Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China

Dissanayake, Asha J.; Chen, Ya-Ya; Cheewangkoon, Ratchadawan; Liu, Jian-Kui

doi:10.3390/jof7110893

Open AccessArticle

Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China

¹

School of Life Science and Technology, Center for Informational Biology, University of Electronic Science and Technology of China, Chengdu 611731, China

²

Institute of Crop Germplasm Resources, Guizhou Academy of Agricultural Sciences, Guiyang 550006, China

³

Guizhou Key Laboratory of Agricultural Biotechnology, Guizhou Academy of Agricultural Sciences, Guiyang 550006, China

⁴

Department of Entomology and Plant Pathology, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand

^*

Author to whom correspondence should be addressed.

J. Fungi 2021, 7(11), 893; https://doi.org/10.3390/jof7110893

Submission received: 26 August 2021 / Revised: 11 October 2021 / Accepted: 18 October 2021 / Published: 22 October 2021

(This article belongs to the Special Issue Fungal Biodiversity and Ecology 2.0)

Download

Browse Figures

Review Reports Versions Notes

Abstract

:

Botryosphaeriales is an important order of diverse fungal pathogens, saprobes, and endophytes distributed worldwide. Recent studies of Botryosphaeriales in China have discovered a broad range of species, some of which have not been formerly described. In this study, 60 saprobic isolates were obtained from decaying woody hosts in southwestern China. The isolates were compared with other species using morphological characteristics, and available DNA sequence data was used to infer phylogenetic analyses based on the internal transcribed spacer (ITS), large subunit rRNA gene (LSU), and translation elongation factor 1-α (tef) loci. Three novel species were illustrated and described as Botryobambusa guizhouensis, Sardiniella elliptica, and Sphaeropsis guizhouensis, which belong to rarely identified genera within Botryosphaeriaceae. Botryobambusa guizhouensis is the second species identified from the respective monotypic genus. The previously known species were identified as Aplosporella hesperidica, Barriopsis tectonae, Botryosphaeria dothidea, Diplodia mutila, Di. neojuniperi, Di. pseudoseriata, Di. sapinea, Di. seriata, Dothiorella sarmentorum, Do. yunnana, Lasiodiplodia pseudotheobromae, Neofusicoccum parvum, Sardiniella celtidis, Sa. guizhouensis, and Sphaeropsis citrigena. The results of this study indicate that numerous species of Botryosphaeriales are yet to be revealed in southwestern China.

Keywords:

asexual morph; phylogeny; saprobes; sexual morph; three new species; woody hosts

1. Introduction

The Botryosphaeriales are among the most widespread, common, and important fungal pathogens of woody plants. Many are known to exist as endophytes in healthy plant tissues and also as saprobes in dead tree materials. This fungal order has gone through significant revisions, and several new families, genera, and species have been introduced or synonymized over the last decade, mainly on the basis of combined morphological and multiple gene sequence data [1,2,3,4,5,6,7,8,9]. Schoch et al. [10] introduced the order Botryosphaeriales to accommodate the single family Botryosphaeriaceae. In the “Outline of Ascomycetes” [7], nine families (Aplosporellaceae, Botryosphaeriaceae, Melanopsaceae, Phyllostictaceae, Planistromellaceae, Saccharataceae, Septorioideaceae, Endomelanconiopsidaceae, and Pseudofusicoccaceae) were recognized in Botryosphaeriales. Phillips et al. [3] revised the order and accepted Aplosporellaceae, Botryosphaeriaceae, Melanopsaceae, Phyllostictaceae, Planistromellaceae, and Saccharataceae, while Endomelanconiopsidaceae, Pseudofusicoccaceae, and Septorioideaceae were considered as synonyms of Botryosphaeriaceae, Phyllostictaceae, and Saccharataceae, respectively. We followed this last taxonomical revision in our study.

Presently, the order Botryosphaeriales comprises 33 genera [3,9]. Alanomyces and Aplosporella are the only two genera accepted within the family Aplosporellaceae. The family Botryosphaeriaceae currently comprises 22 genera: Alanphillipsia, Barriopsis, Botryobambusa, Botryosphaeria, Cophinforma, Diplodia, Dothiorella, Endomelanconiopsis, Eutiarosporella, Lasiodiplodia, Macrophomina, Marasasiomyces, Mucoharknessia, Neodeightonia, Neofusicoccum, Neoscytalidium, Oblongocollomyces, Phaeobotryon, Sakireeta, Sardiniella, Sphaeropsis, and Tiarosporella [3,9]. Melanopsaceae accommodates only one genus, Melanops, which was supported by several phylogenetic analyses [3,4,11], while Phyllostictaceae includes two genera, Phyllosticta and Pseudofusicoccum [3,4,11]. Planistromellaceae was revised to accommodate Kellermania and Umthunziomyces [3]. Saccharataceae comprises three genera, Pileospora, Saccharata, and Septorioides [3,4].

Botryosphaeriales species cause blight, canker, dieback, and fruit rots on a variety of woody perennials globally [5,12]. In China, infections related to Botryosphaeriales have been described on numerous hosts such as grapes [13,14,15], Caragana arborescens [16], Cercis chinensis [17], Eucalyptus [12], Chinese hackberry [18], blueberry [19,20], forest trees [21,22], and various other woody hosts. Hence, the aim of this study was to characterize the Botryosphaeriales taxa associated with woody hosts in southwestern China based on morphology, DNA sequence data, and phylogeny.

2. Materials and Methods

2.1. Collection of Specimens, Isolation, Morphology, and Culture Characteristics

From 2017 to 2019, specimens were collected in field investigations of numerous decomposing woody hosts in Fanjing mountain (Tongren District), Forest Park (Chishui District), Huaxi wetland park, Xiaochehe wetland park (Guiyang District), Maolan natural reserve (Libo District), Suiyang broad water nature reserve, and Xingyi Wanfenglin in the Karst region of Guizhou province (Table 1). Samples were placed into ziplock plastic bags, relevant data (location, date, etc.) were documented, and samples were taken into the laboratory.

Morphological observations of conidiomata or ascostromata were carried out using a Motic SMZ 168 series stereomicroscope and photographed using a Nikon E80i microscope-camera system. Tarosoft^® Image Framework was used to measure morphological characters as in Liu et al. [23], and images included in figures were processed with Adobe Photoshop cs v. 5. To isolate single spores, the procedure according to Chomnunti et al. [24] was followed. Spores germinated on water agar (WA) for 12–24 h were examined and then transferred to potato dextrose agar (PDA) media (OXOID CM0139). Obtained pure cultures were incubated at 25 °C for two weeks, and colony characteristics and morphology of fungal structures were examined for a total of 60 isolates. According to Rayner [25], colony color was inspected after 5–10 days of progression on PDA at 25 °C. Approximately 20 ascomata/conidiomata, 25 asci, and 50 conidia/ascospores were measured to obtain the mean size/length. Shape, color, and presence or absence of the mucous sheath of conidia/ascospores were also documented.

Herbarium specimens were deposited at the HKAS (Herbarium of Cryptogams, Kunming Institute of Botany Academia Sinica Kunming, China) and GZAAS (Herbarium of Guizhou Academy of Agricultural Sciences, Guiyang, China), while living cultures were deposited in the CGMCC (China General Microbiological Culture Collection Center in Beijing, China) and GZCC (Guizhou Culture Collection in Guiyang, China) (Table 1).

2.2. DNA Extraction and Molecular Based Amplification

About 10 mg of aerial mycelia were scraped from 5 day-old isolates grown on PDA medium at 25 °C for the extraction of total genomic DNA using an Extraction Kit of Biospin Fungus Genomic DNA (BioFlux^®, Hangzhou, China) according to the manufacturer’s protocol (Hangzhou, China). For initial species confirmation, the internal transcribed spacer (ITS) region was sequenced for all isolates. The BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 14 August 2020) was used to compare the resulting sequences with those in GenBank. After confirmation of Botryosphaeriales species, two additional gene regions coding for translation elongation factor 1-α (tef) and large subunit rRNA gene (LSU) were sequenced as in Dissanayake et al. [5]. The primer pairs and amplification conditions for each of the above-mentioned gene regions are provided in Table 2. A Bio-Rad C1000 thermal cycler was used to conduct the PCR reactions. The resulting PCR products were visualized on a 1% agarose gel stained with ethidium bromide under UV light by a Gel Doc^TM XR Molecular Imager (Bio-Rad, USA). All positive amplicons were sequenced by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China).

2.3. Sequence Alignment and Phylogenetic Analyses

Sequence quality was assured by inspecting the chromatograms using BioEdit v. 5 [29]. Sequences were obtained with both forward and reverse primers, and consensus sequences were obtained using DNAStar v. 5.1 (DNASTAR, Inc.). The sequence data generated in this study have been deposited in GenBank (Table 1).

Reference sequences of ITS, tef, and LSU were retrieved from NCBI GenBank, referring to recent publications [3,4,5,6,9] (Table 3) to conduct phylogenetic analyses. The reference sequences were aligned with the sequences obtained in this study (Table 1) using MAFFT (http://www.ebi.ac.uk/Tools/msa/mafft/, accessed on 22 December 2020) [30], then manually adjusted, and phylogenetic relationships were inferred with maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) using procedures provided in detail by Dissanayake et al. [31]. An overview phylogenetic tree for the order Botryosphaeriales was constructed using ITS, LSU, and tef sequence data as some families in Botryosphaeriales (except Botryosphaeriaceae) comprise only ITS and LSU sequences. Separate phylogenetic trees of the diverse genera (Botryosphaeria, Diplodia, Dothiorella, Lasiodiplodia, and Neofusicoccum) were constructed by combining ITS and tef sequences.

Alignments generated in this study were submitted to TreeBASE (https://treebase.org/treebase-web/home.html, accessed on 18 August 2021). The submission numbers and reviewer access URL for each alignment are provided in Table 4. Taxonomic novelties were submitted to the Faces of Fungi database [32] and Index fungorum (http://www.indexfungorum.org, accessed on 5 August 2021). New species were established based on the guidelines provided by Jeewon and Hyde [33].

3. Results

3.1. Phylogenetic Analyses

Sixty isolates obtained from various decaying woody hosts in various locations in Guizhou province were primarily recognized by colony characteristics, such as abundant greenish black aerial mycelia on PDA medium. The ITS gene region sequences compared with those in GenBank using the BLAST tool exhibited 95–99% similarity to known Botryosphaeriales species, and these closely related known species were included in the phylogenetic analysis. All details of the alignments (ITS, LSU, tef alignment of the overview phylogenetic tree for the order Botryosphaeriales and ITS and tef alignments for the genera Botryosphaeria, Diplodia, Dothiorella, Lasiodiplodia, and Neofusicoccum) are provided in Table 4. The best-scoring RAxML tree (Figure 1) is presented as the MP and BI methods produced trees with topologies similar to those of ML.

Six different phylogenetic trees were constructed for the 60 isolates obtained in this study. Twelve isolates (20% of total isolates) were treated together in an overview phylogenetic tree and seven of them did not cluster with any known Botryosphaeriales species, thus, three novel species were identified based on the morphological and phylogenetic evidence (Figure 1). In this phylogeny, the isolates obtained in the study were clustered with Aplosporella hesperidica (Figure 2), Barriopsis tectonae (Figure 3), Botryobambusa guizhouensis sp. nov. (Figure 4), Sardiniella celtidis (Figure 5), Sardiniella elliptica sp. nov. (Figure 6 and Figure 7), Sardiniella guizhouensis (Figure 8), Sphaeropsis citrigena, and Sphaeropsis guizhouensis sp. nov (Figure 9).

Twenty-three isolates (38.3% of total isolates) belong to the genus Botryosphaeria, and all of them clustered with B. dothidea (Figure 10). Six isolates (10% of total isolates) belong to the genus Diplodia and were identified as Di. mutila, Di. neojuniperi, Di. pseudoseriata, Di. sapinea, and Di. seriata (Figure 11). Two isolates (3.3% of total isolates) were identified as species of Dothiorella (Do. sarmentorum and Do. yunnana, Figure 12), while five isolates (8.3% of total isolates) belong to the genus Lasiodiplodia (L. pseudotheobromae, Figure 13). All twelve isolates (20% of total isolates) of the genus Neofusicoccum were identified as N. parvum (Figure 14).

3.2. Taxonomy

Aplosporella hesperidica Speg., Anal. Soc. cient. argent. 13: 18 (1882) (Figure 2).

Index Fungorum number: IF218239; Facesoffungi number: FoF07830.

Saprobic on decaying wood. Sexual morph: Not observed. Asexual morph: Conidiomata 220–360 × 420–610 µm (

\bar{x}

= 320 × 550 µm, n = 20), solitary, dark brown, immersed to semi-immersed, erumpent, multiloculate, locules separated by pale brown textura prismatica. Ostiole 60–80 µm diam., central. Peridium 75–150 µm (6–10 cell-layers), outer layers composed of dark brown textura angularis, becoming hyaline towards the inner region. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 6–11 × 2.5–3 µm (

\bar{x}

= 8 × 2.5 µm, n = 20), holoblastic, hyaline, cylindrical to doliiform, smooth-walled, proliferating percurrently with 1–3 annellations near the apex. Paraphyses 35–95 × 4–8 µm (

\bar{x}

= 60 × 5 µm, n = 20), wide at the base, 1–3 µm wide in the upper part, hyaline, smooth-walled, septate, branched below. Conidia 17–25 × 10–18 µm (

\bar{x}

= 20 × 12 µm, n = 50), aseptate, initially hyaline, smooth-walled, broadly ellipsoidal to subcylindrical, with rounded ends, becoming dark brown (black in mass), prominently verruculose before discharge from pycnidia.

Culture characteristics: Conidia germinate on WA within 12 h at room temperature. Colonies on PDA after five days at 25 °C become olivaceous to grey-olivaceous in the center, olivaceous-buff to greenish-olivaceous towards the margin. Aerial mycelium appressed, floccose, white to smoke grey. Colonies flat with undulate edge, 38 mm diameter after two days, reaching the edge of the Petri dish within 10 days.

Material examined: China, Guizhou province, Tongren District, Fanjing mountain, on decaying woody host, July 2018, Y. Y. Chen, GZAAS 19-1814, living culture GZCC 19-0095.

Notes: Our sample morphologically lines up with the description of Aplosporella hesperidica provided by Spegazzini [34] as it has erumpent, black conidiomata and brown, smooth-walled, oblong conidia with overlapping spore dimensions of 22–25 × 9–11 µm. It is identical to A. hesperidica based on morphology and phylogeny (Figure 1). This is the first time A. hesperidica has been reported in China.

Figure 2. Aplosporella hesperidica (GZAAS 19-1814). (a–c) Conidiomata on host surface. (d,e) Vertical hand sections of multiloculate conidiomata. (f,g) Developing conidia attached to conidiogenous cells. (h) Hyaline immature conidium. (i–k) Mature brown conidia. (l,m) Five-day-old culture on PDA (OXOID CM0139) from above and below. Scale bars: (d,e) = 100 μm, (f–k) = 10 μm.

Barriopsis tectonae Doilom, L.A. Shuttlew., and K.D. Hyde, Phytotaxa 176: 84 (2014) (Figure 3).

Index Fungorum number: IF808202; Facesoffungi number: FoF09644.

Saprobic on decaying wood. Sexual morph: Ascostromata 286–420 × 258–349 μm (

\bar{x}

= 350 × 318 µm, n = 20), black, immersed, aggregated or clustered, scattered, multi-loculate, composed of one or up to three globose ascomata in each ascostroma, erumpent through the bark at maturity, discoid to pulvinate or hemispherical, discrete or wide-spreading. Peridium composed of several layers of dark brown-walled cells of textura angularis. Pseudoparaphyses 2.5–3.5 μm wide, hyphae-like, septate, embedded in a gelatinous matrix. Asci 107–154 × 34–41 (

\bar{x}

= 129 × 36 µm, n = 25), eight-spored, bitunicate, fissitunicate, clavate to sub-clavate, broad, with a short pedicel and apically rounded with an ocular chamber. Ascospores 31–34 ×14–15 µm (

\bar{x}

= 32 × 15 µm, n = 50), biseriate, brown to dark brown, aseptate, ellipsoid-oval, inequilateral, slightly curved, widest in the median, ends rounded, light brown in the center, smooth or verrucose, without a gelatinous sheath. Asexual morph: Not observed.

Culture characteristics: Ascospores germinate on WA within 18 h. Colonies growing on PDA reach 2 cm diameter after five days at 25 °C. Effuse, velvety with entire to slightly undulate edge. Blackish green to black.

Material examined: China, Guizhou province, Libo District, Maolan natural reserve, on decaying woody host, July 2017, Y. Y. Chen, GZAAS 19-1985, living culture GZCC 19-0266.

Notes: In the phylogenetic analysis, an isolate obtained in this study (GZCC 19-0266) was grouped with the ex-type isolate of Barriopsis tectonae (Figure 1) with absolute bootstrap support (ML/MP/BI = 100/100/1.0). This isolate is morphologically similar to Ba. tectonae as of the report by Doilom et al. [35] with erumpent, black ascostromata and overlapping biseriate, brown, aseptate, ellipsoid, thick-walled conidia with overlapping spore dimensions of 29–33 × 13–15 μm (

\bar{x}

= 30 × 14 μm, n = 30). It is identical to Ba. tectonae based on morphology and phylogeny (Figure 1). We therefore identify our isolate as Ba. tectonae based on phylogenetic analyses, and the isolate is introduced here as a new locality record from Guizhou province, China. This is the first time Ba. tectonae has been reported in China.

Figure 3. Barriopsis tectonae (GZAAS 19-1985). (a,b) Appearance of ascomata on wood. (c) Horizontal section of the ascomata. (d,e) Vertical section of ascomata. (f) Peridium. (g,h) Immature asci. (i) Immature and mature asci. (j) Mature asci. (k) Pseudoparaphyses. (l–p). Brown ascospores. Scale bars: (d) = 50 μm, (e) = 100 μm, (f) = 50 μm, (g–j) = 20 μm, (k–p) = 10 μm.

Botryobambusa guizhouensis Y.Y. Chen, A. J. Dissanayake, and Jian K. Liu., sp. nov (Figure 4).

Index Fungorum number: IF558473; Facesoffungi number: FoF09645.

Etymology: Name refers to the location where the fungus was collected, Guizhou, China.

Holotype: HKAS 112600.

Saprobic on a decaying bamboo. Sexual morph: Ascostromata 218–340 × 210–420 μm (

\bar{x}

= 275 × 345 μm, n = 20), black, immersed or erumpent, gregarious, uniloculate, locules globose to subglobose, coriaceous. Peridium 36–60 μm, comprises several layers of cells textura angularis, broader at the base, outer layers dark to dark brown and thick-walled, inner layers hyaline and thin-walled. Asci 78–115 × 12–16 μm (

\bar{x}

= 94.5 × 14.5 μm, n = 25), eight-spored, bitunicate, fissitunicate, clavate to cylindro-clavate, usually wider at the apex, pedicellate, apically rounded with well-developed ocular chamber. Ascospores 13–22 × 8–11 μm (

\bar{x}

= 17.5 × 9 μm, n = 50), uniseriate at the base or irregularly biseriate, hyaline, aseptate, ellipsoidal to obovoid, thick-walled, surrounded by distinctive structured mucilaginous sheath. Asexual morph: Not observed.

Culture characteristics: Ascospores germinate on WA within 24 h. Colonies growing on PDA reach a 5 cm diameter after five days at 25 °C. Fast growing; white in the first few days, become grey to green-black after one week. Reverse grey to black, flattened, fairly dense, surface smooth with crenate edge.

Material examined: China, Guizhou province, Chishui District, Forest Park, on decaying bamboo, July 2019, Y. Y. Chen, 171, (HKAS 112600, holotype); ex-type living culture CGMCC 3.20348; ibid., (GZAAS 20-0718, paratype), living culture GZCC 19-0734.

Notes:Botryobambusa guizhouensis formed a distinct clade with absolute support (ML/MP/BI = 100/100/1.0) and differed from its closely related species Bo. fusicoccum in the concatenated alignment by 7/680 bp in ITS, 4/803 bp in LSU, and 5/479 bp in tef. Morphologically, Bo. guizhouensis differs from Bo. fusicoccum in having longer asci (94.5 × 14.5 μm vs. 60 × 15.5 μm) and larger ascospores (17.5 × 9 μm vs. 11.5 × 6 μm).

Figure 4. Botryobambusa guizhouensis (HKAS 112600, holotype). (a,b) Appearance of ascomata on bamboo. (c) Vertical section of ascomata. (d,e) Immature asci. (f,g) Immature and mature asci. (h–j) Hyaline, aseptate ascospores enclosed with mucilaginous sheath. Scale bars: (c) = 50 μm, (d–g) = 100 μm, (h,i) = 20 μm, (j) = 10 μm.

Sardiniella celtidis Dissan., Camporesi and K.D. Hyde, Fungal Divers 87: 12 (2017) (Figure 5).

Index Fungorum number: IF552896; Facesoffungi number: FoF02732.

Saprobic on a decaying host. Sexual morph: Ascostromata 210–300 × 275–340 μm (

\bar{x}

= 270 × 310 μm, n = 20), dark brown to black, globose, immersed in the substrate, partially erumpent at maturity, ostiolate. Ostiole circular, central. Peridium 48–72 μm thick, composed of dark brown thick-walled cells of textura angularis, becoming thin-walled and hyaline towards the inner region. Pseudoparaphyses 3–5 μm wide, thin-walled, hyaline. Asci 62–90 × 26–34 μm (

\bar{x}

= 78 × 30 μm, n = 20), four- to eight-spored, bitunicate, cylindric-clavate, endotunica thick-walled, with a well-developed ocular chamber. Ascospores 19–27 × 15–18 μm (

\bar{x}

= 23 × 16 μm, n = 50), 1-septate, irregularly biseriate, dark brown, oblong to ovate, widest in center, straight, moderately thick-walled, surface smooth. Asexual morph: Not observed.

Culture characters: Ascospores germinate on WA within 24 h. Colonies on PDA reach a 2 cm diameter after five days at 25 °C. Mycelium velvety and moderately fluffy with an irregular margin, surface initially white and later turning dark olivaceous from the middle of the colony and dark grey in reverse.

Material examined: China, Guizhou province, Guiyang city, Xingyi Wanfenglin, on decaying woody host, June 2019, Y.Y. Chen, GZAAS 19-1967, living culture GZCC 19-0248.

Notes: Our sample is phylogenetically identical to Sardiniella celtidis (Figure 1). Only the asexual morph of Sa. celtidis was provided when Hyde et al. [36] introduced this species. Here, we provide the sexual morph of Sa. celtidis.

Figure 5. Sardiniella celtidis (GZAAS 19-1967). (a,b) Appearance of ascomata on decaying wood. (c) Peridium. (d,e) Vertical section of ascomata. (f) Immature ascus. (g,h) Mature asci. (i) Pseudoparaphyses. (j–l) Brown, one-septate ascospores. (m,n) Five-day-old culture on PDA (OXOID CM0139) from above and below. Scale bars: (c–e) = 100 μm, (f–l) = 20 μm.

Sardiniella elliptica Y.Y. Chen, A. J. Dissanayake, and Jian K. Liu., sp. nov (Figure 6 and Figure 7).

Index Fungorum number: IF558474; Facesoffungi number: FoF09646.

Etymology: Named referring to the shape of the conidiospores.

Holotype: HKAS 112594.

Saprobic on decaying host. Sexual morph: Ascostromata 280–390 × 295–340 μm (

\bar{x}

= 340 × 310 μm, n = 20), dark brown to black, globose, submerged in the substrate, partially erumpent at maturity, ostiolate. Ostiole circular, central. Peridium 30–48 μm thick, composed of dark brown thick-walled cells of textura angularis, becoming thin-walled and hyaline towards the inner region. Pseudoparaphyses 2–3 μm wide, thin-walled, hyaline. Asci 71–93 × 19–24 μm, (

\bar{x}

= 86 × 22 μm, n = 25), 4(–8)-spored, bitunicate, cylindric-clavate, endotunica thick-walled, with a well-developed ocular chamber. Ascospores 26–33 × 9–12 μm (

\bar{x}

= 29 × 11 μm, n = 50), irregularly biseriate, initially hyaline and becoming dark brown, oblong to ovate, widest in center, straight, moderately thick-walled, surface smooth. Asexual morph: Appearing as subepidermal black spots on the substrate with black margins, with circular sunken perforation through the bark. Conidiomata 190–240 × 274–310 µm (

\bar{x}

= 220 × 290 µm, n = 20), pycnidial, immersed, arranged singly or in small groups within the bark, globose to subglobose, dark brown to black, solitary or gregarious. Ostiole central. Peridium 27–35 µm thick, comprising dark brown to hyaline, multi-layered (3–5 layered), thick-walled cells of textura angularis. Conidiogenous cells lining the inner surface of the conidioma, hyaline, short obpyriform to subcylindrical. Conidia 25–32 × 10–13 µm (

\bar{x}

= 28 × 12 µm, n = 50), ellipsoid to obovoid, immature conidia hyaline, mature conidia becoming medium to dark brown.

Culture characters: Colonies on PDA reaching a 70 mm diameter after five days at 25 °C. Mycelium velvety and moderately fluffy with an irregular margin. Surface initially white and later turning dark olivaceous from the middle of the colony and dark grey in reverse.

Material examined: China, Guizhou province, Guiyang District, Huaxi wetland park, on decaying woody host, April 2017, Y.Y. Chen, 18-76 (HKAS 112594, holotype); ex-type living culture CGMCC 3.20349; ibid., Libo District, Maolan natural reserve, July 2017, 19-120 (GZAAS 19-1855, paratype), living culture GZCC 19-0262; ibid., Xingyi Wanfenglin, June 2019, 19-96 (GZAAS 19-1838, paratype), living culture GZCC 19-0245.

Notes: Three isolates of Sardiniella elliptica clustered together with Sa. celtidis, Sa. guizhouensis, and Sa. urbana and formed a well-supported clade representing the genus Sardiniella; thus, it can be recognized as a distinct lineage within Sardiniella. Sardiniella elliptica can be distinguished from the above closely related species based on ITS and tef loci for Sa. celtidis (5/680 bp in ITS, 21/479 bp in tef) and Sa. urbana (5/680 bp in ITS, 8/803 bp in LSU, 27/479 bp in tef). In addition, Sa. elliptica can be morphologically distinguished from other known Sardiniella species based on its aseptate mature ascospores.

Figure 6. Sardiniella elliptica (HKAS 112594, holotype, sexual morph). (a,b) Appearance of ascomata on decaying wood. (c) Vertical section of ascomata. (d) Peridium. (e) Pseudoparaphyses. (f) Immature and mature asci. (g) Immature ascus. (h,i) Mature asci. (j–l) Immature hyaline ascospores. (m–o) Mature, brown, aseptate ascospores. Scale bars: (c) = 100μm, (d) = 50 μm, (e–o) = 10 μm.

Figure 7. Sardiniella elliptica (GZAAS 19-1838, asexual morph). (a–c) Conidiomata on host surface. (d) Vertical section of conidiomata. (e) Peridium. (f–h) Conidiogenous cells and developing conidia. (i–l) Immature, hyaline conidia. (m) Mature, brown conidia. Scale bars: (d) = 100 μm, (e) = 20 μm, (f–m) = 10 μm.

Sardiniella guizhouensis Y.Y. Chen, and Jian K. Liu, Phytotaxa 508: 190 (2021) (Figure 8).

Index Fungorum number: IF558352; Facesoffungi number: FoF09647.

Saprobic on decaying wood. Sexual morph: Not observed. Asexual morph: Conidiomata 180–245 × 275–395 µm (

\bar{x}

= 229 × 330 µm, n = 20), immersed, arranged singly or in small groups within the bark, globose to subglobose, dark brown to black, solitary or gregarious. Ostiole central. Peridium 22–34 µm thick, outer layer composed of pigmented thick-walled cells of textura angularis, inner layer composed of hyaline thin-walled cells of textura angularis (three- to five-layered). Conidiogenous cells 6–11 × 6–7 µm (

\bar{x}

= 8.5 × 6.5 μm, n = 25), lining the inner surface of the conidioma, hyaline, short obpyriform to subcylindrical. Conidia 21–28 × 10–14 µm (

\bar{x}

= 24.5 × 12.5 μm, n = 50), ellipsoid to obovoid, immature conidia hyaline, mature conidia becoming medium to dark brown.

Culture characteristics: Conidia germinating on WA within 18 h and producing germ tubes from each septum. Colonies growing on PDA, reaching a diameter of 4 cm after five days at 25 °C, effuse, velvety, with entire to slightly undulate edge. The early stage of the white, later green.

Material examined: China, Guizhou province, Libo District, Maolan natural reserve, July 2017, GZAAS 19-1948, living culture GZCC 19-0229.

Notes:Sardiniellaguizhouensis was introduced by Chen et al. [37] with both sexual and asexual morphs. One isolate obtained in this study clustered with the ex-type of Sa. guizhouensis (CGMCC 3.19222) in the phylogenetic analyses of combined ITS, LSU, and tef sequence data (Figure 1). We identified our collection as Sa. guizhouensis based on morphology and phylogeny.

Figure 8. Sardiniella guizhouensis (GZAAS 19-1809, asexual morph). (a,b) Conidiomata on host surface. (c) Horizontal section of conidiomata. (d) Vertical section of conidiomata. (e–i) Conidiogenous cells and developing conidia. (j–n) Hyaline conidia. Scale bars: (d) = 100 μm, (e–n) = 10 μm.

Sphaeropsis guizhouensis Y.Y. Chen, A. J. Dissanayake, and Jian K. Liu., sp. nov (Figure 9).

Index Fungorum number: IF558475; Facesoffungi number: FoF09648.

Etymology: Name refers to the location where the fungus was collected, Guizhou, China.

Holotype: HKAS 112084.

Saprobic on decaying wood. Sexual morph: Ascostromata 132–185 × 122–165 µm (

\bar{x}

= 152 × 145 µm, n = 20), initially immersed under host epidermis, becoming semi-immersed to erumpent, breaking through cracks in bark, gregarious and fused, uniloculate, globose to subglobose, membraneous, ostiolate. Ostiole 43–52 μm high, 30–42 μm wide, central, papillate, pale brown, relatively broad, periphysate. Peridium 28–44 μm wide, broader at the base, comprising several layers of relatively thick-walled, dark brown to black-walled cells arranged in a textura angularis. Pseudoparaphyses hyphae-like, numerous, embedded in a gelatinous matrix. Asci 67–101 × 19–23 µm (

\bar{x}

= 89 × 20 μm, n = 25), eight-spored, bitunicate, fissitunicate, clavate to cylindro-clavate, sometimes short pedicellate, mostly long pedicellate, apex rounded with an ocular chamber. Ascospores 20–23 × 7.8–8.3 µm (

\bar{x}

= 22 × 8 μm, n = 50), overlapping uniseriate to biseriate, hyaline, aseptate, ellipsoidal to obovoid, slightly wide above the center, minutely guttulate, smooth-walled. Asexual morph: Not observed.

Culture characteristics: Ascospores germinating on PDA within 18 h. Germ tubes produced from both ends of the ascospores. Fast growing; fimbriate, flat or effuse, dense, convex with papillate surface, reaching the edge of the Petri dish after seven days.

Material examined: China, Guizhou province, Libo District, Maolan natural reserve, on decaying woody host, July 2017, Y.Y. Chen, GZAAS4 (HKAS 112084, holotype); ex-type living culture CGMCC 3.20352; ibid., Xingyi Wanfenglin, on decaying woody host, June 2019, Y.Y. Chen, (GZAAS 19-2892, paratype), living culture GZCC 19-0273.

Notes:Sphaeropsis guizhouensis formed a distinct clade (Figure 1) and is phylogenetically distinct from Sp. eucalypticola (MFLUCC 11-0579) in a clade with absolute support (ML/MP/BI = 100/100/1.0). Sphaeropsis guizhouensis can be distinguished from Sp. eucalypticola based on ITS (3/680 bp), LSU (1/803 bp), and tef (25/479 bp). Sphaeropsis guizhouensis differs from Sp. eucalypticola in having smaller asci (89 × 20 μm vs. 106 × 29 μm) and ascospores (22 × 8 μm vs. 30 × 12 μm).

Figure 9. Sphaeropsis guizhouensis (HKAS 112084, holotype). (a–c) Appearance of ascomata on wood. (d,e) Vertical section of ascomata. (f) Peridium. (g–j) Immature and mature asci. (k) Pseudoparaphyses. (l–p) Hyaline mature ascospores. Scale bars: (d,e) = 50 μm, (f) = 20 μm, (g–p) = 10 μm.

Figure 10. Maximum likelihood tree based on analysis of combined ITS and tef sequences of Botryosphaeria. Bootstrap support values of ML, MP > 75% are shown near the nodes, and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species. Ex-type strains are in bold. The tree is rooted to Macrophomina phaseolina (CBS 227.33).

Figure 11. Maximum likelihood tree based on analysis of combined ITS and tef sequences of Diplodia. Bootstrap support values of ML, MP > 75% are shown near the nodes, and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species. Ex-type strains are in bold. The tree is rooted to Lasiodiplodia theobromae (CBS 164.96).

Figure 12. Maximum likelihood tree based on analysis of combined ITS and tef sequences of Dothiorella. Bootstrap support values of ML, MP > 75% are shown near the nodes, and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species. Ex-type strains are in bold. The tree is rooted to Neofusicoccum parvum (CMW9081).

Figure 13. Maximum likelihood tree based on analysis of combined ITS and tef sequences of Lasiodiplodia. Bootstrap support values of ML, MP > 75% are shown near the nodes, and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species. Ex-type strains are in bold. The tree is rooted to Diplodia mutila (CBS 112553).

Figure 14. Maximum likelihood tree based on analysis of combined ITS and tef sequences of Neofusicoccum. Bootstrap support values of ML, MP > 75% are shown near the nodes, and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species. Ex-type strains are in bold. The tree is rooted to Dothiorella viticola (CBS 117009).

4. Discussion

This study reports the largest collection of Botryosphaeriales isolates from Guizhou province, China, and is the first attempt to characterize Botryosphaeriales species from various nature reserves in the province. Three new species were described in three rarely observed genera: Botryobambusa (Bo. guizhouensis), Sardiniella (Sa. elliptica), and Sphaeropsis (Sp. guizhouensis). These three genera have few species and have been sporadically isolated worldwide. Apart from these novel species, 15 known species—Aplosporella hesperidica, Barriopsis tectonae, Botryosphaeria dothidea, Diplodia mutila, Di. neojuniperi, Di. pseudoseriata, Di. sapinea, Di. seriata, Dothiorella sarmentorum, Do. yunnana, Lasiodiplodia pseudotheobromae, Neofusicoccum parvum, Sardiniella celtidis, Sa. guizhouensis, and Sphaeropsis citrigena—were isolated and included in their respective phylogenies.

The genus Aplosporella consists of plant pathogens, saprobes, and endophytes. Though 300 epithets of Aplosporella are registered in Index Fungorum (http://www.indexfungorum.org/Names/Names.asp, accessed in 23 August 2021), only 12 species are accepted within this genus (www.botryosphaeriales.org). Aplosporella hesperidica has been reported in several Asian countries [17,22,38,39,40,41,42], but this is the first time it has been identified in China.

Five species are accepted in the genus Barriopsis [35,43,44,45]. Barriopsis tectonae was introduced by Doilom et al. [35] from a dead Tectona grandis branch collected in Thailand. So far, this species has been reported only from Thailand (http://nt.arsgrin.gov/fungaldatabases/, accessed on 25 September 2021), and here we provide a new country report of Ba. tectonae (Figure 3) based on sexual morphological characteristics and molecular evidence.

Botryobambusa is a monotypic genus (www.botryosphaeriales.org). Liu et al. [1] introduced and compared Botryobambusa with other existing genera in Botryosphaeriales. It is thus far only identified from bamboo in Thailand. In this study, two isolates obtained from decaying bamboo in Forest Park, Chishui District in Guizhou province were identified as a novel species (Bo. guizhouensis). The sexual morph of Bo. guizhouensis was distinguished from Bo. fusicoccum by its larger asci and ascospores as well as by molecular phylogeny. Our study shows that the genus can be clearly discriminated from the morphologically similar genus Botryosphaeria by its velvety, hyaline, and sheathed ascospores. Phylogenetically, these two genera are clearly distinct lineages.

Linaldeddu et al. [46] introduced the genus Sardiniella by denoting Sa. urbana as the type species. Hyde et al. [36] introduced the second species in the genus, Sa. celtidis, while Chen et al. [37] introduced the third species, Sa. guizhouensis, reporting a sexual morph of the genus for the first time. In this study, another new species (Sa. elliptica) is described and assigned to the genus with details provided for a previously known species (Sa. celtidis). With morphological and molecular support, here we present the sexual morph report for Sa. elliptica; a newly introduced species in this study (Figure 6 and Figure 7). So far, Sardiniella species are known only from Italy and China (http://nt.arsgrin.gov/fungaldatabases/, accessed on 25 September 2021).

Though more than 630 names exist in Sphaeropsis (Index Fungorum, August 2021), only five species are currently accepted [2,3]. In this study, two isolates obtained from decaying woody hosts in Guizhou province were identified as a novel species, Sp. guizhouensis. The sexual morph of Sp. guizhouensis (Figure 9) is distinguished from the other species in this genus by ascospore dimensions. Another previously known species Sp. citrigena was also isolated and included in the phylogenetic analysis.

Botryosphaeria dothidea (Figure 10) and Neofusicoccum parvum (Figure 14) were the most isolated species in this study, consistent with some prior studies [47,48,49,50,51], which indicates the ability of species in these genera to inhabit a variety of plant species and geographic areas globally. Certain Diplodia species occupy extensive host ranges, such as Di. seriata which has been documented on more than 250 hosts [3,5]. In this study, we isolated five Diplodia species (Figure 11): Di. mutila, Di. neojuniperi, Di. pseudoseriata, Di. sapinea, and Di. seriata. Our study revealed two previously known Dothiorella species (Figure 12), Do. sarmentorum and Do. yunnana, for the first time from Guizhou province. Lasiodiplodia pseudotheobromae is a common and cosmopolitan species on diverse host plants and has been reported from various localities globally. This study revealed five saprobic L. pseudotheobromae isolates (Figure 13) in Guizhou province.

Members of Botryosphaeriales signify a rising risk to agricultural crops and urban and natural forest ecosystems in China. Collecting and identifying Botryosphaeriales isolates from various hosts and locations is required to describe and understand these species. The occurrence and significance of Botryosphaeriales species in various nature reserves has not been investigated at a larger scale so far in Guizhou province. Hence, in this study, we provided a larger collection of Botryosphaeriales isolates and identify them to species level by both morphology and phylogeny. Further studies are needed to explore and gather data on their occurrence, as precise data of the causal agents is essential.

5. Conclusions

We carried out fungal diversity investigations at a large scale in southwestern China and here we provided a report of Botryosphaeriales species isolated from various woody hosts in Guizhou province, China. The identification of 18 Botryosphaeriales species (15 known species and three new species) associated with saprobic woody hosts was revealed.

Author Contributions

Conceptualization, J.-K.L. and Y.-Y.C.; methodology, Y.-Y.C. and A.J.D.; formal analysis, Y.-Y.C. and A.J.D.; resources, Y.-Y.C. and J.-K.L.; data curation, A.J.D., R.C., and J.-K.L.; writing—original draft preparation, A.J.D.; writing—review and editing, A.J.D. and J.-K.L.; supervision, J.-K.L.; project administration, J.-K.L.; funding acquisition, J.-K.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study is supported by the Joint Fund of the National Natural Science Foundation of China and the Karst Science Research Center of Guizhou province (Grant No. U1812401).

Acknowledgments

We would like to thank Shaun Pennycook (Landcare Research-Manaaki Whenua, New Zealand) for advising on the new fungal names. A.J.D. acknowledges the University of Electronic Science and Technology of China for financial support.

Conflicts of Interest

The authors declare no conflict of interest.

References

Liu, J.K.; Phookamsak, R.; Doilom, M.; Wikee, S.; Li, Y.M. Towards a natural classification of Botryosphaeriales. Fungal Divers. 2012, 57, 149–210. [Google Scholar] [CrossRef]
Phillips, A.J.L.; Alves, A.; Abdollahzadeh, J.; Slippers, B.; Wingfield, M.J. The Botryosphaeriaceae: Genera and species known from culture. Stud. Mycol. 2013, 76, 51–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Phillips, A.J.L.; Hyde, K.D.; Alves, A.; Liu, J.K. Families in Botryosphaeriales: A phylogenetic, morphological and evolutionary perspective. Fungal Divers. 2019, 94, 1–22. [Google Scholar] [CrossRef]
Slippers, B.; Boissin, E.; Phillips, A.J.L.; Groenewald, J.Z.; Lombard, L. Phylogenetic lineages in the Botryosphaeriales: A systematic and evolutionary framework. Stud. Mycol. 2013, 76, 31–49. [Google Scholar] [CrossRef] [Green Version]
Dissanayake, A.J.; Phillips, A.J.L.; Hyde, K.D.; Li, X.H. Botryosphaeriaceae: Current status of genera and species. Mycosphere 2016, 7, 1001–1073. [Google Scholar] [CrossRef]
Yang, T.; Groenewald, J.Z.; Cheewangkoon, R.; Jami, F.; Abdollahzadeh, J. Families, genera, and species of Botryosphaeriales. Fungal Biol. 2017, 121, 322–346. [Google Scholar] [CrossRef] [PubMed]
Wijayawardene, N.N.; Hyde, K.D.; Lumbsch, T.; Liu, J.K.; Maharachchikumbura, S.S.N. Outline of Ascomycota-2017. Fungal Divers. 2018, 88, 167–263. [Google Scholar] [CrossRef]
Hongsanan, S.; Hyde, K.D.; Phookamsak, R.; Wanasinghe, D.N.; McKenzie, E.H.C. Refined families of Dothideomycetes: Orders and families incertae sedis in Dothideomycetes. Fungal Divers. 2020, 105, 17–318. [Google Scholar] [CrossRef]
Zhang, W.; Groenewald, J.Z.; Lombard, L.; Schumacher, R.K.; Phillips, A.J.L. Evaluating species in Botryosphaeriales. Persoonia 2021, 46, 63–115. [Google Scholar]
Schoch, C.L.; Shoemaker, R.A.; Seifert, K.A.; Hambleton, S.; Spatafora, J.W. A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 2006, 98, 1041–1052. [Google Scholar] [CrossRef]
Wikee, S.; Lombard, L.; Nakashima, C.; Motohashi, K.; Chukeatirote, E. A phylogenetic re-evaluation of Phyllosticta (Botryosphaeriales). Stud. Mycol. 2013, 76, 1–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Slippers, B.; Crous, P.W.; Jami, F.; Groenewald, J.Z.; Wingfield, M.J. Diversity in the Botryosphaeriales: Looking back, looking forward. Fungal Biol. 2017, 121, 307–321. [Google Scholar] [CrossRef] [PubMed]
Yan, J.Y.; Xie, Y.; Zhang, W.; Wang, Y.; Liu, J.K. Species of Botryosphaeriaceae involved in grapevine dieback in China. Fungal Divers. 2013, 61, 221–236. [Google Scholar] [CrossRef]
Dissanayake, A.J.; Zhang, W.; Liu, M.; Chukeatirote, E.; Yan, J.Y. Lasiodiplodia pseudotheobromae causes pedicel and peduncle discolouration of grapes in China. Australas. Plant Dis. 2015, 10, 21. [Google Scholar] [CrossRef] [Green Version]
Dissanayake, A.J.; Zhang, W.; Li, X.H.; Zhou, Y.; Hyde, K.D. First report of Neofusicoccum mangiferae associated with grapevine dieback in China. Phytopathol. Mediterr. 2015, 54, 414–419. [Google Scholar]
Chen, Y.Y.; Dissanayake, A.J.; Liu, Z.Y.; Liu, J.K. Additions to Karst Fungi 4: Botryosphaeria spp. associated with woody hosts in Guizhou province, China including B. guttulata sp. nov. Phytotaxa 2020, 454, 186–202. [Google Scholar] [CrossRef]
Dou, Z.P.; He, W.; Zhang, Y. Lasiodiplodia chinensis, a new holomorphic species from China. Mycosphere 2017, 8, 521–532. [Google Scholar] [CrossRef]
Liang, L.; Li, H.; Zhou, L.; Chen, F. Lasiodiplodia pseudotheobromae causes stem canker of Chinese hackberry in China. J. For. Res. 2020, 31, 2571–2580. [Google Scholar] [CrossRef] [Green Version]
Yu, L.; Impaprasert, R.; Zhao, J.R.; Xu, S.G.; Wu, M. Stem die-back of highbush blueberries caused by Neofusicoccum parvum in China. New Dis. Rep. 2013, 27, 3. [Google Scholar] [CrossRef] [Green Version]
Xu, C.; Zhang, H.; Zhou, Z.; Hu, T.; Wang, S. Identification and distribution of Botryosphaeriaceae species associated with blueberry stem blight in China. Eur. J. Plant Pathol. 2015, 143, 737–752. [Google Scholar] [CrossRef]
Pan, Y.; Ye, H.; Lu, J. Isolation and identification of Sydowia polyspora and its pathogenicity on Pinus yunnanensis in southwestern China. J. Phytopathol. 2019, 166, 386–395. [Google Scholar] [CrossRef]
Zhu, H.Y.; Tian, C.M.; Fan, X.L. Studies of botryosphaerialean fungi associated with canker and dieback of tree hosts in Dongling Mountain of China. Phytotaxa 2018, 348, 63–76. [Google Scholar] [CrossRef]
Liu, J.K.; Chomnunti, P.; Cai, L.; Phookamsak, R.; Chukeatirote, E. Phylogeny and morphology of Neodeightonia palmicola sp. nov. from palms. Sydowia 2010, 62, 261–276. [Google Scholar]
Chomnunti, P.; Hongsanan, S.; Aguirre-Hudson, B.; Tian, Q.; Peršoh, D. The sooty moulds. Fungal Divers. 2014, 66, 1–36. [Google Scholar] [CrossRef]
Rayner, R.W. A Mycological Colour Chart; Commonwealth Mycological Institute & British Mycological Society: Kew, UK, 1970. [Google Scholar]
White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4239–4246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous Ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
Hall, T. Bioedit 7.5.0.3. Department of Microbiology, North Carolina State University. 2006. Available online: http://www.mbio.ncsu.edu/BioEdit/Bioedit.html (accessed on 11 August 2020).
Katoh, K.; Standley, K. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
Dissanayake, A.J.; Bhunjun, C.S.; Maharachchikumbura, S.S.N.; Liu, J.K. Applied aspects of methods to infer phylogenetic relationships amongst fungi. Mycosphere 2020, 11, 2653–2677. [Google Scholar] [CrossRef]
Jayasiri, S.C.; Hyde, K.D.; Ariyawansa, H.A.; Bhat, J. The Faces of Fungi database: Fungal names linked with morphology, phylogeny and human impacts. Fungal Divers. 2015, 74, 3–18. [Google Scholar] [CrossRef]
Jeewon, R.; Hyde, K.D. Establishing species boundaries and new taxa among fungi: Recommendations to resolve taxonomic ambiguities. Mycosphere 2016, 7, 1669–1677. [Google Scholar] [CrossRef]
Spegazzini, C. Fungi argentini additis nonnullis brasiliensibus montevideensibusque. Pugillus quartus (Continuacion). Anal. Soc. Cient. Argent. 1882, 12, 97–117. [Google Scholar]
Doilom, M.; Shuttleworth, L.; Roux, J.; Chukeatirote, E.; Hyde, K.D. Barriopsis tectonae sp. nov. a new species of Botryosphaeriaceae from Tectona grandis (teak) in Thailand. Phytotaxa 2014, 176, 081–091. [Google Scholar] [CrossRef] [Green Version]
Hyde, K.D.; Norphanphoun, C.; Abreu, V.P.; Bazzicalupo, A.; Chethana, K.W.T. Fungal diversity notes 603–708: Taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers. 2017, 87, 1–235. [Google Scholar] [CrossRef]
Chen, Y.Y.; Dissanayake, A.J.; Liu, J.K. Additions to Karst Fungi 5: Sardiniella guizhouensis sp. nov. (Botryosphaeriaceae) associated with woody hosts in Guizhou province, China. Phytotaxa 2021, 508, 187–196. [Google Scholar] [CrossRef]
Jami, F.; Slippers, B.; Wingfield, M.J.; Gryzenhout, M. Botryosphaeriaceae species overlap on four unrelated, native South African hosts. Fungal Biol. 2014, 118, 168–179. [Google Scholar] [CrossRef] [Green Version]
Fan, X.L.; Hyde, K.D.; Liu, J.K.; Liang, Y.M.; Tian, C.M. Multigene phylogeny and morphology reveal Phaeobotryon rhois sp. nov (Botryosphaeriales, Ascomycota). Phytotaxa 2015, 205, 90–98. [Google Scholar] [CrossRef] [Green Version]
Ekanayaka, A.H.; Dissanayake, A.J.; Jayasiri, S.C.; To-anun, C.; Jones, E.B.G. Aplosporella thailandica; a novel species revealing the sexual-asexual connection in Aplosporellaceae (Botryosphaeriales). Mycosphere 2016, 7, 440–447. [Google Scholar] [CrossRef]
Du, Z.; Fan, X.L.; Yang, Q.; Hyde, K.D.; Tian, C.M. Aplosporella ginkgonis (Aplosporellaceae, Botryosphaeriales), a new species isolated from Ginkgo biloba in China. Mycosphere 2017, 8, 1246–1252. [Google Scholar] [CrossRef]
Mapook, A.; Hyde, K.D.; McKenzie, E.H.C.; Jones, E.B.G.; Bhat, D.J. Taxonomic and phylogenetic contributions to fungi associated with the invasive weed Chromolaena odorata (Siam weed). Fungal Divers. 2020, 101, 1–175. [Google Scholar] [CrossRef]
Phillips, A.J.L.; Alves, A.; Pennycook, S.R.; Johnston, P.R.; Ramaley, A. Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 2008, 21, 29–55. [Google Scholar] [CrossRef]
Abdollahzadeh, J.; Mohammadi, G.E.; Javadi, A.; Shams-Bakhsh, M.; Zare, R. Barriopsis iraniana and Phaeobotryon cupressi: Two new species of the Botryosphaeriaceae from trees in Iran. Persoonia 2009, 23, 1–8. [Google Scholar] [CrossRef] [Green Version]
Konta, S.; Phillips, A.J.L.; Bahkali, A.H.; Jones, E.B.G.; Eungwanichayapant, D.P. Botryosphaeriaceae from palms in Thailand—Barriopsis archontophoenicis sp. nov, from Archontophoenix alexandrae. Mycosphere 2016, 7, 921–932. [Google Scholar] [CrossRef]
Linaldeddu, B.T.; Alves, A.; Phillips, A.J.L. Sardiniella urbana gen. et sp. nov., a new member of the Botryosphaeriaceae isolated from declining Celtis australis trees in Sardinian streetscapes. Mycosphere 2016, 7, 893–905. [Google Scholar] [CrossRef]
Lazzizera, C.; Frisullo, S.; Alves, A.; Phillips, A.J.L. Morphology, phylogeny and pathogenicity of Botryosphaeria and Neofusicoccum species associated with drupe rot of olives in southern Italy. Plant Pathol. 2008, 57, 948–956. [Google Scholar] [CrossRef]
Linaldeddu, B.T.; Scanu, B.; Maddau, L.; Franceschini, A. Diplodia corticola and Phytophthora cinnamomi: The main pathogens involved in holm oak decline on Caprera island (Italy). For. Pathol. 2014, 44, 191–200. [Google Scholar] [CrossRef]
Linaldeddu, B.T.; Deidda, A.; Scanu, B.; Franceschini, A.; Serra, S. Diversity of Botryosphaeriaceae species associated with grapevine and other woody hosts in Italy, Algeria and Tunisia, with descriptions of Lasiodiplodia exigua and Lasiodiplodia mediterranea sp. nov. Fungal Divers. 2015, 71, 201–214. [Google Scholar] [CrossRef]
Giambra, S.; Piazza, G.; Alves, A.; Mondello, V.; Berbegal, M. Botryosphaeriaceae species associated with diseased loquat trees in Italy and description of Diplodia rosacearum sp. nov. Mycosphere 2016, 7, 978–989. [Google Scholar] [CrossRef]
Marsberg, A.; Kemlera, M.; Jami, F.; Nagela, J.H. Botryosphaeria dothidea: A latent pathogen of global importance to woody plant health. Mol. Plant Pathol. 2017, 18, 477–488. [Google Scholar] [CrossRef] [PubMed]

Figure 1. Maximum likelihood tree based on analysis of combined ITS, LSU, and tef sequences of selected Botryosphaeriales taxa. Bootstrap values of ML, MP >75% are shown near nodes and branches in bold indicate BI probabilities >0.95. Isolates obtained in this study are in blue for known species, and novel taxa are in red. Ex-type strains are in bold. The tree is rooted to Lecanosticta acicola (LNPV252). The scale bar represents the expected number of nucleotide substitutions per site.

Table 1. Botryosphaeriales species isolated and characterized in this study. The details of the type species of novel taxa are given in bold. N/A: No sequence available.

Species Name	Isolate Number	Location	Date	ITS	LSU	tef
Aplosporella hesperidica	GZCC 19-0095	Fanjing mountain, Tongren District	July 2018	MZ781423	MZ781490	MZ852496
Barriopsis tectonae	GZCC 19-0266	Maolan natural reserve, Libo District	July 2017	MZ781424	MZ781491	MZ852497
Botryobambusa guizhouensis	CGMCC 3. 20348	Forest Park, Chishui District	July 2019	MZ781425	MZ781492	MZ852498
	GZCC 19-0734	Forest Park, Chishui District	July 2019	MZ781426	MZ781493	MZ852499
Botryosphaeria dothidea	GZCC 20-0524	Huaxi wetland park, Guiyang District	April 2017	MZ781435	N/A	MZ852508
	GZCC 20-0525	Xingyi Wanfenglin	June 2019	MZ781436	N/A	MZ852509
	GZCC 20-0526	Xingyi Wanfenglin	June 2019	MZ781437	N/A	MZ852510
	GZCC 20-0527	Suiyang broad water nature reserve	April 2018	MZ781438	N/A	MZ852511
	GZCC 20-0528	Forest Park, Chishui District	July 2019	MZ781439	N/A	MZ852512
	GZCC 20-0529	Suiyang broad water nature reserve	April 2018	MZ781440	N/A	MZ852513
	GZCC 20-0530	Suiyang broad water nature reserve	April 2018	MZ781441	N/A	MZ852514
	GZCC 20-0531	Xiaochehe wetland park, Guiyang District	May 2017	MZ781442	N/A	MZ852515
	GZCC 20-0532	Forest Park, Chishui District	July 2019	MZ781443	N/A	MZ852516
	GZCC 20-0533	Huaxi wetland park, Guiyang District	April 2017	MZ781444	N/A	MZ852517
	GZCC 20-0534	Suiyang broad water nature reserve	April 2018	MZ781445	N/A	MZ852518
	GZCC 20-0535	Xiaochehe wetland park, Guiyang District	May 2017	MZ781446	N/A	MZ852519
	GZCC 20-0536	Xiaochehe wetland park, Guiyang District	May 2017	MZ781447	N/A	MZ852520
	GZCC 20-0537	Huaxi wetland park, Guiyang District	April 2017	MZ781448	N/A	MZ852521
	GZCC 20-0538	Forest Park, Chishui District	July 2019	MZ781449	N/A	MZ852522
	GZCC 20-0539	Forest Park, Chishui District	July 2019	MZ781450	N/A	MZ852523
	GZCC 20-0540	Huaxi wetland park, Guiyang District	April 2017	MZ781451	N/A	MZ852524
	GZCC 20-0541	Forest Park, Chishui District	July 2019	MZ781452	N/A	MZ852525
	GZCC 20-0542	Forest Park, Chishui District	July 2019	MZ781453	N/A	MZ852526
	GZCC 20-0543	Xiaochehe wetland park, Guiyang District	May 2017	MZ781454	N/A	MZ852527
	GZCC 20-0544	Suiyang broad water nature reserve	April 2018	MZ781455	N/A	MZ852528
	GZCC 20-0545	Xingyi Wanfenglin	June 2019	MZ781456	N/A	MZ852529
	GZCC 20-0546	Xiaochehe wetland park, Guiyang District	May 2017	MZ781457	N/A	MZ852530
Diplodia mutila	GZCC 20-0547	Xingyi Wanfenglin	June 2019	MZ781459	N/A	MZ852531
	GZCC 20-0548	Huaxi wetland park, Guiyang District	April 2017	MZ781460	N/A	MZ852532
Di. neojuniperi	GZCC 19-0191	Maolan natural reserve, Libo District	July 2017	MZ781463	N/A	MZ852533
Di. pseudoseriata	GZCC 19-0072	Xingyi Wanfenglin	June 2019	MZ781461	N/A	MZ852534
Di. sapinea	GZCC 19-0075	Suiyang broad water nature reserve	April 2018	MZ781462	N/A	MZ852535
Di. seriata	GZCC 19-0548	Xiaochehe wetland park, Guiyang District	May 2017	MZ781458	N/A	MZ852536
Dothiorella sarmentorum	GZCC 19-0092	Xingyi Wanfenglin	June 2019	MZ781464	N/A	MZ852537
Do. yunnana	GZCC 19-0175	Suiyang broad water nature reserve	April 2018	MZ781465	N/A	MZ852538
Lasiodiplodia pseudotheobromae	GZCC 19-0162	Xiaochehe wetland park, Guiyang District	May 2017	MZ781466	N/A	MZ852539
	GZCC 19-0184	Xiaochehe wetland park, Guiyang District	May 2017	MZ781467	N/A	MZ852540
	GZCC 19-0227	Huaxi wetland park, Guiyang District	April 2017	MZ781468	N/A	MZ852541
	GZCC 20-1575	Xiaochehe wetland park, Guiyang District	May 2017	MZ781469	N/A	MZ852542
	GZCC 19-0063	Suiyang broad water nature reserve	April 2018	MZ781470	N/A	MZ852543
Neofusicoccum parvum	GZCC 19-0123	Xiaochehe wetland park, Guiyang District	May 2017	MZ781471	N/A	MZ852544
	GZCC 19-0198	Xingyi Wanfenglin	June 2019	MZ781472	N/A	MZ852545
	GZCC 19-0218	Xingyi Wanfenglin	June 2019	MZ781473	N/A	MZ852546
	GZCC 19-2013	Maolan natural reserve, Libo District	July 2017	MZ781474	N/A	MZ852547
	GZCC 20-0549	Xiaochehe wetland park, Guiyang District	May 2017	MZ781475	N/A	MZ852548
	GZCC 20-0550	Xiaochehe wetland park, Guiyang District	May 2017	MZ781476	N/A	MZ852549
	GZCC 20-0551	Xingyi Wanfenglin	June 2019	MZ781477	N/A	MZ852550
	GZCC 20-0552	Xiaochehe wetland park, Guiyang District	May 2017	MZ781478	N/A	MZ852551
	GZCC 20-0553	Huaxi wetland park, Guiyang District	April 2017	MZ781479	N/A	MZ852552
	GZCC 20-0554	Xiaochehe wetland park, Guiyang District	May 2017	MZ781480	N/A	MZ852553
	GZCC 20-0555	Suiyang broad water nature reserve	April 2018	MZ781481	N/A	MZ852554
	GZCC 20-0556	Xiaochehe wetland park, Guiyang District	May 2017	MZ781482	N/A	MZ852555
Sardiniella celtidis	GZCC 19-0248	Xingyi Wanfenglin	June 2019	MZ781427	MZ781494	MZ852500
Sa. elliptica	CGMCC 3.20349	Huaxi wetland park, Guiyang District	April 2017	MZ781429	MZ781496	MZ852502
	GZCC 19-0245	Xingyi Wanfenglin	June 2019	MZ781431	MZ781498	MZ852504
	GZCC 19-0262	Maolan natural reserve, Libo District	July 2017	MZ781430	MZ781497	MZ852503
Sa. guizhouensis	GZCC 19-0229	Maolan natural reserve, Libo District	July 2017	MZ781428	MZ781495	MZ852501
Sphaeropsis citrigena	GZCC 20-0557	Xingyi Wanfenglin	June 2019	MZ781432	MZ781499	MZ852505
Sp. guizhouensis	CGMCC 3.20352	Maolan natural reserve, Libo District	July 2017	MZ781433	MZ781500	MZ852506
	GZCC 19-0273	Xingyi Wanfenglin	June 2019	MZ781434	MZ781501	MZ852507

Table 2. Details of gene regions, respective primer pairs, primer sequences, and PCR conditions used in the study.

Gene Region	Primers	Sequence 5′-3′	Optimized PCR Protocols	References
ITS	ITS1	TCCGTAGGTGAACCTGCGG	94 °C: 5 min, (94 °C: 30 s, 55 °C: 50 s, 72 °C: 1 min) × 34 cycles 72 °C: 10 min	White et al. [26]
ITS	ITS4	TCCTCCGCTTATTGATATGC		White et al. [26]
LSU	LR0R	ACCCGCTGAACTTAAGC	94 °C: 5 min, (94 °C: 30 s, 54 °C: 50 s, 72 °C: 1 min) × 34 cycles 72 °C: 10 min	Vilgalys and Hester [27]
LSU	LR5	TCCTGAGGGAAACTTCG		Vilgalys and Hester [27]
tef	EF1-728F	CATCGAGAAGTTCGAGAAGG	95 °C: 5 min, (95 °C: 30 s, 58 °C: 30 s, 72 °C: 1 min) × 34 cycles 72 °C: 10 min	Carbone and Kohn [28]
tef	EF1-986R	TACTTGAAGGAACCCTTACC		Carbone and Kohn [28]

Table 3. Botryosphaeriales taxa used in the phylogenetic analysis. The culture collection accession number for the type strains are given in bold. N/A: No sequence available.

Species Name	Isolate Number	ITS	LSU	tef
Aplosporellaceae
Alanomyces indica	CBS 134264	HF563622	HF563623	AB872219
Aplosporella africana	CBS 121777	KF766196	EU101380	EU101360
A. africana	CBS 121778	EU101316	EU101381	EU101361
A. artocarpi	CPC 22791	KM006450	N/A	KM006481
A. ginkgonis	CFCC 52442	MH133916	MH133933	MH133950
A. ginkgonis	CFCC 89661	KM030583	KM030590	KM030597
A. hesperidica	CBS 732.79	KX464083	KX464239	N/A
A. hesperidica	CBS 208.37	JX681069	MH867398	N/A
A. javeedii	CFCC 50054	KP208840	KP208843	KP208846
A. javeedii	CFCC 50052	KP208838	KP208841	KP208844
A. macropycnidia	CGMCC 3.17725	KT343648	N/A	KX011176
A. macropycnidia	CGMCC 3.17726	KT343649	N/A	KX011177
A. papillata	CBS 121780	EU101328	EU101383	EU101373
A. papillata	CBS 121781	EU101329	EU101384	EU101374
A. prunicola	CBS 121167	KF766147	KF766315	N/A
A. prunicola	STE-U 6326	EF564375	EF564377	N/A
A. sophorae	CPC 29688	KY173388	KY173482	N/A
A. thailandica	MFLU 16-0615	KX423536	N/A	KX423537
A. yalgorensis	MUCC511	EF591926	EF591943	EF591977
A. yalgorensis	MUCC512	EF591927	EF591944	EF591978
Botryosphaeriaceae
Alanphillipsia aloeicola	CBS 138896	KP004444	KP004472	N/A
A. euphorbiae	CPC 21628	KF777140	KF777196	N/A
Barriopsis fusca	CBS 174.26	EU673330	DQ377857	EU673296
Ba. iraniana	IRAN1448C	FJ919663	KF766318	FJ919652
Ba. iraniana	IRAN1449C	FJ919665	N/A	FJ919654
Ba. tectonae	MFLUCC 12-0381	KJ556515	N/A	KJ556516
Botryobambusa fusicoccum	MFLUCC 11-0143	JX646792	JX646809	JX646857
Bo. fusicoccum	MFLUCC 11-0657	JX646793	JX646810	JX646858
Botryosphaeria agaves	MFLUCC 11-0125	JX646791	JX646808	JX646856
B. agaves	MFLUCC 10-0051	JX646790	JX646807	JX646855
B. corticis	CBS 119047	DQ299245	EU673244	EU017539
B. corticis	ATCC 22927	DQ299247	EU673245	EU673291
B. dothidea	CMW8000	AY236949	DQ377852	AY236898
B. dothidea	CBS 110302	AY259092	EU673243	AY573218
B. dothidea	CMW 25413	KF766167	KF766332	EU101348
B. dothidea	GZCC 16-0013	KX447675	N/A	KX447678
B. dothidea	GZCC 16-0014	KX447676	N/A	KX447679
B. dothidea	CGMCC 3.17722	KT343254	N/A	KU221233
B. dothidea	CGMCC 3.17724	KT343256	N/A	KU221234
B. dothidea	CGMCC 3.18744	KX278002	N/A	KX278107
B. dothidea	CGMCC 3.18745	KX278003	N/A	KX278108
B. dothidea	CGMCC3.20094	MT327839	N/A	MT331606
B. dothidea	GZCC 19-0186	MT327832	N/A	MT331600
B. dothidea	GZCC 19-0188	MT327833	N/A	MT331601
B. fabicerciana	CMW27094	HQ332197	N/A	HQ332213
B. fabicerciana	CMW27108	HQ332200	N/A	HQ332216
B. fabicerciana	MFLUCC 10-0098	JX646789	JX646806	JX646854
B. fabicerciana	MFLUCC 11-0507	JX646788	JX646805	JX646853
B. kuwatsukai	CBS 135219	KJ433388	N/A	KJ433410
B. kuwatsukai	LSP5	KJ433395	N/A	KJ433417
B. kuwatsukai	CGMCC 3.18007	KX197074	N/A	KX197094
B. kuwatsukai	CGMCC 3.18008	KX197075	N/A	KX197095
B. qingyuanensis	CGMCC 3.18742	KX278000	N/A	KX278105
B. qingyuanensis	CGMCC 3.18743	KX278001	N/A	KX278106
B. ramosa	CBS 122069	EU144055	N/A	EU144070
B. ramosa	CGMCC 3.18739	KX277988	N/A	KX278093
B. ramosa	CGMCC 3.18740	KX277989	N/A	KX278094
B. scharifii	IRAN1529C	JQ772020	N/A	JQ772057
B. scharifii	IRAN1543C	JQ772019	N/A	JQ772056
Cophinforma eucalypti	MFLUCC 11-0655	JX646801	JX646818	JX646866
C. mamane	CBS 117444	KF531822	DQ377855	KF531801
Diplodia africana	CBS 120835	EF445343	N/A	EF445382
Di. africana	CBS 121104	EF445344	N/A	EF445383
Di. agrifolia	CBS 132777	JN693507	N/A	JQ517317
Di. agrifolia	UCROK1429	JQ411412	N/A	JQ512121
Di. allocellula	CBS 130408	JQ239397	JQ239410	JQ239384
Di. allocellula	CBS 130410	JQ239399	JQ239412	JQ239386
Di. arengae	MFLU 17-2769	MG762771	N/A	MG762774
Di. bulgarica	CBS 124135	GQ923853	N/A	GQ923821
Di. bulgarica	CBS 124254	GQ923852	N/A	GQ923820
Di. corticola	CBS 112546	AY259100	AY928051	AY573227
Di. corticola	CBS 112549	AY259110	EU673262	DQ458872
Di. crataegicola	MFLU 15-1311	KT290244	N/A	KT290248
Di. cupressi	CBS 168.87	DQ458893	EU673263	DQ458878
Di. cupressi	CBS 261.85	DQ458894	EU673264	DQ458879
Di. eriobotryicola	BN 21	MT587342	N/A	MT592047
Di. estuarina	CMW41231	KP860831	N/A	KP860676
Di. estuarina	CMW41230	KP860830	N/A	KP860675
Di. fraxini	CBS 136010	KF307700	N/A	KF318747
Di. galiicola	MFLU 15-1310	KT290245	N/A	KT290249
Di. gallae	CBS 213.25	KX464092	N/A	KX464566
Di. malorum	CBS 124130	GQ923865	N/A	GQ923833
Di. malorum	CBS 112554	AY259095	N/A	DQ458870
Di. mutila	CBS 112553	AY259093	AY928049	AY573219
Di. mutila	CBS 230.30	DQ458886	AY928049	DQ458869
Di. mutila	CBS 121862	KX464093	N/A	KX464567
Di. neojuniperi	CPC22753	KM006431	N/A	KM006462
Di. olivarum	CBS 121887	EU392302	N/A	EU392279
Di. olivarum	CBS 121886	EU392297	N/A	EU392274
Di. pseudoseriata	CBS 124906	EU080927	MH874931	EU863181
Di. pseudoseriata	CBS 124907	EU080922	N/A	EU863179
Di. pseudoseriata	CBS 124931	FJ888460	MH874935	FJ888444
Di. pseudoseriata	CBS 124933	FJ888478	N/A	FJ888446
Di. pseudoseriata	CBS 140350	KX833072	N/A	KX833073
Di. quercivora	CBS 133852	JX894205	N/A	JX894229
Di. rosulata	CBS 116470	EU430265	DQ377896	EU430267
Di. rosulata	CBS 116472	EU430266	DQ377897	EU430268
Di. sapinea	CBS 393.84	DQ458895	DQ377893	DQ458880
Di. sapinea	CBS 109725	DQ458896	EU673270	DQ458881
Di. sapinea	CBS 124462	GQ923858	MH874896	GQ923826
Di. sapinea	CBS 124134	HM036528	N/A	GQ923851
Di. sapinea	CBS 141915	KT956270	N/A	KU378605
Di. scrobiculata	CBS 118110	AY253292	KF766326	AY624253
Di. scrobiculata	CBS 109944	DQ458899	EU673268	DQ458884
Di. scrobiculata	CBS 113423	DQ458900	EU673267	DQ458885
Di. seriata	CBS 112555	AY259094	AY928050	AY573220
Di. seriata	CBS 119049	DQ458889	EU673266	DQ458874
Di. subglobosa	CBS 124133	GQ923856	N/A	GQ923824
Di. tsugae	CBS 418.64	DQ458888	DQ377867	DQ458873
Dothiorella acacicola	CPC26349	KX228269	KX228320	KX228376
Do. acericola	KUMCC 18-0137	KY385661	N/A	KY393212
Do. alpina	CGMCC 3.18001	KX499645	N/A	KX499651
Do. brevicollis	CBS 130411	JQ239403	JQ239416	JQ239390
Do. capri-amissi	CBS 121763	EU101323	N/A	EU101368
Do. capri-amissi	CMW25404	EU101324	N/A	EU101369
Do. casuarinae	CBS 120688	DQ846773	N/A	DQ875331
Do. casuarinae	CBS 120690	DQ846774	N/A	DQ875333
Do. citricola	ICMP 16828	EU673323	N/A	EU673290
Do. citricola	ICMP 16827	EU673322	N/A	EU673289
Do. dulcispinae	CBS 130413	JQ239400	JQ239413	JQ239387
Do. dulcispinae	CBS 121765	EU101300	KX464317	EU101345
Do. iranica	IRAN1587C	KC898231	N/A	KC898214
Do. juglandis	CBS 188.87	EU673316	DQ377891	EU673283
Do. lampangensis	MFLUCC 18-0232	MK347758	N/A	MK340869
Do. longicollis	CBS 122068	EU144054	MH874718	EU144069
Do. longicollis	CBS 122066	EU144052	KX464311	EU144067
Do. magnoliae	CFCC 51563	KY111248	N/A	KY213687
Do. mangifericola	IRAN1584C	MT587407	N/A	MT592119
Do. mangifericola	IRAN1545C	KC898221	N/A	KX464614
Do. mangifericola	CBS 121760	KF766227	N/A	EU101335
Do. mangifericola	CBS 121761	EU101293	N/A	EU101338
Do. moneti	MUCC 505	EF591920	EF591937	EF591971
Do. moneti	MUCC 507	EF591922	EF591939	EF591973
Do. plurivora	IRAN1557C	KC898225	N/A	KC898208
Do. plurivora	IRAN1537C	KC898226	N/A	KC898209
Do. pretoriensis	CBS 130404	JQ239405	JQ239418	JQ239392
Do. pretoriensis	CBS 130403	JQ239406	JQ239419	JQ239393
Do. prunicola	IRAN1541	EU673313	EU673232	EU673280
Do. rhamni	MFLUCC 14-0902	KU246381	KU246382	N/A
Do. rhamni	BN 81	MT587399	N/A	MT592111
Do. santali	MUCC 509	EF591924	EF591941	EF591975
Do. santali	MUCC 508	EF591923	EF591940	EF591974
Do. sarmentorum	IMI63581b	AY573212	AY928052	AY573235
Do. sarmentorum	CBS 115038	AY573206	DQ377860	AY573223
Do. sarmentorum	CBS 128309	HQ288218	MH876298	HQ288262
Do. sarmentorum	CBS 128310	HQ288219	MH876299	HQ288263
Do. sarmentorum	CBS 141587	KX357188	N/A	KX357211
Do. sarmentorum	MFLUCC 17-0242	KY797637	KY815014	KY815020
Do. sarmentorum	CBS 115045	AY573202	AY928053	AY573222
Do. sarmentorum	CBS 113188	AY573198	EU673230	EU673278
Do. sarmentorum	MFLUCC 17-0951	MF398891	N/A	MF398943
Do. sarmentorum	CBS 140349	KP205497	N/A	KP205470
Do. sarmentorum	CBS 188.87	EU673316	DQ377891	EU673283
Do. sarmentorum	IRAN1579C	KC898234	N/A	KC898217
Do. sarmentorum	IRAN1585C	KC898235	N/A	KC898218
Do. sarmentorum	IRAN1583C	KC898236	N/A	KC898219
Do. sarmentorum	IRAN1581C	KC898237	N/A	KC898220
Do. sarmentorum	MFLUCC 13-0497	KJ742378	N/A	KJ742381
Do. sarmentorum	MFLUCC 13-0196	KU234782	N/A	KU234796
Do. sarmentorum	DAR78992	EU768874	N/A	EU768881
Do. sarmentorum	DAR78993	EU768876	N/A	EU768882
Do. striata	ICMP 16824	EU673320	EU673240	EU673287
Do. striata	ICMP 16819	EU673320	EU673239	EU673287
Do. striata	DAR 80992	KJ573643	N/A	KJ573640
Do. styphnolobii	JZB3150013	MH880849	N/A	MK069594
Do. tectonae	MFLUCC 12-0382	KM396899	N/A	KM409637
Do. thailandica	MFLUCC 11-0438	JX646796	JX646813	JX646861
Do. thripsita	BRIP 51876	FJ824738	N/A	KJ573639
Do. ulmacea	CBS 138855	KR611881	KR611899	KR611910
Do. uruguayensis	CBS 124908	EU080923	MH874932	EU863180
Do. vinea gemmae	DAR81012	KJ573644	N/A	KJ573641
Do. viticola	CBS 117009	AY905554	MH874565	AY905559
Do. viticola	CBS 117006	AY905555	EU673236	AY905562
Do. viticola	DAR80529	HM009376	N/A	HM800511
Do. viticola	DAR80530	HM009378	N/A	HM800513
Do. yunnana	CGMCC 3.17999	KX499643	N/A	KX499649
Endomelanconiopsis endophytica	CBS 120397	EU683656	EU683629	EU683637
E. microspora	CBS 353.97	EU683655	KF766330	EU683636
Lasiodiplodia americana	CERC1960	KP217058	N/A	KP217066
L. americana	CERC1961	KP217059	N/A	KP217067
L. avicenniae	CMW41467	KP860835	N/A	KP860680
L. avicenniarum	MFLUCC 17-2591	MK347777	MK347994	MK340867
L. brasiliense	CMM4015	JX464063	N/A	JX464049
L. brasiliense	CMM2185	KC484800	N/A	KC481530
L. bruguierae	CMW42480	KP860832	N/A	KP860677
L. chonburiensis	MFLUCC 16-0376		N/A
L. cinnamomi	CFCC 51997	MG866028	N/A	MH236799
L. citricola	CBS 124707	GU945354	N/A	GU945340
L. citricola	IRAN1521C	GU945353	N/A	GU945339
L. crassispora	CBS 118741	DQ103550	DQ377901	EU673303
L. crassispora	WAC12534	DQ103551	N/A	DQ103558
L. crassispora	CBS 110492	EF622086	EU673251	EF622066
L. crassispora	CBS 121770	EU101307	N/A	EU101352
L. crassispora	CBS 121771	EU101308	N/A	EU101353
L. euphorbicola	CMM3609	KF234543	N/A	KF226689
L. euphorbicola	IBL329	KT247490	N/A	KT247492
L. gilanensis	CBS 124704	GU945351	N/A	GU945342
L. gilanensis	IRAN1501C	GU945352	N/A	GU945341
L. gilanensis	CBS 128311	HQ288225	N/A	HQ288267
L. gilanensis	UCD2199MO	HQ288226	N/A	HQ288268
L. gonubiensis	CBS 115812	AY639595	DQ377902	DQ103566
L. gonubiensis	CBS 116355	AY639594	EU673252	DQ103567
L. gravistriata	CMM4564	KT250949	N/A	KT250950
L. hormozganensis	CBS 124709	GU945355	N/A	GU945343
L. hormozganensis	CBS 124708	GU945356	N/A	GU945344
L. iraniensis	CBS 124710	GU945346	MH874918	GU945334
L. iraniensis	CBS 124711	GU945347	N/A	GU945335
L. iraniensis	CMM3610	MT587430	N/A	MT592142
L. iraniensis	CMM0247	MT587431	N/A	MT592143
L. laeliocattleyae	CBS 167.28	KU507487	N/A	KU507454
L. laeliocattleyae	CBS 130992	JN814397	N/A	JN814424
L. laeliocattleyae	CMM3611	JN814401	N/A	JN814428
L. lignicola	CBS 134112	JX646797	N/A	KU887003
L. lignicola	MFLUCC 11-0656	JX646797	JX646815	KU887003
L. lignicola	CGMCC 3.18061	KX499889	N/A	KX499927
L. lignicola	CBS 342.78	KX464140	N/A	KX464634
L. macrospora	CMM3833	KF234557	N/A	KF226718
L. mahajangana	CBS 124927	FJ900597	N/A	FJ900643
L. mahajangana	CBS 124925	FJ900595	N/A	FJ900641
L. mahajangana	IBL352	KT154759	N/A	KT154753
L. mahajangana	CMM1325	KT154760	N/A	KT008006
L. mahajangana	CBS 137785	KJ638317	N/A	KJ638336
L. mahajangana	BL184	KJ638318	N/A	KJ638337
L. mahajangana	MFLUCC 16-0265	MH275068	MH260301	MH412774
L. margaritacea	CBS 122519	EU144050	N/A	EU144065
L. margaritacea	CBS 122065	EU144051	N/A	EU144066
L. marypalme	CMM2275	KC484843	N/A	KC481567
L. marypalme	CMM2271	KC484844	N/A	KC481568
L. mediterranea	CBS 137783	KJ638312	N/A	KJ638331
L. mediterranea	ALG36	KJ638314	N/A	KJ638333
L. parva	CBS 456.78	EF622083	KF766362	EF622063
L. parva	CBS 494.78	EF622084	EU673258	EF622064
L. parva	CBS 356.59	AY343482	N/A	EF445396
L. plurivora	CBS 120832	EF445362	KX464356	EF445395
L. plurivora	CBS 121103	AY343482	KX464357	EF445396
L. pontae	CMM1277	KT151794	N/A	KT151791
L. pontae	IBL14	KT151794	N/A	KT151791
L. pseudotheobromae	CBS 116459	EF622077	EU673256	EF622057
L. pseudotheobromae	CBS 447.62	EF622081	MH869806	EF622060
L. rubropurpurea	CBS 118740	DQ103553	DQ377903	EU673304
L. rubropurpurea	WAC12536	DQ103554	N/A	DQ103572
L. subglobosa	CMM3872	KF234558	N/A	KF226721
L. subglobosa	CMM4046	KF234560	N/A	KF226723
L. thailandica	CPC22795	KJ193637	N/A	KJ193681
L. thailandica	CGMCC 3.17975	KX499879	MG321677	KX499917
L. thailandica	MFLUCC 18-0244	MK347789	N/A	MK340870
L. theobromae	CBS 164.96	AY640255	EU673253	AY640258
L. theobromae	CBS 124.13	DQ458890	AY928054	DQ458875
L. theobromae	CBS 111530	EF622074	N/A	EF622054
L. theobromae	CAA006	DQ458891	EU673254	DQ458876
L. theobromae	CBS 164.96	AY640255	EU673253	AY640258
L. venezuelensis	CBS 118739	DQ103547	DQ377904	EU673305
L. venezuelensis	WAC12540	DQ103548	N/A	DQ103569
L. viticola	CBS 128313	HQ288227	KX098286	HQ288269
L. viticola	CBS 128315	HQ288228	N/A	HQ288270
L. vitis	CBS 124060	KX464148	N/A	MN938928
Lecanosticta acicola	LNPV252	JX901755	JX901844	JX901639
Macrophomina phaseolina	CBS 227.33	KF951627	DQ377906	KF952000
Neodeightonia palmicola	MFLUCC 10-0822	HQ199221	HQ199222	N/A
N. phoenicum	CBS 122528	EU673340	EU673261	EU673309
N. subglobosa	CBS 448.91	EU673337	DQ377866	EU673306
Neofusicoccum arbuti	CBS 116131	AY819720	DQ377915	KF531792
N. arbuti	UW13	AY819724	N/A	KF531791
N. arbuti	CBS 117453	AY693976	DQ377914	AY693977
N. arbuti	CMW13446	DQ306263	N/A	DQ306264
N. australe	CMW6837	AY339262	KF766367	AY339270
N. australe	CMW6853	AY339263	N/A	AY339271
N. brasiliense	CMM1338	JX513630	N/A	JX513610
N. buxi	CBS 116.75	KX464164	KX464406	KX464677
N. cordaticola	CBS 123634	EU821898	MH874849	EU821868
N. cordaticola	CBS 123635	EU821903	KX464410	EU821873
N. cryptoaustrale	CMW23785	FJ752742	N/A	FJ752713
N. eucalypticola	CBS 115679	AY615141	N/A	AY615133
N. eucalypticola	CBS 115766	AY615143	N/A	AY615135
N. eucalyptorum	CBS 115791	AF283686	N/A	AY236891
N. eucalyptorum	CMW10126	AF283687	N/A	AY236892
N. grevilleae	CBS 129518	JF951137	N/A	N/A
N. hellenicum	CERC1947	KP217053	N/A	KP217061
N. hongkongensis	CERC 2973	KX278052	MF410096	KX278157
N. illicii	CGMCC 3.18311	KY350150	N/A	KY817756
N. kwambonambiense	EU821900	EU821900	N/A	EU821870
N. kwambonambiense	CMW14140	EU821919	N/A	EU821889
N. lumnitzerae	CMW41469	KP860881	N/A	KP860724
N. luteum	CBS 110299	AY259091	AY928043	AY573217
N. luteum	CBS 110497	EU673311	N/A	EU673277
N. luteum	CMW41365	KP860859	N/A	KP860702
N. macroclavatum	CBS 118223	DQ093196	N/A	DQ093217
N. macroclavatum	WAC12446	DQ093197	N/A	DQ093218
N. mangiferae	CBS 118532	AY615185	DQ377921	DQ093221
N. mangiferae	CMW7797	AY615186	N/A	DQ093220
N. mediterraneum	CBS 121718	GU251176	MH874696	GU251308
N. mediterraneum	CBS 121558	GU799463	N/A	GU799462
N. mediterraneum	CBS 113083	KX464186	KX464465	KX464712
N. mediterraneum	CBS 113089	KX464199	N/A	KX464727
N. microconidium	CERC 3497	KX278053	MF410097	KX278158
N. nonquaesitum	CBS 126655	GU251163	MH875645	GU251295
N. nonquaesitum	PD301	GU251164	N/A	GU251296
N. occulatum	CBS 128008	EU301030	MH876179	EU339509
N. occulatum	MUCC286	EU736947	N/A	EU339511
N. parvum	CMW9081	AY236943	AY928045	AY236888
N. parvum	CBS 110301	AY259098	AY928046	AY573221
N. parvum	CBS 137504	KJ657702	N/A	KJ657715
N. parvum	ALG9	KJ657704	N/A	KJ657721
N. parvum	MFLUCC 15-0900	KY856755	N/A	KY856754
N. pennatisporum	WAC13153	EF591925	EF591942	EF591976
N. pistaciae	CBS 595.76	KX464163	KX464404	KX464676
N. protearum	STE-U 4361	AF196295	N/A	N/A
N. protearum	STE-U 1775	AF452539	N/A	N/A
N. ribis	CMW7772	AY236935	N/A	AY236877
N. ribis	CBS 121.26	AF241177	N/A	AY236879
N. ribis	CBS 124923	FJ900607	N/A	FJ900653
N. ribis	CBS 124924	FJ900608	N/A	FJ900654
N. ribis	CMW14058	EU821904	N/A	EU821874
N. ribis	CMW14060	EU821905	N/A	EU821875
N. sinense	CGMCC 3.18315	KY350148	N/A	KY817755
N. sinoeucalypti	CERC 2005	KX278061	MF410105	KX278166
N. stellenboschiana	CBS 110864	AY343407	KX464513	AY343348
N. terminaliae	CBS 125264	GQ471802	N/A	GQ471780
N. ursorum	CBS 122811	FJ752746	MH874765	FJ752709
N. viticlavatum	CBS 112878	AY343381	MH874474	AY343342
N. viticlavatum	CBS 112977	AY343380	KX464528	AY343341
N. vitifusiforme	CBS 110887	AY343383	MH874455	AY343343
N. vitifusiforme	CBS 110880	AY343382	KX464475	AY343344
N. vitifusiforme	CBS 120081	DQ923533	MN162190	KX464682
N. vitifusiforme	CBS 121112	EF445349	N/A	EF445391
Oblongocollomyces variabile	CBS 121774	NR136994	KX464536	EU101357
O. variabile	CMW25420	EU101313	N/A	EU101358
O. variabile	CMW25421	EU101314	N/A	EU101359
Phaeobotryon mamane	CPC 12264	EU673331	DQ377898	EU673297
P. mamane	CBS 122980	EU673332	EU673248	EU673298
Sardiniella celtidis	MFLUCC 17-981	MF443249	N/A	MF443248
Sa. urbana	BL180	KX379677	KX379679	KX379678
Sa. urbana	BL181	KX379680	KX379682	KX379681
Sa. urbana	CBS 141580	KX379674	KX379676	KX379675
Sphaeropsis citrigena	ICMP16812	EU673328	EU673246	EU673294
Sp. citrigena	ICMP16818	EU673329	EU673247	EU673295
Sp. eucalypticola	MFLUCC 11-0579	JX646802	JX646819	JX646867
Sp. eucalypticola	MFLUCC 11-0654	JX646803	JX646820	JX646868
Sp. porosa	CBS 110496	AY343379	DQ377894	AY343340
Sp. porosa	CBS 110574	AY343378	DQ377895	AY343339
Sp. visci	CBS 100163	EU673324	N/A	EU673292
Sp. visci	CBS 186.97	EU673325	DQ377868	EU673293
Tiarosporella graminis-karoo	CBS 118718	KF531828	DQ377939	KF531807
Melanopsaceae
Melanops sp.	CBS 118.39	FJ824771	DQ377856	FJ824776
M. tulasnei	CBS 116805	FJ824769	KF766365	FJ824774
M. tulasnei	CBS 116806	FJ824770	FJ824765	KX464644
Phyllostictaceae
Phyllosticta citricarpa	CBS 102374	FJ538313	DQ377877	FJ538376
P. minima	CBS 111635	KF766215	EU754194	KF766433
P. parthenocissi	CBS 111645	EU683672	DQ377876	EU683653
P. podocarpi	CBS 111647	KF766217	KF766383	KF766434
Pseudofusicoccum adansoniae	CMW 26147	KF766220	KF766386	N/A
P. ardesiacum	CMW 26159	EU144060	KF766387	N/A
P. kimberleyensis	CMW 26156	EU144057	KF766388	N/A
Planistromellaceae
Kellermania agaves	CPC 21713	KF777164	KF777217	N/A
K. confusa	CBS 131723	KF766174	KF766344	KF766405
K. micranthae	CBS 131724	KF766179	NG042706	KF766410
K. plurilocularis	CBS 131719	KF766181	KF766351	KF766412
K. yuccifoliorum	CBS 131726	KF766185	KF766355	KF766416
Umthunziomyces hagahagensis	CPC 29917	KY173472	KY173561	N/A
Saccharataceae
Neoseptorioides eucalypti	CBS 140665	KT950857	KT950871	KT950882
Saccharata banksiae	CPC 27698	KY173449	KY173539	KY173596
S. daviesiae	CPC 29174	KY173450	KY173540	N/A
S. proteae	CBS 115206	KF766226	DQ377882	GU349030
Septorioides pini-thunbergi	CBS 473.91	NR145234	KF251746	N/A
S. strobi	CBS 141443	KT884699	KT884685	KT884713

ALG: Personal culture collection of A. Berraf-Tebbal; ATCC: American Type Culture Collection, Virginia, USA; BL: Personal collection of B.T. Linaldeddu; BRIP: Culture collection, Queensland Department of Agriculture and Fisheries, Queensland, Australia; CAA: Personal culture collection of Artur Alves, Universidade de Aveiro, Portuga; CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CERC: Culture collection of China Eucalypt Research Centre, Chinese Academy of Forestry, ZhanJiang, GuangDong, China; CFCC: China Forestry Culture Collection Center, Beijing, China; CGMCC: China General Microbiological Culture Collection Center; CMM: Culture Collection of Phytopathogenic Fungi “Prof. Maria Menezes”, Universidade Federal Rural de Pernambuco, Recife, Brazil; CMW: Tree Patholgy Co-operative Program, Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa; CPC: Working collection of P.W. Crous, housed at CBS; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; GZCC: Guizhou Academy of Agricultural Sciences Culture Collection, GuiZhou, China; IBL: Personal culture collection of I.B.L. Coutinho; ICMP: International Collection of Microorganisms from Plants, Landcare Research, Aukland, New Zealand; IMI: International Mycological Institute, CBI-Bioscience, Egham, Bakeham Lane, UK; IRAN: Iranian Fungal Culture Collection, Iranian Research Institute of Plant Protection, Iran; KUMCC: Kunming University Culture Collection, Yunnan, China. MFLU: Mae Fah Luang University Herbarium Collection, Chiang Rai, Thailand; MFLUCC: Mae Fah Luang University Culture Collection, Chiang Rai, Thailand; MUCC: Murdoch University Culture Collection, Murdoch, Australia; PD: Culture collection, University of California, Davis, USA; STE-U: Culture collection of the Department of Plant Pathology, University of Stellenbosch, South Africa; UCD: University of California, Davis, Plant Pathology Department Culture Collection; UCROK: Culture collection, University of Riverside, California, USA; WAC: Department of Agriculture, Western Australia Plant Pathogen Collection, South Perth, Western Australia.

Table 4. Alignment details and comparison of MP, ML, and BI analyses results of each phylogenetic tree constructed in this study.

Character			Botryosphaeriales (Figure 1)	Botryosphaeria (Figure 10)	Diplodia (Figure 11)	Dothiorella (Figure 12)	Lasiodiplodia (Figure 13)	Neofusicoccum (Figure 14)
Number of base pairs in each gene region (including the gaps after alignment)			ITS (680), LSU (803), tef (374)	ITS (565), tef (265)	ITS (551), tef (331)	ITS (504), tef (343)	ITS (490), tef (344)	ITS (549), tef (253)
Number of isolates obtained in this study			12	23	6	2	5	12
Number of taxa originated from GenBank			95	32	49	68	78	65
Outgroup taxon			Lecanosticta acicula	Macrophomina phaseolina	Lasiodiplodia theobromae	Neofusicoccum parvum	Diplodia mutila	Dothiorella viticola
MP	Total number of characters		1857	830	882	847	834	802
	Constant characters		954	690	688	578	592	565
	Variable/parsimony uninformative characters		204	75	52	77	54	107
	Parsimony informative characters		704	70	146	202	192	134
	Number of parsimonious trees obtained		77	5	10	10	10	10
	Tree length (TL)		4199	180	385	725	559	463
	(CI)		0.393	0.911	0.644	0.568	0.612	0.646
	(RI)		0.762	0.938	0.865	0.835	0.857	0.865
	(RC)		0.300	0.854	0.557	0.475	0.524	0.559
	(HI)		0.607	0.089	0.356	0.432	0.388	0.354
ML	Final likelihood value		−22,205.648157	−2130.358718	−3417.346418	−4843.109271	−4183.640855	−3665.812286
	Number of distinct alignment patterns		1096	212	297	390	293	310
	Percentage of undetermined characters or gaps		26.52%	7.31%	11.38%	21.84%	8.52%	9.63%
	Base frequencies	A	0.223450	0.206023	0.207760	0.210373	0.213076	0.201476
		C	0.259348	0.298959	0.297528	0.293067	0.286249	0.297204
		G	0.288244	0.259350	0.261525	0.252521	0.258157	0.273045
		T	0.228958	0.235668	0.233187	0.244039	0.242519	0.228274
	Substitution rates	AC	1.251462	0.503912	0.982007	1.364862	0.729024	1.047005
		AG	2.644446	1.747452	3.644983	2.268590	2.724108	4.839820
		AT	1.415897	1.056533	0.863841	1.240011	1.053880	1.265619
		CG	1.353737	0.612519	1.681164	1.176948	0.817807	0.870409
		CT	4.677551	3.387698	4.528302	4.552526	4.062263	8.746955
		GT	1.000000	1.000000	1.000000	1.000000	1.000000	1.000000
	Gamma distribution rate parameter (alpha)		0.286904	0.231276	0.174245	0.234867	0.223197	0.268848
BI (model of each gene region)		ITS	SYM+I+G	GTR+I	GTR+I+G	HKY+I+G	SYM+I+G	GTR+I+G
BI (model of each gene region)		tef	HKY+G	GTR+G	HKY+I+G	GTR+G	HKY+I+G	HKY+G
Tree base ID			28690	28685	28686	28687	28688	28689
Reviewer access URL			http://purl.org/phylo/treebase/phylows/study/TB2:S28690?x-access-code=fe183dad30514d2dfbbfb8087dbbe53a&format=html	http://purl.org/phylo/treebase/phylows/study/TB2:S28685?x-access-code=ac877963f1b00fed7de4920660ebc78f&format=html	http://purl.org/phylo/treebase/phylows/study/TB2:S28686?x-access-code=9df25bff3d5c7c2faeb0029110c6675d&format=html	http://purl.org/phylo/treebase/phylows/study/TB2:S28687?x-access-code=382c7e58f8f7e3b815b9ae27dbe6f639&format=html	http://purl.org/phylo/treebase/phylows/study/TB2:S28688?x-access-code=e58fc08c292227a8965dd978203b449a&format=html	http://purl.org/phylo/treebase/phylows/study/TB2:S28689?x-access-code=7152a6819a1dd4ef1e743d4db1e0240c&format=html

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Dissanayake, A.J.; Chen, Y.-Y.; Cheewangkoon, R.; Liu, J.-K. Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China. J. Fungi 2021, 7, 893. https://doi.org/10.3390/jof7110893

AMA Style

Dissanayake AJ, Chen Y-Y, Cheewangkoon R, Liu J-K. Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China. Journal of Fungi. 2021; 7(11):893. https://doi.org/10.3390/jof7110893

Chicago/Turabian Style

Dissanayake, Asha J., Ya-Ya Chen, Ratchadawan Cheewangkoon, and Jian-Kui Liu. 2021. "Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China" Journal of Fungi 7, no. 11: 893. https://doi.org/10.3390/jof7110893

APA Style

Dissanayake, A. J., Chen, Y. -Y., Cheewangkoon, R., & Liu, J. -K. (2021). Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China. Journal of Fungi, 7(11), 893. https://doi.org/10.3390/jof7110893

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Occurrence and Morpho-Molecular Identification of Botryosphaeriales Species from Guizhou Province, China

Abstract

1. Introduction

2. Materials and Methods

2.1. Collection of Specimens, Isolation, Morphology, and Culture Characteristics

2.2. DNA Extraction and Molecular Based Amplification

2.3. Sequence Alignment and Phylogenetic Analyses

3. Results

3.1. Phylogenetic Analyses

3.2. Taxonomy

4. Discussion

5. Conclusions

Author Contributions

Funding

Acknowledgments

Conflicts of Interest

References

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI