-CLSI and FDA recommendations, respectively.

4.7. Carba NP Test (CNPt-CLSI)

Phenotypic confirmation of CR-APEC was conducted through CNPt, according to the CLSI guidelines (CLSI 2018). A total of 100 μL of Tris-HCl lysis buffer (20 mM) was briefly added in two separate Eppendorf tubes labeled 1 and 2. With the help of a sterilized platinum loop, freshly grown bacterial colonies were dispensed in each tube. Subsequently, solution A (100 μL), made up of phenol red (0.5%) and ZnSO4 (0.1 mm/L) with pH 7.8, was added in tube 1 while solution B (100 μL), which was prepared by adding imipenem (6 mg/mL) to solution A, was added in tube 2. Tubes were incubated for 2 h at 37°C. Color change in the tubes was observed and the yellow color in tube B was considered positive.

4.8. Molecular Identification of ARGs

In addition to phenotypic-resistance profiling, various ARGs (Table 5) were identified with the help of PCR using specific primers. The DNA was extracted using a Genomic DNA purification kit K0722 (Thermo-Scientific™, Waltham, MA, USA). A total of 25 μL reaction mixture for PCR was comprised of 5 μL DNA template, 10 μL Green DreamTaq mix (Thermo Fisher Scientific, Waltham, MA, USA), and F&R primers (100 pM) 1 μL each. A total of 8 μL SuperQ nuclease-free water was added to get the desired volume (25 μL). Lastly, 1.5% agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was carried out to examine the PCR products.

4.9. Serogrouping of APEC

Only CR-APEC (n = 13) were subjected to O-antigen-based serogrouping. Isolates were examined for three different and prevalent serogroups, as described previously [21], which include O1, O2, and O78. Extracted DNA was subjected to PCR using specific primers (Table 5), as described previously [21], for each of the serogroups, with thermocycler conditions as follows: a total of 25 cycles of denaturation at 94 °C for 40 s, annealing at 59 °C for 35 s, and extension at 72 °C for 60 sec. Subsequently, agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was performed and imagined under a gel transilluminator (BioRad, Hercules, CA, USA). Additionally, gene diversity was observed with respect to the O antigen and VAGs present in CR-APEC.

4.10. Allele-Specific PCR

For the identification of ST, CR-APEC (n = 13) isolates were subjected to allele-specific PCR as developed and validated previously [10]. The DNA extraction from the isolates was carried out using a Genomic DNA purification kit K0722 (Thermo-Scientific™, Waltham, MA, USA). Afterwards, DNA was quantified using NanoDrop™ (2000/2000c, Thermo-Scientific™, Waltham, MA, USA), and 250 ng/mL was used for the further PCR reaction. A total of 25 μL PCR mixture was prepared with 5 μL extracted DNA, 10 μL Green DreamTaq mix (Thermo Fisher Scientific, Waltham, MA, USA), 1 μL of F & R aesIX primers (50 pM; Table 5), and 8 μL SuperQ nuclease-free water. All the isolates were examined with the chuA gene, which served as an internal control. The PCR was conducted with conditions as follows: initial DNA denaturation for 5 min at 94 °C, followed by 30 cycles having 94 °C denaturation for 10 s, annealing at 60 °C for 30 s, and finally, extension at 72 °C for 5 min.

4.11. Statistical Analysis

The study data was arranged in a Microsoft Excel spreadsheet and subjected to statistical analysis. The chi-square test was used to determine the potential relationship of the isolates with different determinants, e.g., sample source and p-value < 0.05 was set as significant.

Author Contributions

Conceptualization, M.U. and Z.B.; methodology, M.U., M.H.R., M.K. and B.A; software, B.A.; validation, M.H.R. and M.K.; formal analysis, B.A.; investigation, M.U., M.H.R. and M.K.; resources, M.U. and Z.B.; data curation, M.K.; writing—original draft preparation, M.U., B.A. and M.H.R.; writing—review and editing, M.K. and Z.B.; visualization, B.A.; supervision, B.A. and Z.B.; project administration, B.A.; funding acquisition, B.A. and Z.B. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Yunnan major science and technology project (2019ZF004) and Pakistan Science Foundation (PSF) under project number PSF/NSLP/P-GCUF(769).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Government College University Faisalabad (Ref No. GCUF/ERC/273, Date: 7 September 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data supporting these findings is contained within the manuscript.

Acknowledgments

We thank all the veterinary doctors working in the local area for helping with sample collections and the information.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this manuscript.

References

  1. Elmanama, A.A.; Al-Reefi, M.R.; Shamali, M.A.; Hemaid, H.I. Carbapenem-resistant Gram-negative bacteria isolated from poultry samples: A cross-sectional study. Lancet 2019, 393, S21. [Google Scholar] [CrossRef]
  2. Van Boeckel, T.P.; Brower, C.; Gilbert, M.; Grenfell, B.T.; Levin, S.A.; Robinson, T.P.; Teillant, A.; Laxminarayan, R. Global trends in antimicrobial use in food animals. Proc. Natl. Acad. Sci. USA 2015, 112, 5649–5654. [Google Scholar] [CrossRef] [PubMed]
  3. Umair, M.; Tahir, M.F.; Ullah, R.W.; Ali, J.; Siddique, N.; Rasheed, A.; Akram, M.; Zaheer, M.U.; Mohsin, M. Quantification and Trends of Antimicrobial Use in Commercial Broiler Chicken Production in Pakistan. Antibiotics 2021, 10, 598. [Google Scholar] [CrossRef]
  4. Azam, M.; Mohsin, M.; Sajjad Ur, R.; Saleemi, M.K. Virulence-associated genes and antimicrobial resistance among avian pathogenic Escherichia coli from colibacillosis affected broilers in Pakistan. Trop. Anim. Health Prod. 2019, 51, 1259–1265. [Google Scholar] [CrossRef] [PubMed]
  5. Johnson, T.J.; Logue, C.M.; Johnson, J.R.; Kuskowski, M.A.; Sherwood, J.S.; Barnes, H.J.; DebRoy, C.; Wannemuehler, Y.M.; Obata-Yasuoka, M.; Spanjaard, L.; et al. Associations between multidrug resistance, plasmid content, and virulence potential among extraintestinal pathogenic and commensal Escherichia coli from humans and poultry. Foodborne Pathog. Dis. 2012, 9, 37–46. [Google Scholar] [CrossRef]
  6. Iancu, I.; Cătana, D.; Pascu, C.; Herman, N. Evaluation of antimicrobial resistance in strains of E. coli isolated from broiler carcasses. Rev. Rom. Med. Vet. 2018, 28, 35–38. [Google Scholar]
  7. Liu, C.M.; Stegger, M.; Aziz, M.; Johnson, T.J.; Waits, K.; Nordstrom, L.; Gauld, L.; Weaver, B.; Rolland, D.; Statham, S.; et al. Escherichia coli ST131-H22 as a Foodborne Uropathogen. mBio 2018, 9, e00470-18. [Google Scholar] [CrossRef]
  8. Le Gall, T.; Clermont, O.; Gouriou, S.; Picard, B.; Nassif, X.; Denamur, E.; Tenaillon, O. Extraintestinal virulence is a coincidental by-product of commensalism in B2 phylogenetic group Escherichia coli strains. Mol. Biol. Evol. 2007, 24, 2373–2384. [Google Scholar] [CrossRef]
  9. Alam, M.; Rasool, M.H.; Khan, I.; Khurshid, M.; Aslam, B. Multilocus Sequence Typing of Carbapenem-Resistant Acinetobacter baumannii Isolates Harboring bla(OXA-23) and bla(IMP) in Cattle from Punjab, Pakistan. Microb. Drug Resist. 2022, 28, 997–1002. [Google Scholar] [CrossRef]
  10. Clermont, O.; Christenson, J.K.; Daubié, A.S.; Gordon, D.M.; Denamur, E. Development of an allele-specific PCR for Escherichia coli B2 sub-typing, a rapid and easy to perform substitute of multilocus sequence typing. J. Microbiol. Methods 2014, 101, 24–27. [Google Scholar] [CrossRef]
  11. Azam, M.; Mohsin, M.; Johnson, T.J.; Smith, E.A.; Johnson, A.; Umair, M.; Saleemi, M.K.; Sajjad Ur, R. Genomic landscape of multi-drug resistant avian pathogenic Escherichia coli recovered from broilers. Vet. Microbiol. 2020, 247, 108766. [Google Scholar] [CrossRef]
  12. Ievy, S.; Islam, M.S.; Sobur, M.A.; Talukder, M.; Rahman, M.B.; Khan, M.F.R.; Rahman, M.T. Molecular Detection of avian pathogenic Escherichia coli (APEC) for the First Time in Layer Farms in Bangladesh and Their Antibiotic Resistance Patterns. Microorganisms 2020, 8, 1021. [Google Scholar] [CrossRef]
  13. Tivendale, K.A.; Logue, C.M.; Kariyawasam, S.; Jordan, D.; Hussein, A.; Li, G.; Wannemuehler, Y.; Nolan, L.K. Avian-pathogenic Escherichia coli strains are similar to neonatal meningitis E. coli strains and are able to cause meningitis in the rat model of human disease. Infect. Immun. 2010, 78, 3412–3419. [Google Scholar] [CrossRef]
  14. Clifford, K.; Desai, D.; da Costa, C.P.; Meyer, H.; Klohe, K.; Winkler, A.S.; Rahman, T.; Islam, T.; Zaman, M.H. Antimicrobial resistance in livestock and poor quality veterinary medicines. Bull. World Health Organ. 2018, 96, 662–664. [Google Scholar] [CrossRef]
  15. Sarowska, J.; Futoma-Koloch, B.; Jama-Kmiecik, A.; Frej-Madrzak, M.; Ksiazczyk, M.; Bugla-PLoSkonska, G.; Choroszy-Krol, I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: Recent reports. Gut Pathog. 2019, 11, 10–1186. [Google Scholar] [CrossRef]
  16. Liao, X.; Yang, R.S.; Xia, J.; Chen, L.; Zhang, R.; Fang, L.X.; Lei, F.; Song, G.; Jia, L.; Han, L.; et al. High colonization rate of a novel carbapenem-resistant Klebsiella lineage among migratory birds at Qinghai Lake, China. J. Antimicrob. Chemother. 2019, 74, 2895–2903. [Google Scholar] [CrossRef]
  17. Barbieri, N.L.; Pimenta, R.L.; de Melo, D.A.; Nolan, L.K.; de Souza, M.M.S.; Logue, C.M. mcr-1 Identified in Fecal Escherichia coli and avian pathogenic E. coli (APEC) From Brazil. Front. Microbiol. 2021, 12, 659613. [Google Scholar] [CrossRef]
  18. Dhaouadi, S.; Soufi, L.; Hamza, A.; Fedida, D.; Zied, C.; Awadhi, E.; Mtibaa, M.; Hassen, B.; Cherif, A.; Torres, C.; et al. Co-occurrence of mcr-1 mediated colistin resistance and β-lactamase-encoding genes in multidrug-resistant Escherichia coli from broiler chickens with colibacillosis in Tunisia. J. Glob. Antimicrob. Resist. 2020, 22, 538–545. [Google Scholar] [CrossRef]
  19. Cummins, M.L.; Reid, C.J.; Roy Chowdhury, P.; Bushell, R.N.; Esbert, N.; Tivendale, K.A.; Noormohammadi, A.H.; Islam, S.; Marenda, M.S.; Browning, G.F.; et al. Whole genome sequence analysis of Australian avian pathogenic Escherichia coli that carry the class 1 integrase gene. Microb. Genom. 2019, 5, 1099. [Google Scholar] [CrossRef]
  20. Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef]
  21. Wang, S.; Meng, Q.; Dai, J.; Han, X.; Han, Y.; Ding, C.; Liu, H.; Yu, S. Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains. PLoS ONE 2014, 9, e96904. [Google Scholar] [CrossRef] [PubMed]
  22. Iguchi, A.; Iyoda, S.; Seto, K.; Morita-Ishihara, T.; Scheutz, F.; Ohnishi, M. Escherichia coli O-Genotyping PCR: A Comprehensive and Practical Platform for Molecular O Serogrouping. J. Clin. Microbiol. 2015, 53, 2427–2432. [Google Scholar] [CrossRef] [PubMed]
  23. Poulsen, L.L.; Kudirkiene, E.; Jørgensen, S.L.; Djordjevic, S.P.; Cummins, M.L.; Christensen, J.P.; Christensen, H.; Bisgaard, M.; Thøfner, I. Whole genome sequence comparison of avian pathogenic Escherichia coli from acute and chronic salpingitis of egg laying hens. BMC Vet. Res. 2020, 16, 148. [Google Scholar] [CrossRef]
  24. Olsen, R.H.; Stockholm, N.M.; Permin, A.; Christensen, J.P.; Christensen, H.; Bisgaard, M. Multi-locus sequence typing and plasmid profile characterization of avian pathogenic Escherichia coli associated with increased mortality in free-range layer flocks. Avian Pathol. 2011, 40, 437–444. [Google Scholar] [CrossRef] [PubMed]
  25. Jørgensen, S.L.; Stegger, M.; Kudirkiene, E.; Lilje, B.; Poulsen, L.L.; Ronco, T.; Dos Santos, T.P.; Kiil, K.; Bisgaard, M.; Pedersen, K.; et al. Diversity and Population Overlap between Avian and Human Escherichia coli Belonging to Sequence Type 95. mSphere 2019, 4, e00333-18. [Google Scholar] [CrossRef]
  26. Ilyas, S.; Rasool, M.H.; Arshed, M.J.; Qamar, M.U.; Aslam, B.; Almatroudi, A.; Khurshid, M. The Escherichia coli Sequence Type 131 Harboring Extended-Spectrum Beta-Lactamases and Carbapenemases Genes from Poultry Birds. Infect. Drug Resist. 2021, 14, 805–813. [Google Scholar] [CrossRef]
  27. Kanokudom, S.; Assawakongkarat, T.; Akeda, Y.; Ratthawongjirakul, P.; Chuanchuen, R.; Chaichanawongsaroj, N. Rapid detection of extended spectrum β-lactamase producing Escherichia coli isolated from fresh pork meat and pig cecum samples using multiplex recombinase polymerase amplification and lateral flow strip analysis. PLoS ONE 2021, 16, e0248536. [Google Scholar] [CrossRef]
  28. Ben Yahia, H.; Ben Sallem, R.; Tayh, G.; Klibi, N.; Ben Amor, I.; Gharsa, H.; Boudabbous, A.; Ben Slama, K. Detection of CTX-M-15 harboring Escherichia coli isolated from wild birds in Tunisia. BMC Microbiol. 2018, 18, 26. [Google Scholar] [CrossRef]
  29. Kim, Y.B.; Yoon, M.Y.; Ha, J.S.; Seo, K.W.; Noh, E.B.; Son, S.H.; Lee, Y.J. Molecular characterization of avian pathogenic Escherichia coli from broiler chickens with colibacillosis. Poult. Sci. 2020, 99, 1088–1095. [Google Scholar] [CrossRef]
  30. Jamil, A.; Zahoor, M.A.; Nawaz, Z.; Siddique, A.B.; Khurshid, M. Genetic Diversity of Escherichia coli Coharboring mcr-1 and Extended Spectrum Beta-Lactamases from Poultry. BioMed Res. Int. 2022, 2022, 8224883. [Google Scholar] [CrossRef]
  31. Sarwar, F.; Rasool, M.H.; Khurshid, M.; Qamar, M.U.; Aslam, B. Escherichia coli Isolates Harboring bla(NDM) Variants and 16S Methylases Belonging to Clonal Complex 131 in Southern Punjab, Pakistan. Microb. Drug Resist. 2022, 28, 623–635. [Google Scholar] [CrossRef]
  32. Aslam, B.; Chaudhry, T.H.; Arshad, M.I.; Muzammil, S.; Siddique, A.B.; Yasmeen, N.; Khurshid, M.; Amir, A.; Salman, M.; Rasool, M.H.; et al. Distribution and genetic diversity of multi-drug-resistant Klebsiella pneumoniae at the human-animal-environment interface in Pakistan. Front. Microbiol. 2022, 13, 898248. [Google Scholar] [CrossRef]
  33. Chaudhry, T.H.; Aslam, B.; Arshad, M.I.; Alvi, R.F.; Muzammil, S.; Yasmeen, N.; Aslam, M.A.; Khurshid, M.; Rasool, M.H.; Baloch, Z. Emergence of bla (NDM-1) Harboring Klebsiella pneumoniae ST29 and ST11 in Veterinary Settings and Waste of Pakistan. Infect. Drug Resist. 2020, 13, 3033–3043. [Google Scholar] [CrossRef] [PubMed]
  34. Subedi, M.; Luitel, H.; Devkota, B.; Bhattarai, R.K.; Phuyal, S.; Panthi, P.; Shrestha, A.; Chaudhary, D.K. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018, 14, 113. [Google Scholar] [CrossRef]
Figure 1. The detection rate of VAGs in CR-APEC and CR-APEC co-harboring mcr-1 isolates.
Figure 1. The detection rate of VAGs in CR-APEC and CR-APEC co-harboring mcr-1 isolates.
Antibiotics 12 00812 g001
Figure 2. Sample-based detection of carbapenem-resistant genes (CRGs) among CR-APEC isolates.
Figure 2. Sample-based detection of carbapenem-resistant genes (CRGs) among CR-APEC isolates.
Antibiotics 12 00812 g002
Figure 3. (A) Sampled broiler showing a typical gross lesion of colibacillosis, i.e., perihepatitis (B) Sampled broiler showing a typical gross lesion of colibacillosis, pericarditis, and perihepatitis (C) EMB agar plate showing metallic sheen colonies of E. coli.
Figure 3. (A) Sampled broiler showing a typical gross lesion of colibacillosis, i.e., perihepatitis (B) Sampled broiler showing a typical gross lesion of colibacillosis, pericarditis, and perihepatitis (C) EMB agar plate showing metallic sheen colonies of E. coli.
Antibiotics 12 00812 g003
Table 1. Overall, sample-based distribution of APEC and CR-APEC along with their respective serogroups.
Table 1. Overall, sample-based distribution of APEC and CR-APEC along with their respective serogroups.
Specimen CategoryNo. of Samples
Collected
E coli Positive SamplesAPEC
% out of E. coli
Overall, APEC E. coli Isolates ConfirmationCR-APECCR-APEC SerogroupsStatistical Analysis
MALDI-TOFVAGs
Pericardial swabs250123 (49.20%)35/123
(28.45%)
35
(14.00%)
35
(14.00%)
2/35
(6%)
O78** p value = 0.001
Perihepatic swabs250131
(52.40%)
41/131
(31.30%)
41
(16.40%)
41
(16.40%)
3/41
(7%)
O78 (2) & O1 (1)
Fecal250164
(65.60%)
78/164
(47.56%)
78
(47.56%)
78
(47.56%)
8/78
(10%)
O78
Overall750418/750
(55.73%)
154/418
(36.84%)
154
 
154
 
13/154
(8.4%)
** Sample wise APEC out of collected samples.
Table 2. Distribution of mcr-1-harboring CR-APEC among various sample sources along with serogroups.
Table 2. Distribution of mcr-1-harboring CR-APEC among various sample sources along with serogroups.
Sample SourceAPECmcr-1-Harboring APECCR-APEC co-Harboring mcr-1SerogroupsST95Statistical Analysis
Pericardial Swabs3521 (60%)1 (3%)O78ND* p value ≤ 0.05
Perihepatic Swabs4123 (56%)3 (7%)O78 (2) & O1 (1)Detected
Fecal samples7817 (22%)1 (1%)O78Detected
Total15461 (39.61%)5 (3.2%)
* Sample-wise CR-APEC co-harboring mcr-1 among APEC. ND = not detected.
Table 3. MICs-CLSI Breakpoint based resistance profiling of mcr-1-harboring CR-APEC along with overall resistance profiling of APEC.
Table 3. MICs-CLSI Breakpoint based resistance profiling of mcr-1-harboring CR-APEC along with overall resistance profiling of APEC.
AntibioticsConc.CLSI-
EUCAST/FDA
Resistance Breakpoints
mcr-1-Harboring APEC IsolatesOverall Resistance Profile of APEC
Pericardial Swabs (n = 1)Perihepatic Swabs
(n = 3)
Fecal Samples
(n = 1)
Ampicillin10 µg≥32256256256512256100%
Cefepime30 µg≥16128512256256128100%
Ciprofloxacin5 µg≥46432641283254%
Levofloxacin5 µg≥432128641286454
Chloramphenicol30 µg≥3212825612812812889%
Trimethoprim5 µg≥1664256326412865%
Imipenem10 µg≥43212864643211%
Meropenem10 µg≥43264128643211%
Colistin10 µg≥8326432643246%
Tetracycline30 µg≥1664128641286481%
Tigecycline15 µg≥8448844%
Table 4. Co-existence of mcr-1 and CRGs in CR-APEC among different sample sources.
Table 4. Co-existence of mcr-1 and CRGs in CR-APEC among different sample sources.
Sample SourceAPEC Isolatesmcr-1 DetectionCR-APEC DetectionCR-APEC Co-Harboring mcr-1Co-Existence of ARGs
Pericardial swabs3521 (60%)2 (6%)1 (3%)mcr-1, blaTEM, blaSHV, blaNDM-1, blaIMP
Perihepatic Swabs4123 (56%)3 (5%)3 (7%)mcr-1, blaCTX-M, blaNDM-1, blaKPC, blaOXA-48, blaIMP
Fecal samples7817 (22%)8 (11%)1 (1%)mcr-1, blaCTX-M, blaSHV, blaNDM-1, blaKPC, blaOXA-48, blaIMP
Total15461 (39%)13 (8%)5 (38 %)
Table 5. Details of all the primers used in the study.
Table 5. Details of all the primers used in the study.
Sr. no.Antibiotics/VAGs/SerogroupsTargetSequenceAnnealing TempAmplicon SizeReferences
ARGs
1β-lactamsblaCTX-M-1F: ATGTGCAGYACCAGTAARGTKATGGC
R:
TGGGTRAARTARGTSACCAGAAYCAGCGG
61593[26,27]
2blaTEMF: CGCCGCATACACTATTCTCAGAATGA
R: ACGCTCACCGGCTCCAGATTTAT
61445
3blaSHVF: CTTTATCGGCCCTCACTCAA
R: AGGTGCTCATCATGGGAAAG
61237
4TetracyclinestetAF: GTAATTCTGAGCACTGTCGC
R: CTGCCTGGACAACATTGCTT
55956[28,29]
5tetBF: CTCAGTATTCCAAGCCTTTG
R: ACTCCCCTGAGCTTGAGGGG
55414
6QuinolonesqnrAF: TCAGCAAGAGGATTTCTCA
R: GGCAGCACTATTACTCCCA
51627
7qnrBF: CGACCTGAGCGGCACTGAAT
R: TGAGCAACGATGCCTGGTAG
52515
8Colistinmcr-1F: AGTCCGTTTGTTCTTGTGGC
R: AGATCCTTGGTCTCGGCTTG
60320[30]
9CarbapenemsblaNDM-1F: TGCCCAATATTATGCACCCGG
R: CGAAACCCGGCATGTCGAGA
59292[31,32,33]
10blaOXA-48F: TTGGTGGCATCGATTATCGG
R: GAGCACTTCTTTTGTGATGGC
55743
11blaKPCF: TGCAGAGCCCAGTGTCAGTTT
R: CGCTCTATCGGCGATACCA
52880
12blaIMPF: GGAATAGAGTGGCTTAATTCTC
R: CCAAACCACTACGTTATC
54624
VAGs
1Enteroaggregative toxinastAF: TGCCATCAACACAGTATATCC
R: TCAGGTCGCGAGTGACGGC
59116[34]
2Colisin V operon genecva/cviF: TGGTAGAATGTGCCAGAGCAAG
R: GAGCTGTTTGTAGCGAAGCC
591181
3SalmocheliniroNF: AATCCGGCAAAGAGACGAACCGCCT
R: GTTCGGGCAACCCCTGCTTTGACTTT
58553
4Hemolysin FhlyFF: GGCCACAGTCGTTTAGGGTGCTTACC
R: GGCGGTTTAGGCATTCCGATACTCAG
58450
5Outer membrane proteinompTF:
TCATCCCGGAAGCCTCCCTCACTACTAT
R:
TAGCGTTTGCTGCACTGGCTTCTGATAC
59496
6Iron repressible proteinirp-2F: AAGGATTCGCTGTTACCGGAC
R: AACTCCTGATACAGGTGGC
58413
7Temperature sensitive hemagglutinintshF: ACTATTCTCTGCAGGAAGTC
R: CTTCCGATGTTCTGAACGT
58824
8Aerobactin operoniucDF: ACAAAAAGTTCTATCGCTTCC
R: CCTGATCCAGATGATGCTC
59714
9P fimbriaepapCF: TGATATCACGCAGTCAGTAGC
R: CCGGCCATATTCACATAA
57501
10Increased serum survivalissF: CAGCAACCCGAACCACTTGATG
R: AGCATTGCCAGAGCGGCAGAA
57323
11Aerobactin siderophores ferric receptor proteiniutAF: GGCTGGACATCATGGGAACTGG
R: CGTCGGGAACGGGTAGAATCG
57302
O serogroups
1Serogroup O1ECO1F: CGATGTTGAGCGCAAGGTTG
R: CATTAGGTGTCTCTGGCACG
58263[21]
2Serogroup O2ECO2F: CGATGTTGAGCGCAAGGTTG
R: GATAAGGAATGCACATCGCC
58355
Serogroup O78ECO78F: CGATGTTGAGCGCAAGGTTG
R: TAGGTATTCCTGTTGCGGAG
58623
ST95 Allele Specific PCR
1Internal controlchuAF: CGATACGGTCGATGCAAAAG
R: TTGGACAACATCAGGTCATC
621013[10]
2ST95, groupIXaesIXF: CCTGGCCTGCAACGGGAG
R: TCTGGCTGCGGATAAAAGAG
62160
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Usman, M.; Rasool, M.H.; Khurshid, M.; Aslam, B.; Baloch, Z. Co-Occurrence of mcr-1 and Carbapenem Resistance in Avian Pathogenic E. coli Serogroup O78 ST95 from Colibacillosis-Infected Broiler Chickens. Antibiotics 2023, 12, 812. https://doi.org/10.3390/antibiotics12050812

AMA Style

Usman M, Rasool MH, Khurshid M, Aslam B, Baloch Z. Co-Occurrence of mcr-1 and Carbapenem Resistance in Avian Pathogenic E. coli Serogroup O78 ST95 from Colibacillosis-Infected Broiler Chickens. Antibiotics. 2023; 12(5):812. https://doi.org/10.3390/antibiotics12050812

Chicago/Turabian Style

Usman, Muhammad, Muhammad Hidayat Rasool, Mohsin Khurshid, Bilal Aslam, and Zulqarnain Baloch. 2023. "Co-Occurrence of mcr-1 and Carbapenem Resistance in Avian Pathogenic E. coli Serogroup O78 ST95 from Colibacillosis-Infected Broiler Chickens" Antibiotics 12, no. 5: 812. https://doi.org/10.3390/antibiotics12050812

APA Style

Usman, M., Rasool, M. H., Khurshid, M., Aslam, B., & Baloch, Z. (2023). Co-Occurrence of mcr-1 and Carbapenem Resistance in Avian Pathogenic E. coli Serogroup O78 ST95 from Colibacillosis-Infected Broiler Chickens. Antibiotics, 12(5), 812. https://doi.org/10.3390/antibiotics12050812

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop