Characterization of a New Toti-like Virus in Sea Bass, Dicentrarchus labrax
Abstract
:1. Introduction
2. Materials and Methods
2.1. Biological Samples
2.1.1. Larvae and Juveniles
2.1.2. Genitors
2.2. Cell Culture Isolation
2.3. Production of Specific Rabbit Antibodies
2.4. Indirect Fluorescent Antibody Test (IFAT)
2.5. Transmission Electronic Microscopy (TEM)
2.6. Nucleic Acid Extraction, Library Preparation, and High-Throughput Sequencing
2.7. Phylogenetic Analyses
2.8. PCR Tools for Viral Detection and Quantification
2.9. Data Availability
2.10. Experimental Trials
2.10.1. Fish
2.10.2. Experimental Design
Authorization to Conduct Research and Ethical Aspects
Experimental System
Viral Challenge Conditions
2.11. ELISA Test
2.12. Statistical Analysis
3. Results
3.1. Clinical Signs in Hatchery and First Laboratory Investigations
3.2. Virus Isolation
3.3. Electron Microscopy
3.4. High-Throughput Sequencing of the Viral Genome and ORF Organization
3.5. Phylogenetic Analysis
3.6. Experimental Infections
3.6.1. Virus Tropism and Spread
3.6.2. Specific Antibody Response
3.7. Screening of the Infected Farm
3.7.1. Larvae Screening
3.7.2. Broodstock Screening
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kibenge, F.S.B. Chapter 6—Determinants of Emergence of Viral Diseases in Aquaculture. In Aquaculture Virology; Kibenge, F.S.B., Godoy, M.G., Eds.; Academic Press: San Diego, CA, USA, 2016; pp. 95–116. [Google Scholar]
- Muniesa, A.; Basurco, B.; Aguilera, C.; Furones, D.; Reverté, C.; Sanjuan-Vilaplana, A.; Dverdal Jansen, M.; Brun, E.; Tavornpanich, S. Mapping the knowledge of the main diseases affecting sea bass and sea bream in Mediterranean. Transbound. Emerg. Dis. 2020, 67, 1089–1100. [Google Scholar] [CrossRef]
- Mikalsen, A.B.; Haugland, Ø.; Evensen, Ø. Totiviruses of Fish. In Aquaculture Virology; Elsevier: Amsterdam, The Netherlands, 2016; pp. 251–258. [Google Scholar]
- Tighe, A.J.; Ruane, N.M.; Carlsson, J. Potential origins of fish toti-like viruses in invertebrates. J. Gen. Virol. 2022, 103, 001775. [Google Scholar] [CrossRef]
- Virus Taxonomy: The Classification and Nomenclature of Viruses—The Online (10th) Report of the ICTV, 10th ed.; International Committee on Taxonomy of Viruses (ICTV): London, UK, 2019.
- Poulos, B.T.; Tang, K.F.J.; Pantoja, C.R.; Bonami, J.R.; Lightner, D.V. Purification and characterization of infectious myonecrosis virus of penaeid shrimp. J. Gen. Virol. 2006, 87 Pt 4, 987–996. [Google Scholar] [CrossRef]
- Mor, S.K.; Phelps, N.B. Molecular detection of a novel totivirus from golden shiner (Notemigonus crysoleucas) baitfish in the USA. Arch. Virol. 2016, 161, 2227–2234. [Google Scholar] [CrossRef]
- Zhai, Y.; Attoui, H.; Jaafar, F.M.; Wang, H.-Q.; Cao, Y.-X.; Fan, S.-P.; Sun, Y.-X.; Liu, L.-D.; Mertens, P.P.C.; Meng, W.-S.; et al. Isolation and full-length sequence analysis of Armigeres subalbatus totivirus. the first totivirus isolate from mosquitoes representing a proposed novel genus (Artivirus) of the family Totiviridae. J. Gen. Virol. 2010, 91, 2836–2845. [Google Scholar] [CrossRef]
- Koyama, S.; Urayama, S.; Ohmatsu, T.; Sassa, Y.; Sakai, C.; Takata, M.; Hayashi, S.; Nagai, M.; Furuya, T.; Moriyama, H.; et al. Identification, characterization and full-length sequence analysis of a novel dsRNA virus isolated from the arboreal ant Camponotus yamaokai. J. Gen. Virol. 2015, 96 Pt 7, 1930–1937. [Google Scholar] [CrossRef]
- Løvoll, M.; Wiik-Nielsen, J.; Grove, S.; Wiik-Nielsen, C.R.; Kristoffersen, A.B.; Faller, R.; Tengs, T. A novel totivirus and piscine reovirus (PRV) in Atlantic salmon (Salmo salar) with cardiomyopathy syndrome (CMS). Virol. J. 2010, 7, 309. [Google Scholar] [CrossRef] [PubMed]
- Haugland, O.; Mikalsen, A.B.; Nilsen, P.; Lindmo, K.; Thu, B.J.; Eliassen, T.M.; Evensen, Ø. Cardiomyopathy syndrome of atlantic salmon (Salmo salar L.) is caused by a double-stranded RNA virus of the Totiviridae family. J. Virol. 2011, 85, 5275–5286. [Google Scholar] [CrossRef] [PubMed]
- Fritsvold, C.; Mikalsen, A.B.; Poppe, T.; Taksdal, T.; Sindre, H. Characterization of an outbreak of cardiomyopathy syndrome (CMS) in young Atlantic salmon, Salmo salar L. J. Fish. Dis. 2021, 44, 2067–2082. [Google Scholar] [CrossRef] [PubMed]
- Fritsvold, C.; Mikalsen, A.B.; Haugland, Ø.; Tartor, H.; Sindre, H. Characterization of early phases of cardiomyopathy syndrome pathogenesis in Atlantic salmon (Salmo salar L.) through various diagnostic methods. J. Fish. Dis. 2022, 45, 1267–1279. [Google Scholar] [CrossRef]
- Sandlund, L.; Mor, S.K.; Singh, V.K.; Padhi, S.K.; Phelps, N.B.D.; Nylund, S.; Mikalsen, A.B. Comparative Molecular Characterization of Novel and Known Piscine Toti-Like Viruses. Viruses 2021, 13, 1063. [Google Scholar] [CrossRef]
- De Lima, J.G.S.; Teixeira, D.G.; Freitas, T.T.; Lima, P.; Lanza, D.C.F. Evolutionary origin of 2A-like sequences in Totiviridae genomes. Virus Res. 2019, 259, 1–9. [Google Scholar] [CrossRef]
- Ghabrial, S.A.; Nibert, M.L. Victorivirus, a new genus of fungal viruses in the family Totiviridae. Arch. Virol. 2009, 154, 373–379. [Google Scholar] [CrossRef]
- Wolf, K.; Quimby, M.C. Lymphocystis virus: Isolation and propagation in centrarchid fish cell lines. Science 1966, 151, 1004–1005. [Google Scholar] [CrossRef]
- Fijan, N.; Sulimanovic, D.; Bearzotti, M.; Muzinic, D.; Zwillenberg, L.O.; Chilmonczyk, S.; Vautherot, J.F.; De Kinkelin, P. Some properties of the Epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann. Virol. (Inst. Pasteur) 1983, 134E, 207–220. [Google Scholar] [CrossRef]
- Lannan, C.N.; Winton, J.R.; Fryer, J.L. Fish cell lines: Establishment and characterization of nine cell lines from salmonids. In Vitro 1984, 20, 671–676. [Google Scholar] [CrossRef]
- Wolf, K.; Quimby, M.C. Established eurythermic line of fish cells in vitro. Science 1962, 135, 1065–1066. [Google Scholar] [CrossRef]
- Hedrick, R.P.; McDowell, T.S.; Groff, J.M.; Yun, S.; Wingfield, W.H. Isolation of an epitheliotropic herpesvirus from white sturgeon Acipenser transmontanus. Dis. Aquat. Organ 1991, 11, 49–56. [Google Scholar] [CrossRef]
- Hedrick, R.P.; Gilad, O.; Yun, S.; Spangenberg, J.V.; Marty, G.D.; Nordhausen, R.W.; Eldar, A. A Herpesvirus Associated with Mass Mortality of Juvenile and Adult Koi. a Strain of Common Carp. J. Aquat. Anim. Health 2000, 12, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.N.; Ueno, Y.; Kou, G.H. A cell line derived from Japanese eel (Anguilla japonica) kidney. Proc. Natl. Sci. Counc. Repub. China B 1982, 6, 93–100. [Google Scholar]
- Frerichs, G.N.; Morgan, D.; Hart, D.; Skerrow, C.; Roberts, R.J.; Onions, D.E. Spontaneously productive C-type retrovirus infection of fish cell lines. J. Gen. Virol. 1991, 72, 2537–2539. [Google Scholar] [CrossRef]
- Castric, J. Obtention Et Etude De Quelques Caractéristiques D’une Lignée Cellulaire Du Bar Morone labrax (Linne); DEA Océanologie biologique; Faculté des Sciences de Brest, Université de Bretagne Occidentale: Brest, France, 1984; 30p. [Google Scholar]
- Louboutin, L.; Dheilly, N.M.; Cabon, J.; Picon Camacho, S.; Leroux, A.; Lucas, P.; Morin, T. Characterization of a novel picornavirus isolated from moribund gilthead seabream (Sparus aurata) larvae. J. Fish. Dis. 2022, 45, 707–716. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2017, 35, 518–522. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Ninove, L.; Nougairede, A.; Gazin, C.; Thirion, L.; Delogu, I.; Zandotti, C.; De Lamballerie, X. RNA and DNA bacteriophages as molecular diagnosis controls in clinical virology: A comprehensive study of more than 45,000 routine PCR tests. PLoS ONE 2011, 6, e16142. [Google Scholar] [CrossRef]
- Garseth, Å.H.; Fritsvold, C.; Svendsen, J.C.; Bang Jensen, B.; Mikalsen, A.B. Cardiomyopathy syndrome in Atlantic salmon Salmo salar L.: A review of the current state of knowledge. J. Fish. Dis. 2018, 41, 11–26. [Google Scholar] [CrossRef]
- Fujimura, T.; Ribas, J.C.; Makhov, A.M.; Wickner, R.B. Pol of gag-pol fusion protein required for encapsidation of viral RNA of yeast L-A virus. Nature 1992, 359, 746–749. [Google Scholar] [CrossRef]
- Shmulevitz, M.; Duncan, R. A new class of fusion-associated small transmembrane (FAST) proteins encoded by the non-enveloped fusogenic reoviruses. EMBO J. 2000, 19, 902–912. [Google Scholar] [CrossRef]
- Salsman, J.; Top, D.; Boutilier, J.; Duncan, R. Extensive syncytium formation mediated by the reovirus FAST proteins triggers apoptosis-induced membrane instability. J. Virol. 2005, 79, 8090–8100. [Google Scholar] [CrossRef] [PubMed]
- Shmulevitz, M.; Corcoran, J.; Salsman, J.; Duncan, R. Cell-cell fusion induced by the avian reovirus membrane fusion protein is regulated by protein degradation. J. Virol. 2004, 78, 5996–6004. [Google Scholar] [CrossRef] [PubMed]
- Hansen, T.; Haugland, O.; Furuvik, A.; Tingbø, T.; Nilsen, P.; Rode, M.; Evensen, Ø. Tissue tropism of piscine myocarditis virus (PMCV) in experimentally challenged Atlantic salmon. In Proceedings of the 15th International Conference on Diseases of Fish and Shellfish (EAFP), Split, Croatia, 12–16 September 2011. [Google Scholar]
- Timmerhaus, G.; Krasnov, A.; Nilsen, P.; Alarcon, M.; Afanasyev, S.; Rode, M.; Takle, H.; Jørgensen, S.M. Transcriptome profiling of immune responses to cardiomyopathy syndrome (CMS) in Atlantic salmon. BMC Genom. 2011, 12, 459. [Google Scholar] [CrossRef] [PubMed]
- Bang Jensen, B.; Nylund, S.; Svendsen, J.C.; Ski, P.R.; Takle, H. Indications for a vertical transmission pathway of piscine myocarditis virus in Atlantic salmon (Salmo salar L.). J. Fish. Dis. 2019, 42, 825–833. [Google Scholar] [CrossRef]
- Mikalsen, A.B.; Lund, M.; Manji, F.; Kjønstad, M.V.; Bergtun, P.H.; Ritchie, G.; Evensen, Ø. Lack of evidence of vertical transmission of piscine myocarditis virus in Atlantic salmon (Salmo salar L.). J. Fish. Dis. 2020, 43, 715–718. [Google Scholar] [CrossRef]
Sampling Date | Internal ID | Age (in dph) | Status | Cell Culture Analysis | NGS Analysis | Conventional RT-PCR |
---|---|---|---|---|---|---|
5 February 2018 | QQ40b * | 27 | Dying | CPEs on BF2, LEB, and WSSK1 at 14 °C | POS | np |
5 February 2018 | QQ41 | 27 | Dying | CPEs on BF2, LEB, and WSSK1 at 14 °C | np | POS |
5 February 2018 | QQ42 | 22 | Dying | CPEs on BF2 (week signal) | np | POS |
7 March 2019 | QQ111 | 33 | Dying | CPEs on BF2, LEB, and WSSK1 at 14 °C | np | POS |
7 March 2019 | QQ112 | 30 | Healthy | CPEs on BF2, LEB, and WSSK1 at 14 °C | np | POS |
23 April 2018 | QQ118 | 21 | Healthy | CPEs on BF2 (week signal) | np | POS |
23 April 2018 | QQ119 | 16 | Healthy | NEG | np | NEG |
12 November 2019 | SS200 | 31 | Dying | CPEs on LEB cells | np | np |
13 November 2019 | SS52 | 32 | Dying | CPEs on LEB cells | np | np |
12 November 2019 | RR200 * | 31 | Dying | CPEs on LEB cells | POS | np |
Identification | Sequence | Target | Position | %GC | Length | Tm | PCR Product Size (bp) |
---|---|---|---|---|---|---|---|
RT-qPCR (detection) | |||||||
oPVP446 | Forward: CTCTGAGAGCGGCTCTATTGGT | MS2 bacteriophage | Replicase gene | 54 | 22 | 66 | 101 |
oPVP447 | Reverse: GTTCCCTACAACGAGCCTAAATTC | 46 | 24 | 64 | |||
tqPVP25 | FAM-TCAGACACGCGGTCCGCTATAACGA-BHQ1 | 56 | 25 | 75 | |||
oPVP559 | Forward: CCGAGGCTATCAAAGTCAGC | Toti-like virus | 3917–3936 | 55 | 20 | 60 | 110 |
oPVP560 | Reverse: GCAGTCCATCTCCAACCACT | 4007–4026 | 55 | 20 | 60 | ||
tqPVP33 | FAM-AGGATCGTTTCTGGCGTCAAAGAAT-BHQ1 | 44 | 25 | 70.2 | |||
Conventional RT-PCR (detection and sequencing) | |||||||
oPVP592 | Forward: CGCCATCTGGATTTGCAGAC | Toti-like virus | 81 to 101 | 55 | 20 | 60 | 888 |
oPVP593 | Reverse: CAGGATGAGGAACGCTGGTT | 948 to 968 | 55 | 20 | 60 | ||
oPVP594 | Forward: ACAGCGTCGGAACAGACATT | 926 to 946 | 50 | 20 | 60 | 944 | |
oPVP595 | Reverse: CTCCGCTCGCATCTGGTTAT | 1849 to 1869 | 55 | 20 | 60 | ||
oPVP596 | Forward: AGTGCGTCTGAACAGAGTGG | 1740 to 1760 | 55 | 20 | 60 | 845 | |
oPVP597 | Reverse: CTCGCCCTTGCCTGATGTTA | 2564 to 2584 | 55 | 20 | 60 | ||
oPVP532 | Forward: AATGGAGTGGGTTGAACTCG | 2353 to 2373 | 50 | 20 | 60 | 983 | |
oPVP533 | Reverse: TCATCAACCATTTCCTCGTG | 3317 to 3336 | 45 | 20 | 60 | ||
oPVP598 | Forward: AAGGGTTCGGCGATCATTGG | 3250 to 3270 | 55 | 20 | 61 | 851 | |
oPVP599 | Reverse: AACTATTCCCCTTGCGACCG | 4080 to 4100 | 55 | 20 | 60 | ||
oPVP600 | Forward: TTCGGGCATCAGGAGCATTT | 4060 to 4080 | 50 | 20 | 60 | 860 | |
oPVP601 | Reverse: TGTTGAAATCCAGTTCCCCGT | 4899 to 4919 | 48 | 20 | 60 | ||
oPVP602 | Forward: TTGGACACGGGTTGAGGATC | 4804 to 4824 | 55 | 20 | 60 | 821 | |
oPVP603 | Reverse: CCCTGTTCCCATGTGCTTCT | 5604 to 5624 | 55 | 20 | 60 | ||
oPVP604 | Forward: TGCGTACTGAGACCACCAAG | 5585 to 5605 | 55 | 20 | 60 | 812 | |
oPVP605 | Reverse: AAGCGATAACGTCAGGTGCA | 6376 to 6396 | 50 | 20 | 60 | ||
oPVP606 | Forward: TGCACCTGACGTTATCGCTT | 6377 to 6397 | 50 | 20 | 60 | 269 | |
oPVP607 | Reverse: GTGTGTCTTCGTCCTCTTCGT | 6625 to 6645 | 52 | 20 | 60 | ||
oPVP610 | Forward: ACCGGAGAGCTTGGTTTTCG | 6273 to 6293 | 55 | 20 | 64 | 211 | |
oPVP611 | Reverse: TTCCCCTCCATCTCCAACCA | 6474 to 6494 | 55 | 20 | 65 | ||
oPVP612 | TTGCAAGCCCTTTCCTTCCA | primer 1 5′RACE PCR | 359 to 379 | 50 | 20 | 65 | 257 |
oPVP615 | ATGTAGAGTAGCAGGTCTGTCAAACCC | primer 2 5′RACE PCR | 275 to 301 | 48 | 27 | 67 | |
oPVP616 | TAGAAGTAGCTCATGGTTAGGACC | primer 3 5′RACE PCR | 232 to 255 | 46 | 24 | 61 | |
oPVP629 | AGGTCCGATGAGCGTATTGAAACTAC | primer 3′RACE | 6504 | 46 | 26 | 68 | 315 |
Positive control | |||||||
oPVP608 | Forward +T7: ATTGTTAATACGACTCACTATAGGGAACAGGAGGGGTGTGTTTGT | In vitro RNA | 3804 to 3823 | 42 | 45 | 78 | 286 |
oPVP609 | Reverse: CCCGAAGGATCGATAAGTTAA | 4045 to 4065 | 43 | 21 | 62 |
Accession Number | SeqId | Bioproject | Biosample | SRA (SRR Accession) |
---|---|---|---|---|
OQ791576 | Toti-like_virus_isolate_QQ40-1stP-BF2 | PRJNA930349 | SAMN33713179 | SRR24070899 |
OQ791577 | Toti-like_virus_RR200-MINOR | PRJNA930359 | SAMN33713174 | SRR24072066 |
OQ791578 | Toti-like_virus_RR200-MAJOR | PRJNA930359 | SAMN33713175 | SRR24072066 |
OQ791581 | Toti-like_virus_isolate_QQ40-10thP-LEB | PRJNA930356 | SAMN33713178 | SRR24070344 |
Mode of Contamination | Organs | Days Post-Infection | |||||||
---|---|---|---|---|---|---|---|---|---|
16 | 23 | 30 | 60 | ||||||
Bath | blood | B1 | nd | B8 | nd | B15 | - | B22 | nd |
brain | B2 | nd | B9 | nd | B16 | - | B23 | nd | |
kidney | B3 | nd | B10 | nd | B17 | nd | B24 | nd | |
spleen | B4 | 31.48 | B11 | nd | B18 | nd | B25 | nd | |
heart | B5 | nd | B12 | nd | B19 | nd | B26 | nd | |
dorsal fin | B6 | nd | B13 | 35.99 | B20 | nd | B27 | nd | |
gills | B7 | 35.04 | B14 | nd | B21 | nd | B28 | nd | |
IP injection | blood | I1 | 37.73 | I8 | nd | I15 | - | I22 | nd |
brain | I2 | nd | I9 | nd | I16 | nd | I23 | nd | |
kidney | I3 | 31.93 | I10 | 32.34 | I17 | 32.46 | I24 | 34.11 | |
spleen | I4 | 29.93 | I11 | 28.35 | I18 | 28.70 | I25 | 31.53 | |
heart | I5 | 30.04 | I12 | 29.56 | I19 | 30.27 | I26 | 31.01 | |
dorsal fin | I6 | 34.51 | I13 | 35.70 | I20 | 29.67 | I27 | nd | |
gills | I7 | 34.91 | I14 | 35.07 | I21 | 35.95 | I28 | nd | |
Negative control | blood | T1 | nd | ||||||
brain | T2 | nd | |||||||
kidney | T3 | nd | |||||||
spleen | T4 | nd | |||||||
heart | T5 | nd | |||||||
dorsal fin | T6 | nd | |||||||
gills | T7 | nd |
a | ||||
Label | Tank | Species | Concentration by Ultracentrifuge | |
Ct | Amount (cp.Reaction−1) | |||
1 | A | BASS | nd | - |
2 | 26.89 | 2.85 × 106 | ||
3 | 35.21 | 7.93 × 103 | ||
4 | 32.56 | 5.18 × 104 | ||
5 | 33.72 | 2.27 × 104 | ||
1 | B | BASS | 35.98 | 2.69 × 103 |
2 | nd | - | ||
3 | 35.28 | 7.53 × 103 | ||
4 | nd (limit of detection) | - | ||
5 | 32.71 | 4.66 × 104 | ||
1 | C | BREAM | 32.57 | 2.84 × 104 |
2 | 33.32 | 3.03 × 104 | ||
3 | nd | - | ||
4 | nd (limit of detection) | - | ||
5 | 39.57 (below LOD) | 3.64 × 102 | ||
b | ||||
Sample | Gonads | |||
Ct | Amount.Reaction−1 | |||
1A | 31.47 | 1.42 × 105 | ||
1B | 31.93 | 9.67 × 104 | ||
1C | 36.05 | 3.07 × 103 | ||
1D | 36.37 | 2.34 × 103 | ||
2A | 35.41 | 6.38 × 103 | ||
2B | nd | nd | ||
2C | nd | nd | ||
2D | 36.77 | 1.68 × 103 | ||
2E | 37.44 | 1.21 × 103 | ||
3A | 39.26 | 2.09 × 102 | ||
3B | 32.04 | 8.82 × 104 | ||
3C | 34.55 | 1.08 × 104 | ||
3D | 37.20 | 1.17 × 103 | ||
3E | 34.58 | 1.25 × 104 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Louboutin, L.; Cabon, J.; Beven, V.; Hirchaud, E.; Blanchard, Y.; Morin, T. Characterization of a New Toti-like Virus in Sea Bass, Dicentrarchus labrax. Viruses 2023, 15, 2423. https://doi.org/10.3390/v15122423
Louboutin L, Cabon J, Beven V, Hirchaud E, Blanchard Y, Morin T. Characterization of a New Toti-like Virus in Sea Bass, Dicentrarchus labrax. Viruses. 2023; 15(12):2423. https://doi.org/10.3390/v15122423
Chicago/Turabian StyleLouboutin, Lénaïg, Joëlle Cabon, Véronique Beven, Edouard Hirchaud, Yannick Blanchard, and Thierry Morin. 2023. "Characterization of a New Toti-like Virus in Sea Bass, Dicentrarchus labrax" Viruses 15, no. 12: 2423. https://doi.org/10.3390/v15122423
APA StyleLouboutin, L., Cabon, J., Beven, V., Hirchaud, E., Blanchard, Y., & Morin, T. (2023). Characterization of a New Toti-like Virus in Sea Bass, Dicentrarchus labrax. Viruses, 15(12), 2423. https://doi.org/10.3390/v15122423