Next Article in Journal
Modulation and Protection Effects of Antioxidant Compounds against Oxidant Induced Developmental Toxicity in Zebrafish
Previous Article in Journal
Stability of Phenolic Compounds in Grape Stem Extracts
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 9
Issue 8
10.3390/antiox9080719
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Antiaging Effect of Active Fractions and Ent-11α-Hydroxy-15-Oxo-Kaur-16-En-19-Oic Acid Isolated from Adenostemma lavenia (L.) O. Kuntze at the Cellular Level

by
Irmanida Batubara
1,2,*,
Rika Indri Astuti
3,
Muhammad Eka Prastya
3,
Auliya Ilmiawati
1,
Miwa Maeda
4,
Mayu Suzuki
5,
Akie Hamamoto
5 and
Hiroshi Takemori
4,5,*
1
Department of Chemistry, Faculty of Mathematics and Natural Sciences, IPB University, IPB Dramaga Campus, Bogor, West Java 16680, Indonesia
2
Tropical Biopharmaca Research Center, IPB University, Taman Kencana Street No. 3, Bogor 16128, Indonesia
3
Department of Biology, Faculty of Mathematics and Natural Sciences, IPB University, IPB Dramaga Campus, Bogor, West Java 16680, Indonesia
4
Graduate School of Natural Science and Technology, Gifu University; Gifu 501-1193, Japan
5
Department of Chemistry and Biomolecular Science, Faculty of Engineering, Gifu University; Gifu 501-1193, Japan
*
Authors to whom correspondence should be addressed.
Antioxidants 2020, 9(8), 719; https://doi.org/10.3390/antiox9080719
Submission received: 29 June 2020 / Revised: 4 August 2020 / Accepted: 6 August 2020 / Published: 8 August 2020
(This article belongs to the Section Health Outcomes of Antioxidants and Oxidative Stress)
Browse Figures
Review Reports Versions Notes

Abstract

:
Background: The extract of Adenostemma lavenia (L.) O. Kuntze leaves has anti-inflammatory activities and is used as a folk medicine to treat patients with hepatitis and pneumonia in China and Taiwan. The diterpenoid ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic acid (11αOH-KA) is the major ingredient in the extract and has wide-spectrum biological activities, such as antitumor and antimelanogenic activities, as well as anti-inflammatory activity. However, the physical and biological properties of this compound as an antioxidant or antiaging agent have not been reported yet. Methods: In addition to in vitro assays, we monitored antioxidative and antiaging signals in Schizosaccharomyces pombe (yeast) and mouse melanoma B16F10 cells. Results: A. lavenia water and chloroform fractions showed antioxidant properties in vitro. The A. lavenia extracts and 11αOH-KA conferred resistance to H2O2 to S. pombe and B16F10 cells and extended the yeast lifespan in a concentration-dependent manner. These materials maintained the yeast mitochondrial activity, even in a high-glucose medium, and induced an antioxidant gene program, the transcriptional factor pap1+ and its downstream ctt1+. Accordingly, 11αOH-KA activated the antioxidative transcription factor NF-E2-related factor 2, NRF2, the mammalian ortholog of pap1+, in B16F10 cells, which was accompanied by enhanced hemeoxygenase expression levels. These results suggest that 11αOH-KA and A. lavenia extracts may protect yeast and mammalian cells from oxidative stress and aging. Finally, we hope that these materials could be helpful in treating COVID-19 patients, because A. lavenia extracts and NRF2 activators have been reported to alleviate the symptoms of pneumonia in model animals.

1. Introduction

Adenostemma lavenia (L.) O. Kuntze, a perennial herb, belongs to the Asteraceae family and grows widely in the tropical regions of Asia. This plant has been traditionally used as a medicinal herb in the Pacific Islands to cure pneumonia, lung congestion, fever, hepatitis, and skin wounds [1]. A recent study showed that A. lavenia extract had anti-inflammatory activity in LPS-treated RAW 264.7 cells and mice [2]. In addition, the leaf extract of this plant has antimelanogenic activities in B16F10 cells and suppresses hair pigmentation in infant mice [3,4]. Notably, A. lavenia leaf extract contains a higher amount of ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic acid (11αOH-KA), which may be responsible for 50% of the antimelanogenic activity in the extracts [4] (Figure 1).
The 11αOH-KA belongs to diterpene/kaurane class, which is found in some plants, including the compositae (Gochnatia decora) and ferns (Pteris semipinnata), as well as A. lavenia [5,6]. Interestingly, 11αOH-KA exhibits various pharmaceutical potentials, such as anticancer, anti-inflammation, and skin whitening [4,5]. Despite the broad activities of 11αOH-KA, the potential of this compound as an antioxidant and antiaging material in skin care has not been clarified yet.
Aging is defined as a gradual loss of physiological integrity, which leads to the progressive deterioration of cellular components and constituents [7]. The accumulation of reactive oxygen species (ROS), mitochondrial dysfunctions, DNA mutations, and advanced glycation end products (AGEs) has been reported to be a primary factor in cellular aging [7,8]. However, aging phenotypes/symptoms are complicated in multicellular organisms due to the presence of different types of cells.
To examine the potential of 11αOH-KA as an antioxidant and antiaging reagent at cellular levels, we used Schizosaccharomyces pombe (yeast) and mouse B16F10 melanoma cells as model systems. S. pombe has a number of advantages including rapid growth, easy cultivation, and well-characterized genomes with conserved genetic pathways in eukaryotic cells, which facilitates its usage as a eukaryotic model to understand the cellular events that occur in higher organisms [9]. Excess calorie consumption and H2O2 stress have been found to modulate the lifespan in yeasts and other organisms with similar mechanisms [7,9,10,11,12].
S. pombe has mechanisms for controlling aging through the factors involved in oxidative stress responses [7,8]. In addition, calorie restriction (CR) conditions also extend the lifespan in S. pombe via the suppression of the Target of Rapamycin (TOR) pathway and upregulation of SIR2 histone deacetylase (sirtuin family) pathways. These cascades result in a suppressed mitochondrial activity, which enhances the expression of antioxidant enzymes and resistance to reactive oxygen species (ROS) [9,13]. In this pathway, the basic leucine zipper domain, bZIP, and transcription factor yeast Pap1 are crucial regulators of cellular defense against oxidative stresses [14].
On the other hand, in mammalian cells, antioxidative responses primarily activate the transcription factor nuclear factor E2-related factor 2 (NRF2, the yeast ortholog of Pap1). Then, the active NRF2 induces downstream genes including heme-oxygenase-1 (HO-1), Nqo1, and glutamate cysteine ligase catalytic (Gclc), which are essential for the inhibition of ROS-induced pro-inflammatory responses [15,16,17].
In this study, we demonstrated that A. lavenia water and chloroform fractions as well as 11αOH-KA prolonged yeast lifespan. Specifically, 11αOH-KA showed CR mimic activity in yeast, followed by oxidative stress responses. Furthermore, experiments in mouse B16F10 cells showed that these materials upregulate NRF2 protein levels, accompanied by enhanced levels of HO-1 protein. These results suggest beneficial effects of 11αOH-KA and A. lavenia extracts as potential candidates for antiaging ingredients in drugs, foods, supplements, and cosmetics.

2. Materials and Methods

2.1. 11α-OH-KA

A. lavenia was collected from Bogor, West Java, Indonesia. 11αOH-KA, isolated from A. lavenia leaves with a purity of >95%, judging from the NMR spectra in Gifu University [4], was dissolved in dimethyl sulfoxide (DMSO). Briefly, a dried powder (100 g) obtained from A. lavenia leaves was soaked in distilled water 1:30 (w/v) at 55 °C for 12 h. The water-soluble fraction (A. lavenia water fraction) was recovered after filtration with coffee filtrates, and 11αOH-KA was purified by chloroform extraction (A. lavenia chloroform fraction) followed by silica gel chromatography. 11αOH-KA was recovered as crystals.

2.2. Cell Culture

The fission yeast S. pombe wild-type strain ARC039 (h-leu1-32 ura4-294: Asahi Glass Co. Ltd., Tokyo, Japan), a gift from Dr. Hiroshi Takagi (Nara Institute of Science and Technology, Nara, Japan), was used in all experiments. The yeast cells were routinely maintained in a yeast extract with supplement (YES) medium containing 3% glucose.
Mouse B16F10 melanoma cells from the RIKEN cell bank (RIKEN, Saitama, Japan) were cultured in Dulbecco’s modified Eagle’s medium (DMEM with 4.5 g/L d-Glucose, Nacalai Tesque, Kyoto, Japan) containing 10% fetal bovine serum (FBS: Sigma-Aldrich Japan, Tokyo, Japan) and a penicillin‒streptomycin solution (WAKO, Osaka, Japan).
The B16F10 cells were plated in six-well dishes at 1.0 × 105 cells/well. After two days, cells were washed with phosphate-buffered saline (PBS) and collected in a 1.5-mL tube. Melanin content was first visually examined by photos, and then measured by optical density (OD) at 450 nm after extraction with 2N NaOH for 4 h. The melanin content was normalized by protein levels measured by the Bradford method (Protein assay kit, Nacalai Tesque, Kyoto, Japan).
To measure NFR2 activity using a reporter assay, OKD48-luc plasmid (Transgenic Inc, Kobe, Japan) was transformed into B16F10 cells with pRL-TK (internal reporter, Promega, Madison, WI, USA), and the cells were stimulated with 11αOH-KA or andrographolide (AG) for 24 h. The reporter activities were monitored by the dual luciferase reporter system (Promega). To detect NRF2 protein, HO-1 protein, and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) protein, anti-NRF2 antibody (GTX103322, GeneTex Inc., Irvine, CA, USA), anti-HO-1 antibody (GTX101147, GeneTex Inc.), and horseradish peroxidase-conjugated anti-GAPDH antibody (MBL Co. Ltd., Nagoya, Japan) were used.

2.3. Measurement of Antioxidant and Antiglycation Activities

Antioxidant activities of fractions were measured based on the radical scavenging activity toward 2,2′-diphenyl-1-picrylhydrazyl (DPPH) and 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS), as described previously [18,19]. The antiglycation reactions were carried out by mixing fractions in solution and the glycation substrate based on a previous method [20].

2.4. Oxidative Stress Tolerance and Survival Assays

S. pombe was cultured in a YES broth supplemented with fractions with an initial OD600 of 0.05 in a shaking incubator at 30 °C. The maximum concentration of fractions was set to 5 times IC50 in DPPH activity. At day 7 and 11, 5 mM H2O2 was added to the culture medium. The viability of S. pombe was measured at day 3 after H2O2 treatment. The survival assay was conducted by using the total plate count, TPC, method at day 11.
For the aging assay, spot tests were also conducted at day 7 and 11. Initially, each of the yeast cultures was adjusted to the OD600 of 1.0 and serially diluted. Immediately, 3 µL of each aliquot were spotted onto a YES or YES agar plates containing various concentrations of H2O2 and incubated for three days at 30 °C. As for chronological aging experiments, the TPC assay was performed on the yeast culture (similar with above) at day 1, 5, 10, 15, and 20. Each culture was serially diluted and spread in triplicate on a YES agar plate, followed by incubation for three days.
Yeast mitochondrial activity was determined by using rhodamine B (Merch, St. Louis, MO, USA) as a mitochondria probe. The reaction mixture was prepared as described in [11]. The fluorescent signal was observed using a BX51 fluorescent microscope (Olympus, Tokyo, Japan).

2.5. RNA Isolation and Real-Time Quantitative PCR Assay

Yeast cells were grown in a YES broth containing 11αOH-KA, with an initial OD600 of 0.05 at 30 °C for 18 h in a shaking incubator (120 rpm). Then, yeast cells were harvested with centrifugation at 5000 rpm for 2.5 min at −4 °C. RNA was isolated using RNAeasy kit (Qiagen, Germantown, MD, USA) and then converted to cDNA using iScriptTM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Quantitative polymerase chain reaction (qPCR) was applied using Applied Biosystems StepOnePlus™ Instrument and Thunderbird SYBR qPCR master mix (Toyobo, Osaka, Japan) as a fluorescent mixture with the primers as follows: pap1+ Forward, 5′ TGGATGGCGATGTTAAGCCT/Reverse, 5′ GCAGCACGGTTTTGAGCTTT (SPAC1783.07c). ctt1+ Forward, 5′ TCGTGACGGCCCTATGAATG/Reverse, 5′ AGCAAGTGGTCGGATTGAGG (SPCC757.07c). Gene expression was normalized to the housekeeping gene act1. act1+ Forward, 5′ CGGTCGTGACTTGACTGACT/Reverse, 5′ ATTTCACGTTCGGCGGTAGT (SPBC32H8.12c).

2.6. Intracellular Yeast Metabolite Extraction and LC-MS Analysis

Intracellular yeast metabolites were prepared by the procedure described previously, with modifications [21]. Treatment cultures were prepared in YES broth medium with an initial yeast cells OD600 of 0.05 and supplemented with 11αOH-KA (45 µg mL−1), then incubated until the mid-log phase with constant shaking (120 rpm) at 30 °C. The harvested yeast cells were immediately quenched in 21 mL of MeOH at −20 °C. The extracellular metabolites were separated from intracellular metabolites (cells pellet) by centrifugation (5000 rpm) for 5 min at −20 °C. To extract metabolites, 2.5 mL pre-cold 50% MeOH/H2O was added to the yeast cells pellet, followed by supplementation in 2.5 mL of pre-cold CHCl3. After centrifugation (5000 rpm) for 5 min at −20 °C, the lower-phase (CHCl3) and the upper-phase (MeOH/H2O) were collected. This mixture was then concentrated by nitrogen evaporation and dry-frozen. Finally, each sample was resuspended in 100 µL (1:1, v/v) acetonitrile: H2O and 1 µL was used for each LC-MS injection.
LC-MS data were acquired using a UHPLC vanquish tandem equipped with UltimateTM 3000 RSLC nano system and coupled to an Q Executive hybrid quadrupole-orbitrap mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). LC separation was conducted on an Accucore™ phenyl-hexyl HPLC column (Thermo Fisher Scientific, 100 × 2.1 mm, 2.6 µm particle size). Acetonitrile with 0.1% formic acid (A) and LC-MS H2O2 with 0.1% formic acid (B) were used as the mobile phase, with gradient elution from 95% A (5% B) to 5% A (95% B) in 30 min and a 0.3 mL min−1 flow rate. Electrospray ionization (ESI) was used. Each sample was injected once (1 µL) with the ESI, operated in both negative and positive ionization mode. Nitrogen was used as the carrier gas. The mass spectrometer was operated in full scan mode with a scan range of 100–1000 m/z and automatic data-dependent MS/MS fragmentation scans. Moreover, raw LC-MS data were analyzed by Compound Discoverer 2.1 software (Thermo Fisher Scientific). The corresponding software was integrated to the mzCloud and ChemSpider for matching fragmentation spectra and compounds.

2.7. Statistical Analyses

All results were expressed as the mean ± SEM (n = 3). Means of different groups were compared using one-way ANOVA followed by Duncan’s multiple range test.

3. Results

3.1. Ability of A. lavenia Fractions to Scavenge Free Radicals and Inhibit AGEs Production In Vitro

Both the A. lavenia chloroform fraction (Acf) and water fraction (Awf) could substantially scavenge radicals of DPPH (Table 1). However, their scavenging efficacies were about fifty times lower than that of ascorbic acid. In contrast, based on an ABTS scavenging assay (represented by the value equivalent to Trolox), both fractions efficiently scavenged radicals. An antiglycation assay showed that Acf has the higher capacity to suppress AGEs production than Awf. These results suggest that A. lavenia extracts not only had radical-scavenging activity, but also antiglycation activity, which prompted us to examine the antiaging potential of the A. lavenia fractions and its ingredient 11αOH-KA in a model organism, S. pombe.

3.2. Cellular Antioxidant and Antiaging Activities of A. lavenia Extracts

Oxidative stress is a major factor of aging [22], and a number of natural compounds have been found to have antiaging activity. Therefore, we examined the correlations between the antioxidative activities and antiaging potentials of A. lavenia fractions. First, we confirmed no effect of DMSO on yeast survival under oxidative stress conditions with 5 mM H2O2 (Figure 2A).
When Awf and Acf, at different doses, were supplemented to the medium, dose-dependent protection of S. pombe from 5 mM H2O2 was observed (Figure 2B). The limiting dilution indicated optimum protective concentrations of Awf and Acf at 1260 µg mL−1 and 888 µg mL−1, respectively (Figure 2C). The calculation of colony-forming units suggested that Acf was more effective than Awf (Figure 2D).

3.3. 11αOH-KA Extends Yeast Life Span

To examine whether 11αOH-KA, a major ingredient in A. lavenia fractions [4], conferred H2O2 resistance and longevity to S. pombe, we performed similar experiments and a chronological life span (CLS) assay with 11αOH-KA. In spot assays, the 11αOH-KA treatment (45 µg mL−1) significantly extended the yeast lifespan at both day 7 and 11 (Figure 3A). In addition, although the effect on the longevity under calorie restriction (CR: 0.5% glucose) conditions was higher than the 11αOH-KA treatment, the presence of 45 µg mL−1 11αOH-KA substantially prolonged the yeast survival under normal calorie conditions (3% glucose) (Figure 3B). Furthermore, 11αOH-KA significantly improved the cell growth of S. pombe at day 11, when mild oxidative stresses were loaded by 3 mM H2O2 (Figure 3C). Notably, a protective effect of 11αOH-KA against H2O2 was also observed under the CR conditions.

3.4. A. lavenia-Derived Fractions and 11αOH-KA Treatment Increase Mitochondria Activity

It is known that CR conditions enhance mitochondrial activity. Indeed, CR treatment (0.5% glucose) provoked high mitochondrial activity in yeast (Figure 4A). Interestingly, treatment of Awf (1260 µg mL−1), Acf (888 µg mL−1), and 11αOH-KA (45 µg mL−1) enhanced mitochondrial activity in the 3% glucose medium (Figure 4B), suggesting that A. lavenia treatment might mimic CR conditions.

3.5. 11αOH-KA Treatment Alters Yeast Intracellular Metabolites Involved in Stress Response Mechanism

Based on metabolomics profile, about 85 metabolites (Table S1, Figures S1–S3) could be analyzed using the software Compound Discoverer 2.1, and we observed a fluctuation in nearly all 83 metabolites (97.6%: 30 increased and 53 decreased) in S. pombe treated with 11αOH-KA. Notably, the levels of 15 metabolites were significantly changed after supplementation with 11αOH-KA (Table 2). The decrease in lactic acid level and the preservation of glucose in the yeast cells treated with 11αOH-KA might result from the activation of mitochondrial functions. Surprisingly, we found that two metabolites, l-proline and l-arginine (stress protectants), decreased significantly—by 33.75- and 2.25-fold, respectively. On the contrary, betaine and choline (other stress protectants) were significantly increased by 7.5- and 1.85-fold, respectively, suggesting a cellular homeostasis alteration occurred following treatment with 11αOH-KA that involves a wide array of stress response mechanisms, which might lead to the lifespan extension of S. pombe.
Importantly, there was no increase in l-cysteine, which is important for the synthesis of the antioxidant glutathione, suggesting that the Pap1 transcription factor, the yeast equivalent of mammalian NRF2 [23], might not fully contribute to the 11αOH-KA-mediated antioxidative stress actions in S. pombe.

3.6. A. lavenia Fractions and 11αOH-KA Upregulate Pap1-Dependent Antioxidant Signaling in Yeast

Although less of a contribution of the transcription factor Pap1 to the antioxidant signaling induced by 11αOH-KA was expected, we examined the effect of A. lavenia fractions and 11αOH-KA on Pap1 mRNA expression. Unexpectedly, treatment with all materials (Awf, Acf, and 11αOH-KA) significantly upregulated the expression of the pap1 gene, while only Acf and 11αOH-KA induced the ctt1 gene expression, a downstream product of Pap1 (Figure 5A,B), suggesting that unknown factors in Awf might suppress the expression of the ctt1 gene.

3.7. 11αOH-KA Upregulates Antioxidant Signaling in Mouse B16F10 Melanoma Cells

NRF2 is the orthologue of Pap1 in mammals [24,25], and several kauranic acids as well as AG (andrographolide: other diteropene) have been reported to decrease the rate of melanogenesis and increase the levels of the antioxidant enzyme HO-1 via NRF2 [26,27]. Therefore, we examined the possible involvement of NRF2 in 11αOH-KA-mediated antimelanogenic action and antioxidative stress pathways. Both 11αOH-KA and AG suppressed melanogenesis in mouse melanoma B16F10 cells (Figure 6A,B). The efficacity of 11αOH-KA was higher than AG.
To monitor Nrf2 activity in B16F10 cells, we used the NRF2-responsible reporter (OKD48-luc) (Figure 6C). 11αOH-KA strongly upregulated NRF2 activity, while AG did only slightly. We could detect free NRF2 protein when the cells were treated with 10 µM 11αOH-KA, which was accompanied by the induction of HO-1 (Figure 6D). Although Acf weakly upregulated protein levels of Nrf2 and HO-1, Awf did significantly (Figure 6E), suggesting that unidentified ingredients might negatively or positively interact with 11αOH-KA. In addition, 11αOH-KA and A. lavenia fractions conferred resistance to H2O2 on B16F10 cells (Figure 6F,G), suggesting that 11αOH-KA might induce antioxidative signaling, and these cascades might be implicated in antimelanogenic activity in mouse melanocytes.

4. Discussion

A water-based extract of A. lavenia leaves has been used for the treatment of inflammation, pneumonia, fever, hepatitis, lung congestion, and digestive system disorders [1,2,3,28], and, in the present study, exhibits additional functions, such as antioxidant and antiglycation activities. In addition to these benefits, we have found that A. lavenia fractions and 11αOH-KA promote longevity in S. pombe and resistance to oxidative stress in S. pombe as well as mouse B16F10 cells.
The A. lavenia leaf extract contained a high amount of 11αOH-KA (approximately 2.5% of dry leaf weight), and the compound showed antimelanogenic activity [4]. The in vitro antioxidant and antiglycation capacities of Awf and Acf were relatively weak compared to positive controls [3]. However, the fractions may have stronger antioxidant and antiglycation activities than other Asteraceae extracts. For example, extracts from Erigeron caucasicus and Faujasiopsis flexuosa have an IC50 value of 704 µg mL−1 and glycation inhibition value of 10.23% from a 1000 µg mL−1 sample for DPPH and antiglycation activities, respectively, which is approximately three times less effective than A. lavenia [29,30].
Although A. lavenia has not been approved for medical use, QualiHerb Co. Ltd. produces a water extract of aerial parts of A. lavenia in Taiwan and the United States. The supplier recommends taking the extract (0.4–1.2 g) two or three times a day before meals. When we imported the extract and reconstituted it in water (30 folds), it contained 11αOH-KA with only 1/100 of our water extracts (<10 µg mL−1) [4], almost 5-fold less concentration (even without further dilution) than the optimal concentration of 11αOH-KA in the present experiment.
S. pombe is commonly used as a model organism in aging studies [31]. Similar to several natural compounds, including acivicin, tschimganine, and l-arginine, it has been shown to extend the lifespan [11,12,22,31,32], in cooperation with the effects of CR [7]. A. lavenia fractions (Acf and Awf) and 11αOH-KA showed longevity effects as well as resistance to H2O2 oxidative stress in yeast. The longevity effects have been reported to be mediated by downregulation of the nutrient-sensing pathways involved in Tor1, Sck2, and Pka1 [31]. These factors modulate other cellular factors and events, such as Sir2, autophagy, and the adaptive responses, which, coupled with the downregulation of mitochondrial activities, lead to resistance to oxidative stress.
Interestingly, we observed that A. lavenia fractions and 11αOH-KA could upregulate yeast mitochondrial activity, which was also supported by metabolomics analyses. Mitochondria are indispensable in all eukaryotes to generate the bulk of cellular ATP and provide intermediates of amino acids, nucleotides, and lipids [33]. Importantly, mitochondrial activity produces intracellular ROS as by-products and these molecules play a critical role in regulating the yeast lifespan [34]. If the ROS level exceeds a toxic threshold, it accelerates the aging process by eliciting oxidative damage in yeast cells.
In contrast, if the concentration of ROS is maintained at a hormetic level (i.e., insufficient to cause damage to cellular macromolecules), the ROS can activate signaling networks that further induce gene expression for adaptive responses [15,17]. In agreement with those theories, we suggest that A. lavenia fractions and 11αOH-KA as well as CR may enforce mitochondrial integrity, resulting in a low level of ROS production. A similar mechanism has already been reported for compounds such as 3.3-diindolemethane in an extract of Pseudomonas sp. that promotes yeast longevity through ROS-adaptive signaling, which modulates mitochondrial activity [12,35]. In the future, we have to monitor the ROS production in cells treated with 11αOH-KA and A. lavenia extracts.
In addition, A. lavenia fractions stimulated the expression level of some genes implicated in oxidative stress responses, including pap1+ and ctt1+. The transcription factor Pap1 is mainly involved in adaptation rather than survival responses. Once Pap1 is activated and transported into the nucleus, it induces the expression of the following oxidative stress-induced genes, among others: ctt1+, trx2+, trr1+, and pgr1+ [17]. The products of these genes are involved in scavenging ROS, recovery from cell damage, and adaptive stress responses.
Similar to Pap1 in yeast cells, its orthologue factor NRF2 may also be activated by 11αOH-KA in B16F10 cells. It has already been reported that the ethyl acetate fraction of A. lavenia promotes the NRF2‒HO-1 axis and protects the lungs from lipopolysaccharide-induced inflammation [2]. However, this report proposed that p-coumaric acid was the compound responsible for the anti-inflammatory activity, suggesting that several compounds in A. lavenia may contribute to the antioxidative and anti-aging activities. Although NRF2 is known to suppress melanogenesis via the downregulation of Mitf (microphthalmia-associated transcription factor) gene expression, 11αOH-KA does not lower the MITF expression level [4]. This evidence suggests that NRF2 may contribute to the antimelanogenic activity of 11αOH-KA and A. lavenia extracts.
To gain comprehensive insight into 11αOH-KA’s effects on the extension of the yeast lifespan, we analyzed the metabolomics profile. Interestingly, we found that 11αOH-KA treatment remarkably decreased l-proline and l-arginine metabolites. l-proline and l-arginine play a pivotal role in yeast cells’ resistance to various stresses, i.e., against freezing, desiccation, oxidation, and ethanol [36,37]. In association with the metabolic pathway, the biosynthesis of l-arginine involves l-proline as one of the substrates. Along with those reports, the overexpression of genes that substantially promote l-proline biosynthesis increases the intracellular nitric oxide (NO) level in S. cerevisiae. As a result, increased NO confers high tolerance to multiple stresses including oxidation, drying, and freezing [38,39], as well as antiaging activity. However, in mouse macrophages, kaurenoic acids have been found to suppress NO production [40]. Further study is required to measure the NO level due to 11αOH-KA treatment.
In a yeast metabolic map, choline is one of the substrates for betaine biosynthesis via the betaine‒aldehyde pathway. It is intriguing to note that betaine has a principle role in the acquisition of stress tolerance in various organisms, including animals, plants, and most microorganisms, against environmental stresses such as drought, oxidative stress, osmotic stress, and extreme temperatures [41]. In fact, betaine also plays an important role in some yeast cells, including S. cerevisiae and Candida oleophila, inducing osmotic and oxidative stresses [42,43]. Moreover, recent studies have shown that betaine supplementation could have an antioxidative effect in HepG2 cells and rat brains by reducing intracellular levels [44,45]. This raises the possibility that the high level of betaine in yeast cells might function as an osmoprotectant that further induces yeast cells to adapt to stressful environments and, thus, increases the lifespan.
In addition to its antioxidant properties, 11αOH-KA has antimelanogenic potential, which can provide additional knowledge for the development of drugs, food supplements, or antiaging cosmetics. In particular, the activation of the NRF2‒HO-1 axis is now proposed to be a candidate to treat COVID-19 patients [46,47,48], and A. lavenia extract has been shown to ameliorate the pathogenesis of a model pneumonia induced by lipopolysaccharides [2]. We hope that the present study gives clues that will help us to solve a wide range of problems in the future.

5. Conclusions

11αOH-KA has unique physical properties as an antioxidant and induces cellular factors (pap1/ctt1 and NRF2/HO-1 in S. pombe and mouse melanoma, respectively) that contribute to resistance to oxidative stress. Specifically, 11αOH-KA extends the lifespan of S. pombe cells and protects both yeast and mouse cells from H2O2. These results suggest that 11αOH-KA and its source, A. lavenia, can be attractive materials for antiaging and related diseases.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-3921/9/8/719/s1, Figure S1: LC-MS chromatogram of blanko (acetonitrile and LC-MS water; 1:1; v/v) in negative mode; Figure S2: LC-MS chromatogram of DMSO control in negative mode; Figure S3: LC-MS chromatogram of 11αOH-KA (150 µM) treatment in negative mode; Table S1: Intracellular metabolites of yeast cells detected on DMSO and 11αOH-KA (150 µM) treatments.

Author Contributions

R.I.A., M.E.P., A.I., M.M., M.S. and A.H. performed the experiments. I.B. and H.T. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Ministry of Research and Higher Education of the Republic of Indonesia for the research funding given to IB through scheme Penelitian Dasar Unggulan Perguruan Tinggi (No. 4160/IT3.I.1/PN/2019). Part of this research is also partially funded by the Indonesian Ministry of Research, Technology and Higher Education under World Class University (WCU) Program managed by Institute Teknologi Bandung, Gifu city (Industry-Government-Academia program), Gifu University (Promotion of International Joint Research).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cheng, P.C.; Hufford, C.D.; Doorenbos, N.J. Isolation of 11-hydroxyated kauranic acids from Adenostemma lavenia. J. Nat. Prod. 1979, 42, 183–186. [Google Scholar] [CrossRef]
  2. Chen, J.J.; Deng, J.S.; Huang, C.C.; Li, P.Y.; Liang, Y.C.; Chou, C.Y.; Huang, G.J. p-Coumaric-acid containing Adenostemma lavenia ameliorates acute lung injury by activating AMPK/Nrf2/HO-1 signaling and improving the anti-oxidant response. Am. J. Chin. Med. 2019, 47, 1–24. [Google Scholar] [CrossRef]
  3. Budiarti, E.; Batubara, I.; Ilmiawati, A. The potency of Asteraceae plants extracts as antioxidant and antiglycation agent. J. Jamu Indones. 2019, 4, 109–117. [Google Scholar] [CrossRef]
  4. Hamamoto, A.; Isogai, R.; Maeda, M.; Hayazaki, M.; Horiyama, E.; Takashima, S.; Koketsu, M.; Takemori, H. The high content of Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic acid in Adenostemma lavenia (L.) O. Kuntze leaf extract: With preliminary in vivo assays. Foods 2020, 9, 73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Kuroi, A.; Sugimura, K.; Kumagai, A.; Kohara, A.; Nagaoka, Y.; Kawahara, H.; Yamahara, M.; Kawahara, N.; Takemori, H.; Fuchino, H. The importance of 11alpha-OH, 15-oxo, and 16-en moieties of 11alpha-hydroxy-15-oxo-kaur-16-en-19-oic acid in its inhibitory activity on melanogenesis. Skin Pharmacol. Physiol. 2017, 30, 205–215. [Google Scholar] [CrossRef] [Green Version]
  6. Zhang, M.; Zhao, C.; Dai, W.; He, J.; Jiao, S.; Li, B. Anti-inflammatory ent-kaurenoic acids and their glycosides from Gochnatia decora. Phytochemistry 2017, 137, 17481. [Google Scholar] [CrossRef] [PubMed]
  7. Fontana, L.; Partridge, L.; Longo, V.D. Extending healthy life span--from yeast to humans. Science 2010, 328, 321–326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Pan, Y. Mitochondria, reactive oxygen species, and chronological aging: A message from yeast. Exp. Gerontol. 2011, 46, 847–852. [Google Scholar] [CrossRef] [PubMed]
  9. Lin, S.J.; Austriaco, N. Aging and cell death in the other Yeasts, Schizosaccharomyces pombe and Candida albicans. FEMS Yeast Res. 2014, 14, 119–135. [Google Scholar] [CrossRef] [Green Version]
  10. Ding, A.J.; Zheng, S.Q.; Huang, X.B.; Xing, T.K.; Wu, G.S.; Sun, H.Y.; Qi, S.H.; Luo, H.R. Current perspective in the discovery of anti-aging agents from natural products. Nat. Prod. Bioprospect. 2017, 7, 335–340. [Google Scholar] [CrossRef] [Green Version]
  11. Prastya, M.E.; Astuti, R.I.; Batubara, I.; Takagi, H.; Wahyudi, A.T. Natural extract and its fractions isolated from the marine bacterium Pseudoalteromonas flavipulchra STILL-33 have antioxidant and anti-aging activities in Schizosaccharomyces pombe. FEMS Yeast Res. 2020, 20, 1–14. [Google Scholar] [CrossRef] [PubMed]
  12. Stephan, J.; Franke, J.; Ehrenhofer-Murray, A.E. Chemical genetic screen in fission yeast reveals roles for vacuolar acidification, mitochondrial fission, and cellular GMP levels in lifespan extension. Aging Cell 2013, 12, 574–583. [Google Scholar] [CrossRef] [PubMed]
  13. Roux, A.E.; Chartrand, P.; Ferbeyre, G.; Rokeach, L.A. Fission yeast and other yeasts as emergent models to unravel cellular aging in eukaryotes. J. Gerontol. A Biol. Sci. Med. Sci. 2010, 65, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Toone, W.M.; Kuge, S.; Samuels, M.; Morgan, B.A.; Toda, T.; Jones, N. Regulation of the fission yeast transcription factor Pap1 by oxidative stress: Requirement for the nuclear export factor Crm1 (Exportin) and the stress-activated MAP kinase Sty1/Spc1. Genes Dev. 1998, 12, 1453–1463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Bellezza, I.; Tucci, A.; Galli, F.; Grottelli, S.; Mierla, A.L.; Pilolli, F.; Minelli, A. Inhibition of NF-κB nuclear translocation via HO-1 activation underlies alpha-tocopheryl succinate toxicity. J. Nutr. Biochem. 2012, 23, 1583–1591. [Google Scholar] [CrossRef]
  16. Brigelius-Flohe, R.; Flohe, L. Basic principles and emerging concepts in the redox control of transcription factors. Antioxid. Redox Signal. 2011, 15, 2335–2381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Lee, D.F.; Kuo, H.P.; Liu, M.; Chou, C.K.; Xia, W.; Du, Y.; Shen, J.; Chen, C.T.; Huo, L.; Hsu, M.C.; et al. KEAP1 E3 ligase-mediated downregulation of NF-κB signaling by targeting IKKβ. Mol. Cell 2009, 36, 131–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Batubara, I.; Mitsunaga, T.; Ohasi, H. Screening antiacne potency of Indonesian medicinal plants: Antibacterial, lipase inhibition, and antioxidant activities. J. Wood Sci. 2009, 55, 230–235. [Google Scholar] [CrossRef]
  19. Prastya, M.E.; Astuti, R.I.; Batubara, I.; Wahyudi, A.T. Bacillus sp. SAB E-41- derived extract shows anti-aging properties via ctt1-mediated oxidative stress tolerance response in yeast Schizosaccharomyces pombe. Asian Pac. J. Trop. Biomed. 2018, 8, 533–539. [Google Scholar] [CrossRef]
  20. Batubara, I.; Zahra, U.; Darusman, K.D.; Maddu, A. Essential oils of zingiberaceae leaves as antioxidants and antiglycation. Indones. J. Essent. Oil 2016, 1, 1–9. [Google Scholar] [CrossRef] [Green Version]
  21. Khoomrung, S.; Martinez, J.L.; Tippmann, S.; Jansa-Ard, S.; Buffing, M.F.; Nicastro, R.; Nielsen, J. Expanded metabolite coverage of Saccharomyces cerevisiae extract through improved chloroform/methanol extraction and tert-butyldimethylsilyl derivatization. Anal. Chem. Res. 2015, 6, 9–16. [Google Scholar] [CrossRef] [Green Version]
  22. Lin, Y.; Kotakeyama, Y.; Li, J.; Pan, Y.; Matsuura, A.; Ohya, Y.; Yoshida, M.; Xiang, L.; Qi, J. Cucurbitacin B exerts anti-aging effects in yeast by regulating autophagy and oxidative stress. Oxid. Med. Cell. Longev. 2019, 2019, 1–15. [Google Scholar] [CrossRef]
  23. Kim, S.J.; Kim, H.G.; Kim, B.C.; Park, E.H.; Lim, C.J. Transcriptional regulation of glutathione synthetase in the fission yeast Schizosaccharomyces pombe. Mol. Cells 2004, 18, 242–248. [Google Scholar] [PubMed]
  24. Simaan, H.; Lev, S.; Horwitz, B.A. Oxidant-sensing pathways in the responses of fungal pathogens to chemical stress signals. Front. Microbiol. 2019, 10, 567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. D’Autréaux, B.; Toledano, M.B. ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell Biol. 2007, 8, 813–824. [Google Scholar] [CrossRef]
  26. Zhu, P.Y.; Yin, W.H.; Wang, M.R.; Dang, Y.Y.; Ye, X.Y. Andrographolide suppresses melanin synthesis through Akt/GSK3β/β-catenin signal pathway. J. Dermatol. Sci. 2015, 79, 74–83. [Google Scholar] [CrossRef]
  27. Mussard, E.; Cesaro, A.; Lespessailles, E.; Legrain, B.; Berteina-Raboin, S.; Toumi, H. Andrographolide, a Natural Antioxidant: An Update. Antioxidants 2019, 8, 571. [Google Scholar] [CrossRef] [Green Version]
  28. Prasad, A.G.D.; Shyma, T.B.; Raghavendra, M.P. Plants used by the tribes for the treatment of digestive system disorders in Wayanad district, Kerala. J. Appl. Pharm. Sci. 2013, 3, 171–175. [Google Scholar] [CrossRef]
  29. Bakar, F.; Acikara, O.B.; Ergene, B.; Nebioglu, S.; Citoglu, G.S. Antioxidant activity and phytochemical screening of some Asteraceae plants. Turk. J. Pharm. Sci. 2015, 12, 123–132. [Google Scholar] [CrossRef]
  30. Mahomoodally, F.; Subratty, A.H.; Gurib-Fakim, A.; Choudhary, M.I. Antioxidant, antiglycation and cytotoxicity evaluation of selected medicinal plants of the Mascarene Islands. BMC Complement Altern. Med. 2012, 12, 165. [Google Scholar] [CrossRef] [Green Version]
  31. Zimmermann, A.; Hofer, S.; Pendl, T.; Kainz, K.; Madeo, F.; Carmona-Gutierrez, D. Yeast as a tool to identify anti-aging compounds. FEMS Yeast Res. 2018, 18, 1–16. [Google Scholar] [CrossRef] [PubMed]
  32. Hibi, T.; Ohtsuka, H.; Shimasaki, T.; Inui, S.; Shibuya, M.; Tatsukawa, H.; Kanie, K.; Yamamoto, Y.; Aiba, H. Tschimganine and its derivatives extend the chronological life span of yeast via activation of the Sty1 pathway. Genes Cells 2018, 23, 620–637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Schrepfer, E.; Scorrano, L. Mitofusins, from mitochondria to metabolism. Mol. Cell 2016, 61, 683–694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Shadel, G.S.; Horvath, T.L. Mitochondrial ROS signaling in organismal homeostasis. Cell 2015, 163, 560–569. [Google Scholar] [CrossRef] [Green Version]
  35. Prastya, M.E.; Astuti, R.I.; Batubara, I.; Takagi, H.; Wahyudi, A.T. Chemical screening identifies an extract from marine Pseudomonas sp.-PTR-08 as an anti-aging agent that promotes fission yeast longevity by modulating the pap1–ctt1+ pathway and the cell cycle. Mol. Biol. Rep. 2020, 47, 33–43. [Google Scholar] [CrossRef] [PubMed]
  36. Takagi, H. Proline as a stress protectant in yeast: Physiological functions, metabolic regulations, and biotechnological applications. Appl. Microbiol. Biotechnol. 2008, 81, 211–223. [Google Scholar] [CrossRef]
  37. Mukai, Y.; Kamei, Y.; Liu, X.; Jiang, S.; Sugimoto, Y. Proline metabolism regulates replicative lifespan in the yeast Saccharomyces cerevisiae. Microb. Cell 2019, 6, 482–490. [Google Scholar] [CrossRef]
  38. Sasano, Y.; Haitani, Y.; Ohtsu, I.; Shima, J.; Takagi, H. Proline accumulation in baker’s yeast enhances high-sucrose stress tolerance and fermentation ability in sweet dough. Int. J. Food Microbiol. 2012, 152, 40–43. [Google Scholar] [CrossRef]
  39. Astuti, R.I.; Watanabe, D.; Takagi, H. Nitric oxide signalling and its role in oxidative stress response in Schizosaccharomyces pombe. Nitric Oxide 2016, 52, 29–40. [Google Scholar] [CrossRef]
  40. Lyu, J.H.; Lee, G.S.; Kim, K.H.; Kim, H.W.; Cho, S.I.; Jeong, S.I.; Kim, H.J.; Ju, Y.S.; Kim, H.K.; Sadikot, R.T.; et al. ent-kaur-16-en-19-oic Acid, isolated from the roots of Aralia continentalis, induces activation of Nrf2. J. Ethnopharmacol. 2011, 137, 1442–1444. [Google Scholar] [CrossRef] [Green Version]
  41. Zou, H.; Chen, N.; Shi, M.; Xian, M.; Song, Y.; Liu, J. The metabolism and biotechnological application of betaine in microorganism. Appl. Microbiol. Biotechnol. 2016, 100, 3865–3876. [Google Scholar] [CrossRef]
  42. Thomas, K.C.; Hynes, S.H.; Ingledew, W.M. Effects of particulate materials and osmoprotectants on very-high-gravity ethanolic fermentation by Saccharomyces cerevisiae. Appl. Environ. Microbiol. 1994, 60, 1519–1524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Sui, Y.; Liu, J.; Wisniewski, M.; Droby, S.; Norelli, J.; Hershkovitz, V. Pretreatment of the yeast antagonist, Candida oleophila, with glycine betaine increases oxidative stress tolerance in the microenvironment of apple wounds. Int. J. Food. Microbiol. 2012, 157, 45–51. [Google Scholar] [CrossRef] [PubMed]
  44. Alirezaei, M.; Khoshdel, Z.; Dezfoulian, O.; Rashdipour, M.; Taghadosi, V. Beneficial antioxidant properties of betaine against oxidative stress mediated by levodopa/benserazide in the brain of rats. J. Physiol. Sci. 2015, 65, 243–252. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, M.; Zhang, H.; Li, H.; Lai, F.; Li, X.; Tang, Y.; Min, T. Antioxidant mechanism of betaine without free radical scavenging ability. J. Agric. Food Chem. 2016, 64, 7921–7930. [Google Scholar] [CrossRef] [PubMed]
  46. Horowitz, R.I.; Freeman, P.R. Three novel prevention, diagnostic, and treatment options for COVID-19 urgently necessitating controlled randomized trials. Med. Hypotheses 2020, 143, 109851. [Google Scholar] [CrossRef] [PubMed]
  47. McCord, J.M.; Hybertson, B.M.; Cota-Gomez, A.; Geraci, K.P.; Gao, B. Nrf2 Activator PB125 ® as a Potential Therapeutic Agent against COVID-19. Antioxidants 2020, 9, 518. [Google Scholar] [CrossRef]
  48. Cuadrado., A.; Pajares, M.; Benito, C.; Jiménez-Villegas, J.; Escoll, M.; Fernández-Ginés, R.; Yagüe, A.J.G.; Lastra, D.; Manda, G.; Rojo, A.I.; et al. Can Activation of NRF2 Be a Strategy against COVID-19? Trends Pharmacol. Sci. 2020, in press. [Google Scholar] [CrossRef]
Antioxidants 09 00719 g001 550
Figure 1. The structure of ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic acid (11αOH-KA).
Figure 1. The structure of ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic acid (11αOH-KA).
Antioxidants 09 00719 g001
Antioxidants 09 00719 g002 550
Figure 2. Antioxidative activity of A. lavenia extracts. (A) S. pombe was preincubated in the YES liquid medium with or without (−) DMSO for seven or 11 days and then streaked on agar plates containing 5 mM H2O2. (B) The effects of A. lavenia fractions on the oxidative stress resistance in the yeast cells were examined by the streaking method. A. lavenia Awf (a, 252; b, 504; c, 756; d, 1008; e, 1260 µg mL−1) or Acf (a, 222; b, 444; c, 666; d, 888; e, 1110 µg mL−1) were mixed in the YES liquid medium. At day 7 or 11, the yeast cells were streaked on plates supplemented with 5 mM H2O2. (C) The yeast cells that had been preincubated as in (B) were diluted and spotted on agar plates. (D) The number of CFU (colony-forming units) was obtained after 11 days of incubation of (C). Error bars represented S.D. from experiments performed in triplicate (n = 5, * p < 0.05, ** p < 0.01).
Figure 2. Antioxidative activity of A. lavenia extracts. (A) S. pombe was preincubated in the YES liquid medium with or without (−) DMSO for seven or 11 days and then streaked on agar plates containing 5 mM H2O2. (B) The effects of A. lavenia fractions on the oxidative stress resistance in the yeast cells were examined by the streaking method. A. lavenia Awf (a, 252; b, 504; c, 756; d, 1008; e, 1260 µg mL−1) or Acf (a, 222; b, 444; c, 666; d, 888; e, 1110 µg mL−1) were mixed in the YES liquid medium. At day 7 or 11, the yeast cells were streaked on plates supplemented with 5 mM H2O2. (C) The yeast cells that had been preincubated as in (B) were diluted and spotted on agar plates. (D) The number of CFU (colony-forming units) was obtained after 11 days of incubation of (C). Error bars represented S.D. from experiments performed in triplicate (n = 5, * p < 0.05, ** p < 0.01).
Antioxidants 09 00719 g002
Antioxidants 09 00719 g003 550
Figure 3. 11αOH-KA promotes longevity in yeast. (A) Spot assay of S. pombe with various concentrations of 11αOH-KA. (B) Colony-forming units (CFU) were measured after the incubation of the yeast with 11αOH-KA. Data are normalized by the values of DMSO control at day 1 (stationary phase). The y-axis is shown in logarithmic scale. Yeasts were cultured in YES liquid medium containing either 0.5% glucose with DMSO (red) or 3% glucose with DMSO (black), 11αOH-KA (45 µg mL−1: blue), or 11αOH-KA (7.5 µg mL−1: green) n = 3. (C) The yeast cells were preincubated in YES liquid medium containing DMSO or 11αOH-KA treatment (45 µg mL−1) with glucose (0.5% or 3%). Mild oxidative stress was induced by the addition of H2O2 (1 mM or 3 mM).
Figure 3. 11αOH-KA promotes longevity in yeast. (A) Spot assay of S. pombe with various concentrations of 11αOH-KA. (B) Colony-forming units (CFU) were measured after the incubation of the yeast with 11αOH-KA. Data are normalized by the values of DMSO control at day 1 (stationary phase). The y-axis is shown in logarithmic scale. Yeasts were cultured in YES liquid medium containing either 0.5% glucose with DMSO (red) or 3% glucose with DMSO (black), 11αOH-KA (45 µg mL−1: blue), or 11αOH-KA (7.5 µg mL−1: green) n = 3. (C) The yeast cells were preincubated in YES liquid medium containing DMSO or 11αOH-KA treatment (45 µg mL−1) with glucose (0.5% or 3%). Mild oxidative stress was induced by the addition of H2O2 (1 mM or 3 mM).
Antioxidants 09 00719 g003
Antioxidants 09 00719 g004 550
Figure 4. Effect of A. lavenia fractions and 11αOH-KA on mitochondria activity. (A) S. pombe was incubated under CR conditions (0.5% glucose), and mitochondria with a high membrane potential were stained with rhodamine B (Rho B: red fluorescence signals). (B) The yeast cells were treated with fractions of A. lavenia water (Awf) or chloroform (Acf) or 11αOH-KA and stained with Rho B. DIC: Differential interference contrast. Bars represent 5 µm.
Figure 4. Effect of A. lavenia fractions and 11αOH-KA on mitochondria activity. (A) S. pombe was incubated under CR conditions (0.5% glucose), and mitochondria with a high membrane potential were stained with rhodamine B (Rho B: red fluorescence signals). (B) The yeast cells were treated with fractions of A. lavenia water (Awf) or chloroform (Acf) or 11αOH-KA and stained with Rho B. DIC: Differential interference contrast. Bars represent 5 µm.
Antioxidants 09 00719 g004
Antioxidants 09 00719 g005 550
Figure 5. A. lavenia fractions and 11αOH-KA induced yeast antioxidative stress pathways. The yeast cells were cultured in YES liquid (3% glucose) supplemented with A. lavenia water (Awf: 1260 µg mL−1), chloroform Acf: (888 µg mL−1) fractions, and 11αOH-KA (45 µg mL−1) for 18 h. The expression levels of the pap1+ (A) and ctt1+ (B) genes were measured by quantitative PCR analysis. Values were normalized with those in the DMSO group. Means and S.D. are shown. (n = 3) *: p < 0.05, **: p < 0.01.
Figure 5. A. lavenia fractions and 11αOH-KA induced yeast antioxidative stress pathways. The yeast cells were cultured in YES liquid (3% glucose) supplemented with A. lavenia water (Awf: 1260 µg mL−1), chloroform Acf: (888 µg mL−1) fractions, and 11αOH-KA (45 µg mL−1) for 18 h. The expression levels of the pap1+ (A) and ctt1+ (B) genes were measured by quantitative PCR analysis. Values were normalized with those in the DMSO group. Means and S.D. are shown. (n = 3) *: p < 0.05, **: p < 0.01.
Antioxidants 09 00719 g005
Antioxidants 09 00719 g006 550
Figure 6. 11αOH-KA upregulates Nrf2 pathways. B16F10 cells were treated with the indicated concentrations of 11αOH-KA or andrographolide (AG) for 24 h. The cells were recovered into sample tubes, and melanin contents were evaluated by photos (A) and optical density after lysis with NaOH (B). (C) B16F10 cells that had been transformed with the Nrf2 reporter (OKD48-luc) were treated with 11αOH-KA or AG for 24 h. Means and S.D. are shown (n = 3). *: p < 0.05. (D) The cells were lysed with SDS sample buffer without the reducing agent mercaptoethanol and used for Western blot analyses. (E) Awf (400 or 1200 µg mL−1) and Acf (300 or 900 µg mL−1) were used as stimulants. (F) B16F10 cells that had been precultured with or without 10 µM of 11αOH-KA for 24 h were treated with H2O2 for a further 24 h. Cell variability was examined by the Cell Counting kit (WST-8). (n = 4) ** p < 0.01. (G) The same experiments were performed with 11αOH-KA (10 µM), Awf (1260 µg mL−1), and Acf: (888 µg mL−1) in the presence of 200 μM H2O2. Gray and black bars indicate without H2O2 treatment and with only H2O2 treatment, respectively.
Figure 6. 11αOH-KA upregulates Nrf2 pathways. B16F10 cells were treated with the indicated concentrations of 11αOH-KA or andrographolide (AG) for 24 h. The cells were recovered into sample tubes, and melanin contents were evaluated by photos (A) and optical density after lysis with NaOH (B). (C) B16F10 cells that had been transformed with the Nrf2 reporter (OKD48-luc) were treated with 11αOH-KA or AG for 24 h. Means and S.D. are shown (n = 3). *: p < 0.05. (D) The cells were lysed with SDS sample buffer without the reducing agent mercaptoethanol and used for Western blot analyses. (E) Awf (400 or 1200 µg mL−1) and Acf (300 or 900 µg mL−1) were used as stimulants. (F) B16F10 cells that had been precultured with or without 10 µM of 11αOH-KA for 24 h were treated with H2O2 for a further 24 h. Cell variability was examined by the Cell Counting kit (WST-8). (n = 4) ** p < 0.01. (G) The same experiments were performed with 11αOH-KA (10 µM), Awf (1260 µg mL−1), and Acf: (888 µg mL−1) in the presence of 200 μM H2O2. Gray and black bars indicate without H2O2 treatment and with only H2O2 treatment, respectively.
Antioxidants 09 00719 g006
Table
Table 1. In vitro antioxidant and antiglycation activities of A. lavenia fractions.
Table 1. In vitro antioxidant and antiglycation activities of A. lavenia fractions.
SamplesFractionsAntioxidant ActivitiesAntiglycation Activity (% Inhibition of 1000 µg mL−1 Sample)
DPPH IC50 (µg mL−1)ABTS (mg Trolox/g Sample)
A. laveniaH2O (Awf)252.02 ± 3.23 *3.63 ± 0.418.87 ± 2.28 *
CHCl3 (Acf)222.37 ± 1.16 *3.24 ± 0.3933.44 ± 4.87 *
Ascorbic acid 4.06 ± 0.03--
Aminoguanidine --73.00 ± 3.26
IC50 indicates the ability of fractions to scavenge DPPH free radicals. The values are means and standard deviations. A. lavenia water fraction (Awf) and chloroform fraction (Acf) contain 11αOH-KA at 15.1% and 56.6% (w/w), respectively. Statistically significant differences in the same column were determined by one-way ANOVA followed by Duncan’s multiple range test (*: significantly different from positive controls, p < 0.05). -: not detectable.
Table
Table 2. Analyses intracellular yeast metabolites following 11αOH-KA (45 µg mL−1) treatment, as analyzed by the LC/MS approach.
Table 2. Analyses intracellular yeast metabolites following 11αOH-KA (45 µg mL−1) treatment, as analyzed by the LC/MS approach.
MetabolitesAbundance (%)
DMSO11αOH-KA
l-Methionine0.10 ± 0.010.07 ± 0.01 *
l-Proline1.35 ± 0.040.04 ± 0.01 *
Leucine0.50 ± 0.030.53 ± 0.02
l-Phenylalanine0.11 ± 0.020.35 ± 0.06 *
l-Serine0.17 ± 0.010.27 ± 0.01 *
l-Tyrosine0.13 ± 0.010.20 ± 0.01 *
Betaine0.66 ± 0.204.96 ± 0.32 *
l-Arginine0.18 ± 0.010.08 ± 0.01 *
l-Glutamic acid0.21 ± 0.020.32 ± 0.02 *
1-Methylguanosine0.55 ± 0.010.32 ± 0.03 *
l-Lactic acid0.22 ± 0.010.08 ± 0.01 *
d-Glucose0.08 ± 0.010.65 ± 0.03 *
Choline0.07 ± 0.010.13 ± 0.01 *
Biotin4.07 ± 0.224.33 ± 0.62
Nicotinamide0.17 ± 0.010.09 ± 0.01 *
Statistical analyses were performed by one-way ANOVA followed by multiple Duncan range test analysis (n = 3). (*: significantly different from DMSO control treatment p < 0.05).

Share and Cite

MDPI and ACS Style

Batubara, I.; Astuti, R.I.; Prastya, M.E.; Ilmiawati, A.; Maeda, M.; Suzuki, M.; Hamamoto, A.; Takemori, H. The Antiaging Effect of Active Fractions and Ent-11α-Hydroxy-15-Oxo-Kaur-16-En-19-Oic Acid Isolated from Adenostemma lavenia (L.) O. Kuntze at the Cellular Level. Antioxidants 2020, 9, 719. https://doi.org/10.3390/antiox9080719

AMA Style

Batubara I, Astuti RI, Prastya ME, Ilmiawati A, Maeda M, Suzuki M, Hamamoto A, Takemori H. The Antiaging Effect of Active Fractions and Ent-11α-Hydroxy-15-Oxo-Kaur-16-En-19-Oic Acid Isolated from Adenostemma lavenia (L.) O. Kuntze at the Cellular Level. Antioxidants. 2020; 9(8):719. https://doi.org/10.3390/antiox9080719

Chicago/Turabian Style

Batubara, Irmanida, Rika Indri Astuti, Muhammad Eka Prastya, Auliya Ilmiawati, Miwa Maeda, Mayu Suzuki, Akie Hamamoto, and Hiroshi Takemori. 2020. "The Antiaging Effect of Active Fractions and Ent-11α-Hydroxy-15-Oxo-Kaur-16-En-19-Oic Acid Isolated from Adenostemma lavenia (L.) O. Kuntze at the Cellular Level" Antioxidants 9, no. 8: 719. https://doi.org/10.3390/antiox9080719

APA Style

Batubara, I., Astuti, R. I., Prastya, M. E., Ilmiawati, A., Maeda, M., Suzuki, M., Hamamoto, A., & Takemori, H. (2020). The Antiaging Effect of Active Fractions and Ent-11α-Hydroxy-15-Oxo-Kaur-16-En-19-Oic Acid Isolated from Adenostemma lavenia (L.) O. Kuntze at the Cellular Level. Antioxidants, 9(8), 719. https://doi.org/10.3390/antiox9080719

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop