Next Article in Journal
Continuous Fermentation Coupled with Online Gas Stripping for Effective Biobutanol Production
Next Article in Special Issue
Comparison of the Chemical and Microbial Composition and Aerobic Stability of High-Moisture Barley Grain Ensiled with Either Chemical or Viable Lactic Acid Bacteria Application
Previous Article in Journal
Bacterial Interactions with Nanoplastics and the Environmental Effects They Cause
Previous Article in Special Issue
Effects of Phenyllactic Acid on Fermentation Parameters, Nitrogen Fractions and Bacterial Community of High-Moisture Stylo Silage
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 9
Issue 11
10.3390/fermentation9110940
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Study on the Antibacterial Rule in Fermented Feed with Different Amounts of CaCO3 by Quantitative Real-Time Polymerase Chain Reaction

by
Jibin Li
†,
Xinyu Heng
,
Zhong Ni
and
Huayou Chen
*
School of Life Sciences, Jiangsu University, Zhenjiang 212013, China
*
Author to whom correspondence should be addressed.
†
Current address: Shandong Lukang Pharmaceutical Co., Ltd., Jining 272021, China.
Fermentation 2023, 9(11), 940; https://doi.org/10.3390/fermentation9110940
Submission received: 25 September 2023 / Revised: 25 October 2023 / Accepted: 26 October 2023 / Published: 30 October 2023
(This article belongs to the Special Issue Feed Fermentation: A Technology Using Microorganisms and Additives, 2nd Edition)
Browse Figures
Review Reports Versions Notes

Abstract

:
Fermented feed is needed to maintain the vitality of probiotics and cannot be sterilized. Fermented feeds, especially those with added CaCO3, have a high risk of contamination with pathogens. Escherichia coli, Staphylococcus aureus, and Shigella flexneri are the main pathogenic bacteria threatening animal breeding. This study developed a new microbial quantitative real-time PCR analysis method to investigate the antibacterial rule in fermented feed with different amounts of CaCO3. Moreover, using the qPCR method, we found that the feed pH decreased slowly with the increase of CaCO3 addition. In the early stage of fermentation, CaCO3 addition promoted three pathogenic bacteria growth. In the middle and late fermentation, CaCO3 addition inhibited the growth of Escherichia coli and Shigella flexneri, and the greater the CaCO3 addition, the stronger the inhibitory effect. The CaCO3 addition reduced the growth inhibition of Staphylococcus aureus, and the inhibition effect was weaker with the increase of CaCO3 addition. From the inhibitory effect on intestinal pathogenic bacteria such as Escherichia coli and Shigella flexneri, the optimal addition amount of CaCO3 was 12%. At this level of addition, the number of Lactiplantibacillus plantarum subsp. plantarum, Lacticaseibacillus rhamnosus, and Bacillus subtilis were also the highest, and the content of organic acids with antibacterial effects was also the highest. The addition of CaCO3 had an inhibitory effect on the growth of pathogenic bacteria, mainly attributed to the promotion of the growth of Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus, and the organic acid of its fermentation product had an inhibitory effect on pathogenic bacteria. This study provides theoretical guidance for the antibacterial rule of high-pH fermented feed with different amounts of CaCO3.

1. Introduction

Pathogenic bacteria (PB) are a huge threat to animal breeding. Main PB are Escherichia coli, Staphylococcus aureus and Shigella flexneri [1]. If an animal is infected with these PB, it will cause serious bodily disease and even death. Studies have reported that Escherichia coli infection can cause diarrhea, meningitis, sepsis, atherosclerosis, etc. [2], and Staphylococcus aureus infection can cause vomiting, diarrhea, and abdominal distension [3]. Animal feed is one of the main sources of PB. Traditional feed can be sterilized by high-temperature cooking and other methods. However, fermented feed is rich in a large number of probiotics, and sterilization before use will cause serious damage to the probiotics and greatly reduce the probiotic effect of fermented feed. Moreover, the water content of fermented feed is generally higher than that of traditional feed, and the possibility of spoilage leading to carrying PB is higher.
Soybean meal (SBM) and bean dregs (BDs) are high-quality raw materials for the production of fermented feed. SBM is known for its balanced amino acid composition and high protein content compared to other plant protein sources [4]. The protein content of SBM is generally 45–55%, of which more than 80% is water-soluble [5]. BDs are the by-products in the processing of soybean products such as soy milk and tofu, which are nutritious but inexpensive. BDs are high in fat, protein, isoflavones, and other nutrients [6]. The solid-state fermentation process is widely used in the production of fermented feed due to its simple equipment and low production cost [7]. Because some nutrients in BDs and SBM are destroyed in the process of high-temperature sterilization, their nutrient and energy utilization rates are very low, and their potential utilization value is not fully realized. Therefore, solid-state fermentation materials such as BDs and SBM often do not undergo sterilization treatment, and the fermentation process cannot achieve an absolutely sterile environment. This greatly increases the risk of carrying PB in fermented feed. The probiotics used in animal nutrition are mainly strains of different genera, such as Lactobacillus, Bacillus, Pediococcus, and Enterococcus [8]. Other probiotics are microscopic fungi, such as Saccharomyces cerevisiae [9]. These probiotics are also added to fermented feed as fermentation strains and produce some beneficial products for animal health. Studies have reported that many fermentation products, such as organic acids, antibacterial peptides, and bacteriocins, have certain antibacterial effects [10,11]. Lactobacillus rhamnosus and Lactobacillus plantarum are probiotics that can be added to animal feed [12], and they can produce organic acids [13]. Organic acids can lower the pH of feed and inhibit the growth of PB. Because of its antibacterial and immune regulatory activities, it has been applied in animal production [14]. Nithya and Halami [15] found that the antibacterial peptide secreted by Bacillus subtilis exhibited promising antibacterial properties and can be considered a potential candidate as a biopreservative agent. Saccharomyces cerevisiae and its cellular components (mannaoligosaccharides, glucooligosaccharides, and enzymes) can improve the growth, immunity, and intestinal health of cultured animals [16]. The proliferation of microorganisms forms nutrient competition for PB and has an inhibitory effect on their growth. However, the antibacterial rule of fermented feed on specific PB remains to be studied.
Calcium (Ca) is crucial for egg formation, eggshell strength, and thickness. Adequate Ca intake by laying hens is key to ensuring the quality of eggshells [17]. Research has shown that when laying hens continue to consume Ca, they can fully utilize their egg production performance [18]. Therefore, in the process of laying hens breeding, Ca supplements such as CaCO3 are often added to the feed. In addition, during the fermentation process, CaCO3 is often added to co-ferment with microorganisms to form organic acid calcium, small peptide calcium, etc. [19,20], which can effectively improve the absorption and utilization of Ca and increase the nutritional value of fermented feed. The added CaCO3 can neutralize the organic acids secreted by the microorganisms so that the fermentation environment maintains a high pH value and a high Ca2+ osmotic pressure. This may cause the fermentation strains to not grow and metabolize normally or may even cause them to die. The fermentation process maintains a constant high pH, which is easily contaminated by PB such as Escherichia coli, Staphylococcus aureus, and Shigella flexneri, resulting in fermentation failure.
The traditional microbial quantitative analysis method is mainly to determine the species and quantity of microorganisms by enrichment culture on plates and evaluation of the microorganism morphology and culture characteristics [21]. Traditional quantitative analysis methods are time-consuming and laborious, and different strains have a large influence on each other [22]. In addition, there are a large number of microorganisms that cannot be cultured in the sample, which leads to lower test results [23]. This is also one of the reasons why some feed production enterprises have poor accuracy in microbial detection in feed products. Quantitative real-time PCR (qPCR) is increasingly applied to microbial quantitative analysis. The microbial quantitative analysis by qPCR is efficient, simple, and accurate [24]. However, the accurate analysis of qPCR depends on the specificity of the primers used for the particular strain. The specificity of the strain primer is especially important when determining the various strains in a mixed multi-strain sample.
This study developed a qPCR method for the determination of fermenting microorganisms and PB. Escherichia coli, Staphylococcus aureus, Shigella flexneri, and different amounts of CaCO3 were added simultaneously at the beginning of fermentation. The growth of fermenting microorganisms, PB, and changes in organic acid content in fermented feed were analysed to investigate the antibacterial rule of fermented feed with different amounts of CaCO3. Moreover, the results of this study are expected to be applied to the microbial quantitative detection process of feed products in feed production enterprises in the future.

2. Materials and Methods

2.1. Materials and Reagents

BDs and SBM were purchased from a bean processing factory in Zhenjiang City (Jiangsu, China). All solvents and chemicals are analytical reagent grade or higher and are purchased from Sinopharm Group Chemical Reagent Co., Ltd. (Shanghai, China). Acid protease and papain were purchased from Ningxia Xia Sheng Enzyme BioEngineering Co., Ltd. (Ningxia, China), and the activity of these enzymes is 60,000 U/g.

2.2. Microorganisms

Lactiplantibacillus plantarum subsp. plantarum (CGMCC 1.557), Lacticaseibacillus rhamnosus (CGMCC 1.2467), Bacillus subtilis (CGMCC 1.1086), and Saccharomyces cerevisiae (2.1527) were purchased from the China General Microbiological Culture Collection Center. Shigella flexneri (CMCC 51572) was purchased from the National Center for Medical Culture Collections. Escherichia coli (ATCC 43888) and Staphylococcus aureus (ATCC 6538) were preserved by our laboratory.

2.3. Expanding the Culture of Strains and Configuration of Culture Media

Luria–Bertani (LB) liquid medium (1 L): 10 g tryptone, 10 g sodium chloride, and 5 g yeast extract were accurately weighed in a 1 L beaker. A total of 950 mL of distilled water was then added to the beaker and blended on a magnetic stirrer. The liquid was placed in a 1 L volumetric bottle and filled to 1000 mL. The medium was then evenly divided into four 500 mL conical glass bottles. These cone-shaped glass bottles containing the medium were then autoclaved at 121 °C for 20 min. Malt extract medium (1 L): 130.1 g wort powder was accurately weighed and placed in a 1 L beaker filled with 700 mL water. After the powder was heated and dissolved, the liquid was placed in a 1 L volume bottle, and the volume was fixed to 1000 mL. The liquid was divided into four 500 mL conical glass bottles. It was then autoclaved at 121 °C for 15 min. Bacillus subtilis, Lactiplantibacillus plantarum subsp. plantarum, Lacticaseibacillus rhamnosus, Escherichia coli, Staphylococcus aureus, and Shigella flexneri were cultured with LB medium at 37 °C for 16 h, respectively. Saccharomyces cerevisiae was cultured with malt extract medium at 28 °C for 16 h.

2.4. Primer Specificity Verification

The strains were cultured to OD600 = 1.00, and the DNA of each bacterial was extracted with the FastPure Bacteria DNA Isolation Mini Kit (Vazyme, Nanjing, China); moreover, yeast DNA was extracted by fungal genome extraction kit (Takara, Kusatsu, Japan). The specificity of each primer was verified by routine PCR with the DNA of other strains. The reaction system was as follows: 2× Rapid Tag Master Mix 10 μL (Vazyme, Nanjing, China), Upstream primer 0.8 μL, Downstream primer 0.8 μL, DNA template 2 μL, ddH2O 6.4 μL. The reaction procedure was as follows: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1 min; a total of 30 cycles were completed, and elongation was at 72 °C for 10 min. The PCR-amplified products were analyzed by 3% agarose gel electrophoresis. The primer sequences used in this study can be seen in Table 1 [25,26,27].

2.5. Establishment of Strain Standard Curves for qPCR Determination

The establishment of strain standard curves refers to the method of Yu, Dong, and Lu [28] with slight modification. The DNA fragments amplified by specific primers were recovered as the standard for qPCR. The concentration of the fragments was measured and converted to the copy number of each standard strain for making standard curves. The calculation formula was copy number = DNA concentration (ng μL−1) × 10−9 × 6.023 × 1023/(660× base number). The standards were diluted 10 times to 10−7~10−2 copies μL−1, and SYBR Green was used as fluorescent dye for qPCR. qPCR reaction system was SYBR Qpcr Master Mix (Vazyme, Nanjing, China) 10 μL, Upstream primer 0.8 μL, Downstream primer 0.8 μL, DNA template 2 μL, ddH2O 6.4 μL. The reaction procedure was as follows: predenaturation at 95 °C for 30 s, amplification at 95 °C for 5 s, 60 °C for 31 s, a total of 40 cycles. After the reaction, it was warmed to 95 °C 15 s, then to 60 °C 1 min, and then to 95 °C 1 s. The amplification and analysis were carried out by Thermofisher QuantStudio 3 (Thermo Fisher Scientific, Singapore). The standard curve could be drawn by taking the logarithm of positive template as abscissa and the initial cycle number (Ct) of fluorescent signals in the process of PCR reaction as ordinate.

2.6. Solid-State Fermentation Process

The solid-state fermentation process referred to the research of Heng et al. [29] and made slight modifications based on our experimental results (Figure 1). Firstly, 120 g BDs and 120 g SBM are mixed in a plastic bowl with a bare mouth. The mixture was stirred evenly and fermented under the aerobic condition at 30 °C for 14 h. Then, Saccharomyces cerevisiae, Lactiplantibacillus plantarum subsp. plantarum, Lacticaseibacillus rhamnosus, and 0.65% acid protease + 0.65% papain (w/w) were added. The mixture was stirred evenly and was put into a fermentation bag containing a one-way vent. Finally, the fermentation bag was sealed, and the fermentation was conducted under an anaerobic condition at 30 °C in a constant temperature incubator. Three PB (Escherichia coli, Staphylococcus aureus, Shigella flexneri) and different amounts of CaCO3 (0, 2, 4, 8, and 12%, w/w) were added before sealing the fermentation bag for anaerobic fermentation. The inoculum size of each strain was 1.25% (v/w), and the strains were cultured to OD600 = 1.00.

2.7. Changes of Fermented Feed pH and Organic Acid Content with Different Amounts of CaCO3

Samples were taken on days 0, 1, 4, 7, 11, 15, 20, and 30 of fermentation to determine the feed pH. Samples were taken on 0, 7, 15, and 30 days of fermentation to determine the organic acid content.

2.8. Microorganism Detection with qPCR

Samples were taken at 12 h, 1 day, 4 days, 7 days, 11 days, 15 days, 20 days, and 30 days of fermentation to determine three PB by qPCR. Samples were taken on days 0, 7, 15, and 30 of fermentation to determine Bacillus subtilis by qPCR. Samples were taken at 12 h, 7 days, 15 days, and 30 days of fermentation to determine Saccharomyces cerevisiae, Lactiplantibacillus plantarum subsp. Plantarum, and Lacticaseibacillus rhamnosus by qPCR. The extraction of microbial DNA in fermented feed also refers to the method of Yu, Dong, and Lu [28] with slight modification. Sample (1.00 g) was mixed with 10 mL deionized water, shaken for 20 min, and filtered through a 200 mesh sieve. Filtrate (2 mL) was used to extract DNA for qPCR, and bacterial DNA was extracted by the FastPure Bacteria DNA Isolation Mini Kit (Vazyme, Nanjing, China); yeast DNA was extracted by fungal genome extraction kit (Takara). The remaining qPCR steps are as described above.

2.9. Determination of Fermented Feed pH and Organic Acids

Feed pH was determined according to the method of Elfalleh et al. [30]. The sample (2.00 g) was mixed with 20 mL of deionized water, soaked for 2 h, and measured with a pH meter (Sartorius PB-10, Sartorius, Beijing, China). Organic acids were determined by the method of Moghaddam, Zhang, and Du [31] with slight modification. Sample (1.00 g) was mixed with 20 mL pH 2.7 HCl solution, sonicated for 30 min, shaken and soaked for 3.5 h, and then centrifuged at 6000× g for 35 min. The supernatant was diluted with HCl solution (pH 2.0) at 1:1 and filtered through a 0.45 μm filter membrane before HPLC analysis (SHIMADZU, Kyoto, Japan). Chromatographic conditions: mobile phase, 0.01 mol L−1 KH2PO4 (pH 2.7):methanol = 97:3; chromatographic column: Welch AQ-C18; detection wavelength: 210 nm; flow rate: 0.6 mL min−1. The total organic acid content was the sum of each acid content.

2.10. Statistical Analysis

All experiments were performed in triplicate. All data are expressed as the mean ± SD and were analyzed using one-way analysis of variance (ANOVA) in SPSS 25.0 and plotted using Origin Pro8. Statistical significance was set at p < 0.05.

3. Results

3.1. Strain Primer Specificity Verification

In this study, except for the nucA gene used in Saccharomyces cerevisiae and Staphylococcus aureus, the other five bacterial strains all used the recA gene, and these two genes have been confirmed to have been optimized for amplification methods and used for quantitative analysis of micrograms numbers [25,26,27]. Each strain primer used in the experiment can only bind to its own DNA, not to other strains of DNA (Figure 2), so the specificity of each strain primer is good.

3.2. Establishment of qPCR Strain Standard Curves

During the PCR process, the fluorescence signal of the sample amplification products shows an s-shaped curve with exponential cycle, linear cycle, and plateau phase [32]. In the exponential phase, there is a linear relationship between the initial concentration of the sample and the number of amplification cycles (Ct value) corresponding to the sample. The standard curves of strains are shown in Table 2.

3.3. Changes of Fermented Feed pH with Different Amounts of CaCO3

As shown in Figure 3, with the increase of CaCO3 addition, the pH drop of fermented feed slows down. Without CaCO3 addition, the pH of fermented feed was lower than 4.5 in 4 days of fermentation and dropped to about 4.1 in 30 days of fermentation. The pH of fermented feed with 2% CaCO3 dropped to below 4.5 in 15 days and was around 4.3 in 30 days. The pH of fermented feed with 4% CaCO3 dropped to about 4.5 in 30 days. The pH of fermented feeds with 8% and 12% CaCO3 was always above 5.0 during one month of fermentation.

3.4. Growth Changes of Escherichia coli, Staphylococcus aureus, and Shigella flexneri with Different Amounts of CaCO3

As shown in Figure 4a, in the early stage of fermentation, the addition of CaCO3 promoted the growth of Escherichia coli, of which 4% was the most obvious, followed by 8%. The addition of CaCO3 made the maximum growth of Escherichia coli (2.63 × 107 copies g−1) appear in advance to the 4th day, while the maximum growth of Escherichia coli (2.14 × 107 copies g−1) appeared on the 7th day without the addition of CaCO3, and the maximum growth of Escherichia coli in the feed with the addition of CaCO3 was higher than that in the feed without the addition of CaCO3. In the middle and later stages of fermentation, the number of Escherichia coli decreased with the increase of CaCO3 addition.
As shown in Figure 4b, in the early stage of fermentation, CaCO3 addition promoted the growth of Staphylococcus aureus, and with the increase of CaCO3 addition, the promotion effect was weakened; the greatest promotion effect was 2% CaCO3. In the middle and late stages of fermentation, the number of Staphylococcus aureus gradually decreased, and with the increase of CaCO3 addition, the number of Staphylococcus aureus increased. The growth trend of Shigella flexneri in all groups of experiments increased first and then decreased (Figure 4c). In the early stage of fermentation, the growth rate of Shigella flexneri in the feed with CaCO3 addition was faster than that in the feed without CaCO3 addition. In the middle and late stages of fermentation, the number of Shigella flexneri continued to decrease in all groups of experiments.

3.5. Changes of Organic Acid Content and Growth Changes of Fermenting Strains with Different Amounts of CaCO3

As shown in Figure 5a, at 7 days of fermentation, the CaCO3 addition reduced the number of Bacillus subtilis. The addition of 2% CaCO3 slowed down the decline of Bacillus subtilis in the late stage of fermentation. As shown in Figure 5b, the addition of 2% and 4% CaCO3 promoted the growth of Saccharomyces cerevisiae in the early stage of fermentation. In the late stage of fermentation, the addition of CaCO3 slowed down the decay of Saccharomyces cerevisiae. In the fermentation process containing anaerobic fermentation, lactic acid bacteria grow rapidly and are the dominant fermenting strains [29]. As shown in Figure 5c,d, the addition of CaCO3 promoted the growth of Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus throughout the fermentation process. The number of both lactic acid bacteria increased with the increase of CaCO3 addition. In addition, as shown in Figure 6, the content of organic acids in fermented feed increased with the addition of CaCO3. In the early stage of fermentation (0–7 days), the organic acid content increases rapidly. After 7 days of fermentation, the organic acid content showed a slow increasing trend.

4. Discussion

It is reported that fermented feed with a pH lower than 4.5 has a better antibacterial effect, and long-term high pH is likely to contaminate PB [33,34]. During the experiment, none of the fermented feeds with CaCO3 showed obvious white spots, odor, etc. We speculate that it is possible that the fermented feeds still have a good antibacterial effect under the high pH caused by the addition of CaCO3.
The growth trend of Escherichia coli, Staphylococcus aureus, and Shigella flexneri increased first and then decreased in all groups of experiments (Figure 4a–c). In the early stage of fermentation, the addition of CaCO3 made the feed pH high, which was favorable to the growth of Escherichia coli, and the growth competition ability of Escherichia coli was stronger than other strains. In the middle and later stages of fermentation, the number of Escherichia coli decreased with the increase of CaCO3 addition. This indicated that the addition of CaCO3 promoted the inhibition of Escherichia coli by fermented feed, and the inhibition effect was stronger with the increase of CaCO3 addition. Different from Escherichia coli, the addition of CaCO3 weakened the growth inhibition of fermented feeds to Staphylococcus aureus, and the inhibition effect became weaker with the increase of CaCO3 addition. This may be because Staphylococcus aureus was a gram-positive bacterium with thicker cell walls [35] that was more resistant to antimicrobial substances in fermented feed. The addition of CaCO3 had a significant inhibition effect on the growth of Shigella flexneri. The higher the CaCO3 addition, the faster the number of Shigella flexneri decreased, indicating that the inhibitory effect of fermented feed on Shigella flexneri was stronger.
At present, it is not clear which amount of CaCO3 is the most appropriate. Because the quantities of Bacillus subtilis, Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus are the highest with a CaCO3 addition under 12%, the production of organic acids is also the highest, and this additional amount has the best inhibition effect on the Escherichia coli and Shigella flexneri. But, the inhibition against Staphylococcus aureus was the worst. The addition of 4% CaCO3 is more suitable for the growth of Saccharomyces cerevisiae. The exploration of the most suitable amount of CaCO3 addition is the content of our next research.
The growth of microorganisms plays an important role in the antimicrobial effect of fermented feed. Adding an appropriate amount of CaCO3 is beneficial for the reproduction of fermentation strains such as Bacillus subtilis and Saccharomyces cerevisiae in this study. The addition of CaCO3 promotes the growth of Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus to varying degrees. The proliferation of microorganisms such as Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus had a competitive inhibitory effect on the growth of Escherichia coli, Staphylococcus aureus, and Shigella flexneri. Lactiplantibacillus plantarum subsp. plantarum and Lacticaseibacillus rhamnosus can also secrete lactic acid bacteriocins, organic acids, and other antibacterial substances, which have a good inhibitory effect on PB. Peng et al. [36] found bacteriocin LP 21-2 produced by Lactiplantibacillus plantarum SHY 21-2 had a broad antimicrobial spectrum against gram-positive bacteria and gram-negative bacteria, including Staphylococcus aureus ATCC25923, Salmonella typhi CMCC50071.
CaCO3 is one of the frequently added raw materials in fermented feed, and its co-fermentation with microorganisms can form organic acid calcium, small peptide calcium, etc. [19,20], which can effectively improve the absorption and utilization rate of calcium and enhance the nutritional value of fermented feed. In addition, the addition of CaCO3 significantly increased the content of organic acids in the fermented feed (Figure 6). The antimicrobial effect of lactic acid is believed to be exerted through the ability of undissociated acids to enter cells, disrupt pH homeostasis, and, thus, cause damage to nucleic acids and proteins [33]. The main components of organic acids in this fermented feed were lactic acid and acetic acid. Costa et al. [37] found that decreases in counts of L. monocytogenes or S. Enteritidis in “Minas Frescal” cheese and ground chicken breast, respectively, were related to increases in lactic and acetic acid contents and decreases in pH values. Bacteriocins can effectively inhibit the growth and reproduction of pathogenic microorganisms and have great feeding value [38]. Vázquez, González, and Murado [39] found that compared with bacteriocin, lactic acid and acetic acid are more effective at inhibiting PB. However, most of the organic acids were in the form of organic acid radicals due to the presence of CaCO3. This may be due to organic acid ions also having good antibacterial effects. Although the addition of a large amount of CaCO3 resulted in the high pH of the fermented feed, it promoted the production of large amounts of organic acid radicals, which had a good growth inhibition effect on PB. The quality of the feed remains unaffected, and the increased organic acid radicals also improve the quality of the fermented feed.
This study established a rapid detection method for the number of microorganisms in the fermented feed fermentation process. This is more accurate and rapid than the traditional method of using plate enrichment culture and evaluating microbial morphology and culture characteristics to determine the type and quantity of microorganisms in products [18]. Although this method cannot distinguish dead cell DNA, resulting in a judgment of excessive quantity, this study provides a rapid and quantitative analysis of microorganisms during the fermentation process of fermented feed, providing a theoretical basis for the prevention of PB pollution, safe production, and preservation of fermented feed. Propidine monoazide (PMA) is a common live bacterial dye, which combines with qPCR technology (PMA-qPCR) to not only specifically quantify the number of strains but also distinguish between live and dead cells [40]. It has been applied to the quantitative detection of microorganisms in beverages [41]. This method may be applied to the rapid and accurate quantitative detection of microorganisms in fermented feed, which is also our next research direction.

5. Conclusions

In order to improve the quality and stability of fermented feed and to more accurately detect changes in microbial biomass during the fermentation process of fermented feed, we have established a rapid qPCR method for detecting microbial changes in fermented feed. The relationship between the addition of CaCO3 and the changes in the number of probiotics, PB, and the organic acid content was established through this method. The addition of CaCO3 significantly inhibited the growth of Escherichia coli and Shigella flexneri and reduced the growth inhibition of Staphylococcus aureus. It also promoted the growth of fermenting strains and a large amount of organic acid production, which made the fermented feed have a certain antibacterial effect. For the inhibitory effect of intestinal PB, the additional amount of 12% CaCO3 is the most suitable. At this level of addition, the number of Lactiplantibacillus plantarum subsp. plantarum, Lacticaseibacillus rhamnosus, and Bacillus subtilis are the highest, and the content of organic acids with antibacterial effects is also the highest. However, this method cannot distinguish between dead cell DNA, resulting in a judgment of excessive quantity. However, this study provides a new rapid detection method for quickly adjusting feed production processes by detecting the number of microorganisms in the fermentation production process of fermented feed and provides a theoretical basis for preventing PB pollution, safe production, and preservation of fermented feed.

Author Contributions

J.L. carried out the whole experiment and data analysis; H.C. participated in part of the experiment, conceived the idea, and supervised the work; X.H. and Z.N. participated in part of the experiment and data analysis. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key Research and Development Program (2021YFC2103004) and the Key Research and Development Program (Modern Agriculture) of Zhenjiang City, Jiangsu, China (NY2023013).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

This study was completed at the School of Life Sciences, Jiangsu University. The authors are grateful for the equipment support provided by the Public Experimental Center of the School of Life Sciences, Jiangsu University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Scallan, E.; Griffin, P.M.; Angulo, F.J.; Tauxe, R.V.; Hoekstra, R.M. Foodborne illness acquired in the United States—Unspecified agents. Emerg. Infect. Dis. 2011, 17, 16–22. [Google Scholar] [CrossRef] [PubMed]
  2. Wu, G.; Carter, B.; Mafura, M.; Liebana, E.; Woodward, M.J.; Anjum, M.F. Genetic diversity among Escherichia coli O157:H7 isolates and identification of genes linked to human infections. Infect. Immun. 2008, 76, 845–856. [Google Scholar] [CrossRef] [PubMed]
  3. Bania, J.; Dabrowska, A.; Bystron, J.; Korzekwa, K.; Chrzanowska, J.; Molenda, J. Distribution of newly described enterotoxin-like genes in staphylococcus aureus from food. Int. J. Food Microbiol. 2006, 108, 36–41. [Google Scholar] [CrossRef] [PubMed]
  4. Chi, C.H.; Cho, S.J. Improvement of bioactivity of soybean meal by solid-state fermentation with Bacillus amyloliquefaciens versus Lactobacillus spp. and Saccharomyces cerevisiae. LWT-Food Sci. Technol. 2016, 68, 619–625. [Google Scholar] [CrossRef]
  5. Zhang, Y.; Chen, S.; Zong, X.; Wang, C.; Shi, C.; Wang, F.; Wang, Y.; Lu, Z. Peptides derived from fermented soybean meal suppresses intestinal inflammation and enhances epithelial barrier function in piglets. Food Agric. Immunol. 2020, 31, 120–135. [Google Scholar] [CrossRef]
  6. Vong, W.C.; Liu, S.Q. Biovalorisation of okara (soybean residue) for food and nutrition. Trends Food Sci. Technol. 2016, 52, 139–147. [Google Scholar] [CrossRef]
  7. Hawashi, M.; Altway, A.; Widjaja, T.; Gunawan, S. Optimization of process conditions for tannin content reduction in cassava leaves during solid state fermentation using saccharomyces cerevisiae. Heliyon 2019, 5, e02298. [Google Scholar] [CrossRef]
  8. Iraqi, K.G.E.; Fayed, R.H. Effect of yeast as feed supplement on behavioural and productive performance of broiler chickens. Life Sci. J. 2012, 9, 4026–4031. [Google Scholar]
  9. Paryad, A.; Mahmoudi, M. Effect of different levels of supplemental yeast (Saccharomyces cerevisiae) on performance, blood constituents and carcass characteristics of broiler chicks. Afr. J. Agric. Res. 2008, 3, 835–842. [Google Scholar]
  10. Yan, Y.; Li, Y.; Zhang, Z.; Wang, X.; Niu, Y.; Zhang, S.; Xu, W.; Ren, C. Advances of peptides for antibacterial applications. Colloid Surf. B 2021, 202, 111682. [Google Scholar] [CrossRef]
  11. Amrutha, B.; Sundar, K.; Shetty, P.H. Effect of organic acids on biofilm formation and quorum signaling of pathogens from fresh fruits and vegetables. Microb. Pathog. 2017, 111, 156–162. [Google Scholar] [CrossRef] [PubMed]
  12. Pézsa, N.P.; Kovács, D.; Somogyi, F.; Karancsi, Z.; Móritz, A.V.; Jerzsele, A.; Rácz, B.; Farkas, O. Effects of Lactobacillus rhamnosus DSM7133 on Intestinal Porcine Epithelial Cells. Animals 2023, 13, 3007. [Google Scholar] [CrossRef] [PubMed]
  13. Leal, K.; Truong, L.; Maga, E.; King, A. Lactobacillus (L. plantarum & L. rhamnosus) and Saccharomyces (S. cerevisiae): Effects on performance, biochemical parameters, ammonium ion in manure, and digestibility of broiler chickens. Poult. Sci. 2023, 102, 102525. [Google Scholar] [CrossRef] [PubMed]
  14. Lobo, R.R.; Roesch, L.F.W.; Grilli, E.; Faciola, A.P. Effects of Microencapsulated Blend of Organic Acids and Pure Botanicals on the Ruminal Microbiota in an In Vitro Dual-Flow Continuous Culture System. Fermentation 2023, 9, 730. [Google Scholar] [CrossRef]
  15. Nithya, V.; Halami, P.M. Antibacterial peptides, probiotic properties and biopreservative efficacy of native Bacillus species isolated from different food sources. Probiotics Antimicrob. Proteins 2012, 4, 279–290. [Google Scholar] [CrossRef]
  16. Valle, J.C.; Bonadero, M.C.; Fernández-Gimenez, A.V. Saccharomyces cerevisiae as probiotic, prebiotic, synbiotic, postbiotics and parabiotics in aquaculture: An overview. Aquaculture 2023, 569, 739342. [Google Scholar] [CrossRef]
  17. Attia, Y.A.; Al-Harthi, M.A.; El-Maaty, H.M.A. Calcium and cholecalciferol levels on late phase-laying hens’ diets: Effects on productive and egg quality traits, blood biochemistry and immune responses. Front. Vet. Sci. 2020, 7, 389. [Google Scholar] [CrossRef]
  18. Wang, J.; Wang, W.W.; Qi, G.H.; Cui, C.F.; Wu, S.G.; Zhang, H.J.; Wang, J. Effects of dietary Bacillus subtilis supplementation and calcium levels on performance and eggshell quality of laying hens in the late phase of production. Poult. Sci. 2020, 100, 100970. [Google Scholar] [CrossRef]
  19. Zhang, H.; Zhao, L.; Shen, Q.; Qi, L.; Jiang, S.; Guo, Y.; Zhang, C.; Richel, A. Preparation of cattle bone collagen peptides-calcium chelate and its structural characterization and stability. LWT-Food Sci. Technol. 2021, 144, 111264. [Google Scholar] [CrossRef]
  20. Wei, C.; Liu, G.; Zhang, J.; Bao, J. Elevating fermentation yield of cellulosic lactic acid in calcium lactate form from corn stover feedstock. Ind. Crops Prod. 2018, 126, 415–420. [Google Scholar] [CrossRef]
  21. Chon, J.W.; Kim, Y.J.; Kim, D.H.; Song, K.Y.; Kim, H.; Kun, H.S. Supplementation of modified mannitol-yolk-polymyxin b agar with cefuroxime for quantitative detection of bacillus cereus in food. J. Food Sci. 2019, 84, 133–137. [Google Scholar] [CrossRef] [PubMed]
  22. Xiong, T.; Chen, J.; Huang, T.; Xie, M.; Xiao, Y.; Liu, C.; Peng, Z. Fast evaluation by quantitative PCR of microbial diversity and safety of Chinese Paocai inoculated with Lactobacillus plantarum NCU116 as the culture starter. LWT-Food Sci. Technol. 2019, 101, 201–206. [Google Scholar] [CrossRef]
  23. Xu, H.S.; Roberts, N.; Singleton, F.L.; Attwell, R.W.; Grimes, D.J.; Colwell, R.R. Survival and viability of nonculturable Escherichia coli and Vibrio cholerae in the estuarine and marine environment. Microb. Ecol. 1982, 8, 313–323. [Google Scholar] [CrossRef]
  24. Wang, X.; Tang, T.; Miao, Q.; Xie, S.; Chen, X.; Tang, J.; Peng, C.; Xu, X.; Wei, W.; You, Z.; et al. Detection of transgenic rice line TT51-1 in processed foods using conventional PCR, real-time PCR, and droplet digital PCR. Food Control 2019, 98, 380–388. [Google Scholar] [CrossRef]
  25. Costa, G.N.; Vilas-Boas, G.T.; Vilas-Boas, L.A.; Miglioranza, L.H.S. In Silico phylogenetic analysis of lactic acid bacteria and new primer set for identification of lactobacillus plantarum in food samples. Eur. Food Res. Technol. 2011, 233, 233–241. [Google Scholar] [CrossRef]
  26. Chhetri, V.S.; Han, Y.; Janes, M.E.; Adhikari, A. Evaluation of viability of E. coli o157: h7 on chlorine and lactic acid treated spinach leaves using combined propidium monoazide staining and real-time PCR. LWT-Food Sci. Technol. 2020, 125, 109259. [Google Scholar] [CrossRef]
  27. Aprodu, I.; Walcher, G.; Schelin, J.; Hein, I.; Norling, B.; Rådström, P.; Nicolau, A.; Wagner, M. Advanced sample preparation for the molecular quantification of Staphylococcus aureus in artificially and naturally contaminated milk. Int. J. Food Microbiol. 2011, 145, S61–S65. [Google Scholar] [CrossRef]
  28. Yu, Z.; Dong, B.; Lu, W. Dynamics of bacterial community in solid-state fermented feed revealed by 16S rRNA. Lett. Appl. Microbiol. 2009, 49, 166–172. [Google Scholar] [CrossRef]
  29. Heng, X.; Chen, H.; Lu, C.; Feng, T.; Li, K.; Gao, E. Study on synergistic fermentation of bean dregs and soybean meal by multiple strains and proteases. LWT-Food Sci. Technol. 2022, 154, 112626. [Google Scholar] [CrossRef]
  30. Elfalleh, W.; Sun, C.; He, S.; Kong, B.; Ma, Y. Changes in enzymatic activities during “koji” incubation and natural fermentation of soybean paste. J. Food Process. Preserv. 2017, 41, e13302. [Google Scholar] [CrossRef]
  31. Moghaddam, T.K.; Zhang, J.; Du, G. Uvra expression of lactococcus lactis nz9000 improve multiple stresses tolerance and fermentation of lactic acid against salt stress. J. Food Sci. Technol. 2017, 54, 639–649. [Google Scholar] [CrossRef]
  32. Postollec, F.; Falentin, H.; Pavan, S.; Combrisson, J.; Sohier, D. Recent advances in quantitative PCR (qPCR) applications in food microbiology. Food Microbiol. 2011, 28, 848–861. [Google Scholar] [CrossRef] [PubMed]
  33. Beal, J.D.; Niven, S.J.; Campbell, A.; Brooks, P.H. The effect of temperature on the growth and persistence of Salmonella in fermented liquid pig feed. Int. J. Food Microbiol. 2002, 79, 99–104. [Google Scholar] [CrossRef] [PubMed]
  34. Wilks, J.C.; Slonczewski, J.L. pH of the cytoplasm and periplasm of Escherichia coli: Rapid measurement by green fluorescent protein fluorimetry. J. Bacteriol. 2007, 189, 5601–5607. [Google Scholar] [CrossRef] [PubMed]
  35. Chang, J.O.; Lee, R.E.; Lee, W. A pursuit of Staphylococcus aureus continues: A role of persister cells. Arch. Pharm. Res. 2020, 43, 630–638. [Google Scholar] [CrossRef]
  36. Peng, S.; Song, J.; Zeng, W.; Wang, H.; Zang, Y.; Xin, J.; Suo, H. A broad-spectrum novel bacteriocin produced by Lactobacillus plantarum SHY 21–2 from yak yogurt: Purification, antimicrobial characteristics and antibacterial mechanism. LWT-Food Sci. Technol. 2021, 142, 110955. [Google Scholar] [CrossRef]
  37. Costa, W.K.A.D.; Souza, G.T.D.; Brandao, L.R.; Lima, R.C.D.; Garcia, E.F.; Lima, M.D.S.; Souza, E.L.D.; Saarela, M.; Magnani, M. Exploiting antagonistic activity of fruit-derived lactobacillus to control pathogenic bacteria in fresh cheese and chicken meat. Food Res. Int. 2018, 108, 172–182. [Google Scholar] [CrossRef]
  38. Wang, N.; Le, G.; Shi, Y.; Zeng, Y. Production of bioactive peptides from soybean meal by solid state fermentation with lactic acid bacteria and protease. Adv. J. Food Sci. Technol. 2014, 6, 1080–1085. [Google Scholar] [CrossRef]
  39. Vázquez, J.A.; González, M.P.; Murado, M.A. Effects of lactic acid bacteria cultures on pathogenic microbiota from fish. Aquaculture 2005, 245, 149–161. [Google Scholar] [CrossRef]
  40. Rizzotti, L.; Levav, N.; Fracchetti, F.; Felis, G.E.; Torriani, S. Effect of UV-C treatment on the microbial population of white and red wines, as revealed by conventional plating and PMA-qPCR methods. Food Control 2015, 47, 407–412. [Google Scholar] [CrossRef]
  41. Huang, T.; Shi, Y.; Zhang, J.; Han, Q.; Xia, X.S.; Zhang, A.M.; Song, Y. Rapid and Simultaneous Detection of Five, Viable, Foodborne Pathogenic Bacteria by Photoinduced PMAxx-Coupled Multiplex PCR in Fresh Juice. Foodborne Pathog. Dis. 2021, 18, 640–646. [Google Scholar] [CrossRef] [PubMed]
Fermentation 09 00940 g001
Figure 1. Initial fermentation process.
Figure 1. Initial fermentation process.
Fermentation 09 00940 g001
Fermentation 09 00940 g002aFermentation 09 00940 g002b
Figure 2. Specificity verification of strain primers. (a) Bacillus subtilis; (b) Saccharomyces cerevisiae; (c) Lactiplantibacillus plantarum subsp. plantarum; (d) Lacticaseibacillus rhamnosus; (e) Escherichia coli; (f) Staphylococcus aureus; (g) Shigella flexneri. M: DNA Marker (50~500 bp); 1: Bacillus subtilis; 2: Saccharomyces cerevisiae; 3: Lactiplantibacillus plantarum subsp. plantarum; 4: Lacticaseibacillus rhamnosus; 5: Escherichia coli; 6: Staphylococcus aureus; 7: Shigella flexneri.
Figure 2. Specificity verification of strain primers. (a) Bacillus subtilis; (b) Saccharomyces cerevisiae; (c) Lactiplantibacillus plantarum subsp. plantarum; (d) Lacticaseibacillus rhamnosus; (e) Escherichia coli; (f) Staphylococcus aureus; (g) Shigella flexneri. M: DNA Marker (50~500 bp); 1: Bacillus subtilis; 2: Saccharomyces cerevisiae; 3: Lactiplantibacillus plantarum subsp. plantarum; 4: Lacticaseibacillus rhamnosus; 5: Escherichia coli; 6: Staphylococcus aureus; 7: Shigella flexneri.
Fermentation 09 00940 g002aFermentation 09 00940 g002b
Fermentation 09 00940 g003
Figure 3. Changes of fermented feed pH with different amounts of CaCO3.
Figure 3. Changes of fermented feed pH with different amounts of CaCO3.
Fermentation 09 00940 g003
Fermentation 09 00940 g004
Figure 4. Growth changes of pathogenic bacteria with different amounts of CaCO3. (a) Escherichia coli; (b) Staphylococcus aureus; (c) Shigella flexneri.
Figure 4. Growth changes of pathogenic bacteria with different amounts of CaCO3. (a) Escherichia coli; (b) Staphylococcus aureus; (c) Shigella flexneri.
Fermentation 09 00940 g004
Fermentation 09 00940 g005
Figure 5. Growth changes of fermenting strains with different amounts of CaCO3. (a) Bacillus subtilis; (b) Saccharomyces cerevisiae; (c) Lactiplantibacillus plantarum subsp. plantarum; (d) Lacticaseibacillus rhamnosus.
Figure 5. Growth changes of fermenting strains with different amounts of CaCO3. (a) Bacillus subtilis; (b) Saccharomyces cerevisiae; (c) Lactiplantibacillus plantarum subsp. plantarum; (d) Lacticaseibacillus rhamnosus.
Fermentation 09 00940 g005
Fermentation 09 00940 g006
Figure 6. Changes of organic acid content with different amounts of CaCO3.
Figure 6. Changes of organic acid content with different amounts of CaCO3.
Fermentation 09 00940 g006
Table 1. Specific primers of strains.
Table 1. Specific primers of strains.
StrainsPrimers (5′-3′)Amplified Fragment
Bacillus subtilisF: CGTAGAGCCACTTGAGCG
R: CTGCCGTTACAGTTCCTT		257
Saccharomyces cerevisiaeF: GCGATAACGAACGAGACCCTAA
R: CCAGCACGACGGAGTTTCACAAGAT		225
Lactiplantibacillus plantarum subsp. F: GTGGTGCGGTCGATATTTTAGTT
R: TCAGCCGCGCTTGTAACC		108
Lacticaseibacillus rhamnosusF: GACGCAGCCGGTTGACCCAA
R: GGCGGCAGTTGCCCCAGAAT		376
Escherichia coliF: GCACTAAAAGCTTGGAGCAGTTC
R: AACAATGGGTCAGCGGTAAGGCTA		178
Staphylococcus aureusF: GCGATTGATGGTGATACGGTT
R: AGCCAAGCCTTGACGAACTAAAGC		279
Shigella flexneriF: GAGATTCCTGCTCCGCTAA
R: TGCGAGGTAGTTGACATTGG		323
Table 2. Standard curves of strains.
Table 2. Standard curves of strains.
StrainsStandard CurvesRelated CoefficientEfficiency Coefficient
Bacillus subtilisY = −3.3493X + 35.973R2 = 0.999698.87%
Saccharomyces cerevisiaeY = −3.4505X + 38.2299R2 = 0.997794.90%
Lactiplantibacillus plantarum subsp. plantarumY = −3.4474X + 35.226R2 = 0.999995.01%
Lacticaseibacillus rhamnosusY = −3.4732X + 36.781R2 = 0.995194.05%
Escherichia coliY = −3.3464X + 39.203R2 = 0.999098.98%
Staphylococcus aureusY = −3.4632X + 38.2299R2 = 0.999194.42%
Shigella flexneriY = −3.2115X + 35.226R2 = 0.9985104.48%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Heng, X.; Ni, Z.; Chen, H. Study on the Antibacterial Rule in Fermented Feed with Different Amounts of CaCO3 by Quantitative Real-Time Polymerase Chain Reaction. Fermentation 2023, 9, 940. https://doi.org/10.3390/fermentation9110940

AMA Style

Li J, Heng X, Ni Z, Chen H. Study on the Antibacterial Rule in Fermented Feed with Different Amounts of CaCO3 by Quantitative Real-Time Polymerase Chain Reaction. Fermentation. 2023; 9(11):940. https://doi.org/10.3390/fermentation9110940

Chicago/Turabian Style

Li, Jibin, Xinyu Heng, Zhong Ni, and Huayou Chen. 2023. "Study on the Antibacterial Rule in Fermented Feed with Different Amounts of CaCO3 by Quantitative Real-Time Polymerase Chain Reaction" Fermentation 9, no. 11: 940. https://doi.org/10.3390/fermentation9110940

APA Style

Li, J., Heng, X., Ni, Z., & Chen, H. (2023). Study on the Antibacterial Rule in Fermented Feed with Different Amounts of CaCO3 by Quantitative Real-Time Polymerase Chain Reaction. Fermentation, 9(11), 940. https://doi.org/10.3390/fermentation9110940

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop