Next Article in Journal
Population Genetic Characteristics of Siberian Roe Deer in the Cold Temperate Forest Ecosystem of the Greater Khingan Mountains, Northeast China
Next Article in Special Issue
Physiological Stress Response and Oxidative Status in Tambaqui (Colossoma macropomum) Fed Diets Supplemented with Selenium
Previous Article in Journal
Hypothalamic Regulation of Cardiorespiratory Functions: Insights into the Dorsomedial and Perifornical Pathways
Previous Article in Special Issue
Effect of Dietary Digestible Protein Levels on Muscle Growth and Oxidative Stress in Amazonian Pintado (Pseudoplatystoma reticulatum × Leiarius marmoratus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 13
Issue 11
10.3390/biology13110934
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism

by
Zhoulin Yu
1,
Yucong Hong
2,
Shuyan Zhao
2,
Meng Zhou
1,* and
Xiaohong Tan
1,*
1
Innovative Institute of Animal Healthy Breeding, College of Animal Sciences and Technology, Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China
2
Guangdong Provincial Key Laboratory of Aquatic Larvae Feed, Guangdong Yuequn Biotechnology Co., Ltd., Jieyang 515500, China
*
Authors to whom correspondence should be addressed.
Biology 2024, 13(11), 934; https://doi.org/10.3390/biology13110934
Submission received: 31 October 2024 / Accepted: 8 November 2024 / Published: 16 November 2024
(This article belongs to the Special Issue Aquatic Animal Nutrition and Feed)
Browse Figures
Versions Notes

Simple Summary

Vibrio alginolyticus is a Gram-negative bacterium that can infect aquatic animals such as fish, shrimp and shellfish, causing huge economic losses to aquaculture households and posing a potential threat to human health. The purpose of this study was to explore the antibacterial effect and mechanism of fermented pomegranate peel polyphenols as a new environmentally friendly antibacterial agent on V. alginolyticus. The results showed that fermented pomegranate peel polyphenols could exert antibacterial activity by inducing oxidative stress in V. alginolyticus, destroying the integrity of cell membrane and cell wall and inhibiting motility, biofilm formation and metabolic activity. This research will provide an important foundation for the application of fermented pomegranate peel polyphenols as a new and efficient antibacterial agent to control the infection of V. alginolyticus in live shrimp and other seafood.

Abstract

Vibrio alginolyticus frequently breaks out in aquatic animal breeding operations involving shrimp, and it can endanger human health through food and wound infections. The antibacterial effect and mechanism of fermented pomegranate peel polyphenols (FPPPs) on V. alginolyticus were investigated. The results indicated that FPPPs had a strong inhibitory effect on the growth of V. alginolyticus, and their minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were 2 and 4 mg/mL. FPPPs significantly reduced biofilm formation and biofilm metabolic activity in V. alginolyticus, down-regulated the expression levels of lafA, lafK, fliS and flaK genes involved in flagellar synthesis and inhibited swimming and swarming motility (p < 0.05). Meanwhile, under the treatment of FPPPs, the activities of catalase (CAT) and superoxide dismutase (SOD) in V. alginolyticus were significantly reduced, and the levels of reactive oxygen species (ROS) and extracellular malondialdehyde (MDA) were significantly increased (p < 0.05). FPPPs also resulted in a significant increase in alkaline phosphatase (AKP) activity, protein and nucleic acid content, as well as conductivity from V. alginolyticus cultures. Scanning electron microscopy (SEM) images further revealed that V. alginolyticus treated with FPPPs showed leakage of intracellular substances, abnormal cell morphology and damage to cell walls and cell membranes, with the severity of the damage in a clear dose-dependent manner. Therefore, FPPPs can be used as a promising food-grade antibacterial agent, notably in seafood to control V. alginolyticus.

1. Introduction

Vibrio is a genus of Gram-negative bacteria widely found in reservoirs, rivers, seas and other aquatic environments [1]. Most of these vibrios are non-pathogenic, and only a small percentage cause infectious diseases in aquatic animals or humans [2]. However, the outbreak and epidemic of vibriosis caused by this part of Vibrio not only cause harm to aquatic animals but also seriously affect human health [3,4]. Vibrio alginolyticus is a halophilic marine Vibrio in the genus Vibrio, and its number is among the highest in seawater vibrio [5]. V. alginolyticus, as a common opportunistic pathogen affecting and contaminating aquaculture aquatic products, is capable of causing massive mortality in marine fish, shrimp and shellfish [6,7,8]. In addition, humans can cause superficial wounds and eye and ear infections after contact with water contaminated with V. alginolyticus [9,10]. Meanwhile, human consumption of undercooked aquatic food carrying V. alginolyticus can even lead to diarrhea, gastroenteritis and septicemia [11,12,13]. Therefore, V. alginolyticus is a harmful bacterium that causes huge economic losses to aquaculture households and poses a potential threat to human health.
Antibiotics can effectively prevent and control Vibrio, but long-term use will destroy the water environment and make pathogenic bacteria evolve drug resistance, and drug residues even endanger human health [14,15]. Hence, the development of environmentally friendly and safe new antibacterial agents has become an extremely urgent problem to be tackled in the field of aquaculture and the food industry. In recent years, medicinal plants and their extracts have received widespread attention for their favorable antimicrobial effects, such as cinnamaldehyde [16], shogaol [17], blueberry extract [18] and Fructus Schisandrae Chinensis extract [19]. Additionally, previous studies have shown that medicinal plants are rich in an assortment of active ingredients and nutrients [20,21,22]. They have the advantages of being natural, effective, inexpensive, non-toxic (or low toxicity) and less harmful to aquatic animals and the water environment, and it is not easy to generate drug resistance [23,24]. Therefore, it is reasonable and valuable to use them as antibacterial agents.
Pomegranate (Punica granatum L.) is a fruit with high nutritional value, primarily distributed in subtropical and temperate regions [25]. In China, pomegranate has a long history of cultivation and rich planting resources and is a kind of plant which is available for medicine and food [26]. Pomegranate peel accounts for more than 40% the of pomegranate fruit and is typically discarded as a by-product of processing [27]. Nevertheless, pomegranate peel contains a variety of bioactive substances, among which polyphenols are the main phytochemicals [28,29]. Numerous studies have proved that pomegranate peel polyphenols (PPPs) can be used for lowering blood lipids and for anti-oxidation, anti-tumor, anti-inflammatory and antibacterial purposes [30,31,32,33]. These health benefits are attributed to the presence of polyphenol compounds such as punicalagin, ellagitannins, gallotannins and anthocyanins in PPPs [34,35]. Natural plant-derived foods are rich in polyphenols, but their bioavailability is low [36]. In the process of fermentation, beneficial microorganisms can secrete tannase, esterase, phenolic decarboxylase, glycosidase and other substances. At the same time, tannic acid, proanthocyanidins, gallic acid esters and other macromolecular-bound phenols were metabolized into quercetin, kaempferol, gallic acid and other free phenols to improve the biological activity and bioavailability of polyphenols [37]. The PPPs in this study were extracted by a factory process. Briefly, pomegranate peel is cleaned and crushed before fermentation, then extracted and concentrated with ethanol, and finally dried to obtain PPPs. Among them, fermentation has a similar effect with enzymatic hydrolysis, which can improve the efficiency of extracting polyphenols by destroying the cell wall of plants and promoting the release of bioactive components in pomegranate peel. Moreover, in our previous study, it was found that dietary supplementation with fermented pomegranate peel polyphenols (FPPPs) in feed can improve the survival rate of Pacific white shrimp (Litopenaeus vannamei) after infection with V. alginolyticus without negatively affecting their growth performance (unpublished article). This result is not only related to the fact that FPPPs can improve the antioxidant capacity and immunity of Litopenaeus vannamei, but it also may be related to the bacteriostatic effect of FPPPs on V. alginolyticus.
However, it is not known whether FPPPs have an antibacterial effect on V. alginolyticus, and there are few studies on the effect of PPPs on marine bacteria. Therefore, this experiment studied the antibacterial effect of FPPPs on V. alginolyticus and explored its possible antibacterial mechanism by measuring the growth curve, oxidative stress indexes, extracellular leakage content and bacterial morphology of V. alginolyticus treated with FPPPs. Furthermore, the effects of FPPPs on the biofilm formation, biofilm metabolic activity and motility of V. alginolyticus were also assessed. The results will provide a crucial foundation for the control of V. alginolyticus by FPPPs as a new environmentally friendly antibacterial agent in aquaculture and the food industry.

2. Materials and Methods

2.1. Bacterial Samples and Culture Conditions

Vibrio alginolyticus strain ZK2406 (GenBank accession number PP905135) was isolated and preserved from diseased Litopenaeus vannamei in a shrimp farm in Jiangmen City, Guangdong Province, China, by the Innovative Institute of Animal Healthy breeding, Zhongkai University of Agriculture and Engineering. Unless otherwise stated, V. alginolyticus was cultured in lysogeny broth (LB, Hope Bio-Technology Co., Ltd., Qingdao, China) liquid medium or LB solid agar plates containing 3% NaCl (w/v) at 30 °C throughout the study.

2.2. Reagents

The fermented pomegranate peel polyphenols (HPLC ≥ 60%) used in this study were purchased from Shaanxi Ciyuan Biotechnology Co., Ltd. (Xi’an, China). The main components of FPPPs were α-punicalagin (268.42 mg/g), β-punicalagin (274.27 mg/g), ellagic acid (18.78 mg/g), epicatechin (8.78 mg/g), catechin (3.31 mg/g) and gallic acid (1.34 mg/g). FPPPs was dissolved in dimethyl sulfoxide (DMSO, Sigma, St. Louis, MO, USA) and vortexed for 30 s at room temperature and then diluted with LB liquid medium to prepare an FPPPs stock solution with a concentration of 32 mg/mL that was stored at 4 °C. The final concentration of DMSO in the FPPPs stock solution was 0.1% (v/v), which had no apparent effect on the growth of V. alginolyticus. The FPPPs stock solution was diluted with LB liquid medium and the double dilution method to the appropriate concentration specified in each experiment. In addition, different concentrations of FPPPs used in this experiment had no significant effect on the pH of LB medium.

2.3. Determination of MIC and MBC

Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) of FPPPs against V. alginolyticus were detected using the standard broth microdilution method as partially modified by Yadav et al. and García-Herridia et al. [38,39]. The activated V. alginolyticus in LB liquid medium was diluted with phosphate-buffered saline (PBS) to a cell concentration of about 106 CFU/mL. The 106 CFU/mL bacterial solution was obtained by establishing the standard curve of bacterial colony-forming units-optical density at 600 absorbance value and diluting the bacterial liquid. Serial dilutions of the 32 mg/mL stock solution of FPPPs were carried out using LB liquid medium to obtain samples containing FPPPs at 4, 2, 1, 0.5, 0.25 and 0 mg/mL, respectively. In a sterile 96-well microtiter plate, 180 μL of LB liquid medium containing different concentrations of FPPPs was first added, and then 20 μL of V. alginolyticus solution with a concentration of 106 CFU/mL was added. After incubation at 30 °C for 24 h, the optical density (OD) was measured at 600 nm using a Varioskan Lux Multimode microplate reader (Thermo Fisher Scientific, Dartford, UK). The lowest FPPPs concentration resulting in a lack of visible V. alginolyticus growth was considered the MIC. Liquid in the wells with a drug concentration greater than or equal to the minimum bacteriostatic concentration was selected to spread the plates, and the lowest drug concentration with less than 5 colonies on the plate was defined as the MBC.

2.4. Determination of Growth Curve

The growth curve was plotted to detect the killing kinetics of FPPPs against V. alginolyticus using the method of Liu et al. [40]. Briefly, V. alginolyticus suspensions (106 CFU/mL) were inoculated at 1% volume into LB broth medium containing FPPPs at concentrations of 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC, respectively. All samples were incubated at 30 °C for 200 rpm, and the cell density was continuously monitored at OD 600 nm for 24 h and the growth curve was drawn.

2.5. Determination of Biofilm Formation Ability

According to the method described by Qian et al. with modifications, the inhibitory effect of FPPPs on the biofilm formation ability of V. alginolyticus was determined by crystal violet staining [41]. The V. alginolyticus solution was diluted to the same OD600 value and 20 μL was pipetted onto a 96-well plate. Then, 180 μL LB broth medium containing FPPPs 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC concentrations was added to the bacterial suspension and mixed evenly. After 48 h of static culture at 30 °C, the medium was discarded, washed with PBS and then incubated with 200 μL 1% crystal violet solution at room temperature for 20 min. After staining, the dye was aspirated and each well was rinsed 3 times with PBS and allowed to dry naturally. Finally, 200 μL of 33% glacial acetic acid was added to dissolve the biofilm, and OD was measured at the wavelength of 570 nm.

2.6. Determination of Biofilm Metabolic Activity

Determining the metabolic capacity of biofilms by measuring the metabolic activity of the cells in the biofilm has been a reasonable and widely research method [42]. The effect of FPPPs on the biofilm metabolic activity of V. alginolyticus was detected by a Cell Counting Kit-8 (CCK-8) assay [43]. The suspension of V. alginolyticus was inoculated into 96-well plate (200 μL/well) containing LB broth medium and incubated at 30 °C for 24 h; then the medium was discarded and the free bacteria were washed away with PBS. Then, 200 μL LB medium containing different concentrations of FPPPs was added. After 24 h of incubation at 30 °C, the medium was discarded and washed with PBS. Lastly, 180 μL PBS and 20 μL CCK-8 were added to each well, and OD was measured at 600 nm after incubation at 30 °C for 4 h protected from light.

2.7. Determination of Cell Wall Integrity

Alkaline phosphatase (AKP) usually exists in the periplasm, and the effect of FPPPs on the cell wall integrity of V. alginolyticus was evaluated by measuring the activity of extracellular AKP [44]. Bacterial suspensions (OD600 = 1.0) were added to LB broth medium containing FPPPs at concentrations of 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC and then incubated at 30 °C for 8 h. In the end, 1 mL culture solution was centrifuged at 3500× g for 10 min, and the activity of AKP in the supernatant was detected by a commercial detection kit of Nanjing Jiancheng Bioengineering Insitute (Nanjing, China).

2.8. Determination of CAT, SOD and ROS

The intracellular catalase (CAT) and superoxide dismutase (SOD) activities and reactive oxygen species (ROS) levels of V. alginolyticus after treatment with different concentrations of FPPPs were determined according to the methods of Shivaprasad et al. and Li et al. [45,46]. The bacterial solution obtained after treatment with different concentrations of FPPPs for 8 h was centrifuged at 3500× g for 10 min. Bacterial precipitates were collected, washed and resuspended with PBS; then, bacteria were lysed with a SCIENTZ-IID ultrasonic cell crusher (SCIENTZ, Ningbo, China), and cellular debris was removed by centrifugation. The activity of CAT and SOD in the supernatant was determined by a CAT assay kit and SOD assay kit of Nanjing Jiancheng Bioengineering Insitute (Nanjing, China), respectively. Intracellular ROS levels were measured by Dichlorodihydrofluorescein diacetate (DCFH-DA) (Nanjing Jiancheng Bioengineering Insitute, Nanjing, China). The bacterial precipitates after FPPPs treatment were collected and washed with PBS and incubated in PBS containing DCFH-DA (10 μM) for 40 min. Eventually, 200 μL of the mixed solution was pipetted onto a 96-well plate and the fluorescence intensity was measured (excitation 488 nm, emission 525 nm).

2.9. Determination of MDA Content

Bacterial suspensions (OD600 = 1.0) were added to LB broth medium containing FPPPs at concentrations of 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC, and then incubated at 30 °C for 8 h. In the end, 1 mL culture solution was centrifuged at 3500× g for 10 min, and the content of malondialdehyde (MDA) in the supernatant was determined by a commercial detection kit of Nanjing Jiancheng Bioengineering Insitute (Nanjing, China).

2.10. Determination of Nucleic Acid and Protein Leakage

The nucleic acid and protein of the biological macromolecules contained in the bacterial cell content have strong absorption of light at 260 and 280 nm, respectively [47]. Therefore, the content of extracellular nucleic acid and protein of V. alginolyticus can be estimated by measuring the absorbance at 260 and 280 nm. According to the steps described by Liu et al., the colorimetric method was used to determine the content of nucleic acid and protein released from V. alginolyticus under FPPPs treatment [48]. The V. alginolyticus suspension (OD600 = 1.0) was treated with FPPPs at 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC for 8 h at 30 °C. After centrifugation at 3500× g for 10 min, the supernatant was obtained, and the content of extracellular nucleic acid and protein was determined at 260 nm and 280 nm. In addition, the total protein assay kit (Bicinchoninic Acid, BCA method) of Nanjing Jiancheng Bioengineering Insitute (Nanjing, China) was used to quantitatively determine the released protein content according to the instructions.

2.11. Determination of Conductivity

Studies have confirmed that when the cell membrane is injured, the electrolyte in the cell will flow out, resulting in changes in the conductivity of the extracellular culture medium. Conductivity was determined with reference to Lee et al [49]. Different concentrations of FPPPs were applied to the V. alginolyticus suspension (OD600 = 1.0) grown overnight in LB medium. After incubation at 30 °C for 8 h, the supernatant was obtained by centrifugation at 3500× g for 10 min. The conductivity of the supernatant was measured using a DDS-307A conductivity meter (INESA, Shanghai, China).

2.12. Motility

Swimming and swarming abilities play a crucial role for Vibrio in infecting host cells, and a loss of motility may affect bacterial adhesion and impair biofilm formation [50,51]. The effect of FPPPs on the swimming and swarming ability of V. alginolyticus was determined on solid LB plates containing 0.3% and 1.5% agar [52]. Different concentrations of FPPPs were added during the preparation of two solid media, so that the final concentrations of FPPPs were 0, 1/8MIC, 1/4MIC, 1/2MIC and MIC, respectively. Then, 5 μL of V. alginolyticus suspension (OD600 = 1.0) was aspirated in the center of the plate and incubated at 30 °C for 24 h. Subsequent photographs were taken using a gel imaging system and the diameters of the swimming circle and swarming circle were detected.

2.13. RNA Extraction and Gene Expression Analysis

V. alginolyticus was treated with different concentrations of FPPPs, and the bacteria were collected after 8 h of culture at 30 °C. The total RNA of V. alginolyticus was extracted using a Bacterial Total RNA Extraction Kit (Tiangen, Beijing, China). Then, the purity and concentration of each RNA were detected by a NanoDrop One microvolume-uv-spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the integrity of total RNA was detected by 1% agarose gel electrophoresis. Finally, the total RNA (1000 ng) extracted in the previous step was reverse transcribed using an Evo M-MLV Mix Kit with DNA Clean for gPCR from Accurate Biotechnology (Hunan) Co., Ltd. (Changsha, China). The complementary DNA (cDNA) template of the product obtained by reverse transcription was stored in a refrigerator at −20 °C for subsequent fluorescence quantitative PCR (qPCR).
The primers were designed according to published articles and are listed in Table 1 [53]. Real-time quantitative PCR was performed using CFX Connect Real-Time PCR Detection Systems (Bio-Rad Laboratories, Hercules, CA, USA) with a Taq Pro Universal SYBR qPCR Master Mix Kit (Vazyme Biotech Co., Ltd., Nanjing, China) to detect the expression levels of lateral and polar flagellum synthesis regulation in V. alginolyticus. The qPCR reaction system and conditions were operated in accordance with the product instructions. Ultimately, the relative expression of each gene mRNA was analyzed by the 2−ΔΔCt method with 16s rRNA (16s) as the internal reference.

2.14. SEM Observation

The effects of FPPPs on the cell morphology and cell membranes of V. alginolyticus were analyzed using scanning electron microscopy (SEM) [54]. V. alginolyticus was treated with different concentrations of FPPPs (0, 1/2MIC and MIC), and the organisms were collected by centrifugation at 3500× g for 10 min after incubation at 30 °C for 8 h. The organisms were washed using PBS and then resuspended in 2.5% glutaraldehyde solution and stored at 4 °C for 12 h. After centrifugation, the samples were dehydrated sequentially for 10 min with different dilutions of ethanol solutions (30, 50, 70, 80, 95 and 100%). Finally, the samples were vacuum placed on a sputtered gold-plated SEM scaffold and observed with a SU8100 scanning electron microscope (Hitachi, Tokyo, Japan).

2.15. Statistical Analysis

All experiments were conducted in at least triplicate. All the data were tested for normality and homogeneity of variance, followed by one-way analysis of variance and Duncan’s multiple range test. p < 0.05 suggested significant difference. The results are shown as means ± SD (n = 3), and SPSS 26.0 (IBM, New York, NY, USA) was used for statistical analysis.

3. Results

3.1. Inhibition of FPPPs on V. alginolyticus

The MIC and MBC of FPPPs against V. alginolyticus were 2 and 4 mg/mL, respectively. Based on the MIC, five FPPPs concentrations were designed to explore the effects on the growth of V. alginolyticus, and the results are shown in Figure 1. On the whole, the growth rate of V. alginolyticus in the control group without FPPPs treatment was relatively fast; V. alginolyticus was in a growth retardation phase from 0 to 4 h, in a log phase from 4 to 10 h and in a stable growth phase after 10 h. FPPPs at 1/8MIC, 1/4MIC and 1/2MIC could partially inhibit the growth of V. alginolyticus, and FPPPs at the MIC could completely inhibit the growth of V. alginolyticus.

3.2. Inhibition of FPPPs on Biofilm Formation of V. alginolyticus

V. alginolyticus can form biofilms when cultured in 96-well plates, so the amount of biofilm formation can be detected by measuring the OD value of the decolorized solution after the elution of crystal violet. As shown in Figure 2A, the biofilm formation of V. alginolyticus in the control group was more, whereas the FPPPs-treated cells exhibited a significant dose-dependent inhibition of biofilm formation.

3.3. Inhibition of FPPPs on Biofilm Metabolic Activity of V. alginolyticus

CCK-8 can be reduced to a water-soluble orange-yellow formazan by dehydrogenases in bacterial cells, and its color depth is proportional to the metabolic activity of the cells. In this experiment (Figure 2B), the metabolic activity of V. alginolyticus biofilm in the group treated with FPPPs was significantly lower than that in control group (p < 0.05). With the increase of the concentration of FPPPs, the inhibitory effect on the metabolic activity of pathogenic bacteria biofilm was enhanced.

3.4. Effect of FPPPs on AKP Activity of V. alginolyticus

As shown in Figure 2C, the activity of the extracellular AKP of V. alginolyticus was increasing with increasing concentrations of FPPPs in the treatment group. As a result, FPPPs significantly enhanced the permeability of V. alginolyticus cell wall, which may be associated with its capability to disrupt the integrity of the cell wall.

3.5. Effect of FPPPs on Oxidative Stress Indexes of V. alginolyticus

The activities of intracellular CAT and SOD enzymes were significantly reduced and the level of ROS was significantly increased in V. alginolyticus treated with FPPPs in this experiment (Figure 3A–C). Moreover, the content of extracellular MDA of V. alginolyticus also increased with the increase in FPPPs concentration (Figure 3D). These above indices indicate that FPPPs can induce oxidative stress in V. alginolyticus.

3.6. Effects of FPPPs on Protein and Nucleic Acid Leakage of V. alginolyticus

As shown in Figure 4, the results of the determination of extracellular proteins using the protein assay kit (BCA method) were consistent with the absorbance method (Figure 4B,C). FPPPs at concentrations from 1/8MIC to MIC could significantly increase the content of extracellular protein and nucleic acid of V. alginolyticus (Figure 4A) (p < 0.05).

3.7. Effect of FPPPs on the Conductivity of V. alginolyticus Culture Medium

In the experiment, the conductivity of the extracellular medium of the control group without FPPPs was 20.56 ms/cm (Figure 4D). However, the conductivity of the extracellular medium of V. alginolyticus increased to 22.26, 22.58, 23.02 and 23.54 ms/cm after treatment with 1/8MIC to the MIC of FPPPs.

3.8. Inhibition of FPPPs on the Motility of V. alginolyticus

The results of motility showed that FPPPs dose-dependently reduced the swimming and swarming ability of V. alginolyticus compared with untreated group, while the MIC of FPPPs almost completely inhibited its motility (Figure 5A,B). Similarly, the 1/2MIC and MIC of FPPPs also significantly down-regulated the expression levels of lafA and lafK genes involved in lateral flagellar synthesis and fliS and flaK genes involved in polar flagellar synthesis (Figure 5C) (p < 0.05).

3.9. Effect of FPPPs on Cell Morphology of V. alginolyticus Under SEM

SEM images showed that the cell surface of V. alginolyticus treated without FPPPs was smooth, full in appearance and normal in shape (Figure 6A). The cell surface of the 1/2MIC FPPPs treatment group began to shrink and distort with some depressions, and there was slight adhesion between the cells (Figure 6B). The cell shape distortion of FPPPs treated with MIC was more serious, and the cell surface showed more obvious shrinkage and collapse (Figure 6C). Additionally, the leakage of intracellular substances as well as the imagery of cell aggregation and overlap were also observed.

4. Discussion

V. alginolyticus, as part of the normal microbiota of the aquatic environment, is not only recognized as a major pathogen in many outbreaks of Vibrio disease in marine organisms but is also an important pathogenic microorganism globally associated with seafood that can cause foodborne illness in humans [8]. In the natural environment, bacteria of the genus Vibrio can form a self-protective biofilm on the surface of seafood or during food transportation and processing, which not only makes it easier for the bacteria to withstand the stresses of the external environment but also provides an ideal platform for them to invade and infect other organisms more easily [55,56]. In addition, due to the characteristics of the bacterial biofilm, which leads to a high level of drug resistance, antibiotics that pollute the environment and easily cause side effects such as environmental drug residues are gradually replaced or banned [57,58]. Therefore, we have necessity to search for new safe antibacterial agents, which should not only have the effect of killing bacteria but also need to be able to pass through biofilm and not be blocked or neutralized by the biofilm.
Polyphenols have been widely reported to inhibit the growth of microorganisms, but there are relatively few studies on the bacteriostatic properties of PPPs, and only a few relevant papers have been published [59,60]. Belgacem et al. found that pomegranate peel extract has a good bacteriostatic effect on Listeria monocytogenes and fruits (apple, pear and melon), and they believe that this strong bacteriostatic ability may come from the polyphenols in pomegranate peel extract [61]. Coincidentally, Yemis et al. also confirmed that pomegranate peel extract contains polyphenols with antibacterial activity against Cronobacter sakazakii, so pomegranate peel can be used as a source of natural antibacterial agents [62]. Further, Chen et al. investigated the bacteriostatic effect of PPPs with a purity of 83.3% on the bacteriostatic effect of Ralstonia solanacearum [30]. They demonstrated that PPPs had a good antibacterial effect on Ralstonia solanacearum, which was even stronger than that of ellagic acid, catechin, gallic acid and other monomers in PPPs. Additionally, PPPs significantly inhibited the reproduction, motility and biofilm formation of Ralstonia solanacearum, even severely disrupting the morphological structure of the bacteria to the point of impairing the integrity of their cell membranes and cell walls. So far, the effect of FPPPs or PPPs on the antibacterial activity of V. alginolyticus and even pathogenic microorganisms in seawater and its mechanism have not been studied.
In this study, the bacteriostatic effect of FPPPs on V. alginolyticus was evaluated for the first time, and the results showed that FPPPs had a good bacteriostatic effect on V. alginolyticus with the MIC of 2 mg/mL. Meanwhile, the 1/8MIC to MIC of FPPPs enormously inhibited the growth of V. alginolyticus, and FPPPs at the MIC can even completely inhibit the growth of V. alginolyticus. Similarly, Liu et al. also confirmed that vanillic acid had good antibacterial activity against V. alginolyticus with the MIC of 1.0 mg/mL, and vanillic acid at the 1/2MIC and MIC had excellent inhibition on the reproduction of V. alginolyticus throughout the growth cycle [63]. In addition, plants or plant extracts such as Fructus schisandrae, Rhizoma coptidis and citral have been successively reported to have good bacteriostatic efficacy against V. alginolyticus [64,65,66]. However, since FPPPs are composed of a variety of monomers, we cannot be sure which monomer or monomers play the main antibacterial role. Fortunately, there has been a great deal of research demonstrating that monomers such as ellagic acid, catechins, gallic acid and chlorogenic acid have excellent antibacterial properties against all types of bacteria, especially punicalagin [67,68,69,70]. Unfortunately, due to the limitations of the experiment, we cannot discuss in detail the antibacterial ability of each chemical component in FPPPs in this study, but this may be a very meaningful research direction and the focus of our subsequent research in the future. In order to prevent the interference of different batches of commercial FPPPs on the experimental results, we purchased FPPPs twice at different time periods and determined their MIC against V. alginolyticus. The results of the two experiments showed that the MIC of FPPPs to V. alginolyticus was 2 mg/mL. Moreover, we learned from the merchants selling FPPPs that the polyphenol content was strictly determined according to the prescribed requirements when each batch of FPPPs was produced in the factory, and the production place of pomegranate is also consistent. Therefore, we believe that FPPPs between different batches will not affect the results and conclusions of this study. In addition, the effect of FPPPs as an antibacterial agent for food preservation on human health needs further study.
The flagellar-mediated motility of Vibrio is usually closely related to the formation of biofilm, bacterial colonization and virulence [71]. V. alginolyticus has two different types of flagellar systems, the unipolar flagellum involved in its swimming in the liquid environment and the lateral flagellum involved in its swarming on solid surfaces [72]. The FPPPs in this study down-regulated the expression levels of the flagellar synthesis-related genes lafA, lafK, fliS and flaK in V. alginolyticus while drastically inhibiting the swimming and swarming ability of V. alginolyticus. Moreover, the biofilm formation and biofilm metabolic activity of V. alginolyticus treated with FPPPs were significantly reduced. Previous studies have revealed that the motility of bacteria plays an essential part in the adhesion phase and biofilm formation on solid surfaces [73]. At the same time, antimicrobial-induced reductions in bacterial biofilm formation are often accompanied by cellular inactivation in the biofilm [74]. Coincidentally, Cao et al. confirmed that citral reduced the formation of Vibrio parahaemolyticus biofilms and inhibited the expression of the genes lafA, flaA and flgM involved in flagellar-mediated motility, as well as the swimming and swarming abilities [75]. Similarly, Liu et al. showed that vanillic acid inhibited the motility of V. alginolyticus by down-regulating the expression levels of the lafA, lafK, fliS and flaK genes while reducing its biofilm-forming ability [63]. Based on the above results and analysis, we speculated that FPPPs may inhibit the swimming and swarming ability of V. alginolyticus by down-regulating the expression levels of the lafA, lafK, fliS and flaK genes that mediate flagellar synthesis, thus affecting the biofilm formation ability and biofilm metabolic activity of V. alginolyticus.
Bacteria may suffer oxidative stress during survival, which can damage their normal cellular structure, and ROS and MDA are important indicators of oxidative stress [76]. Excessive ROS can cause injury to important biological molecules such as proteins, lipin and nucleic acids in cells, thus affecting the basic functions of cells and eventually leading to cell death [77]. MDA is the product of lipid peroxidation, and its massive accumulation may lead to the injury of cell membrane structure and function, resulting in the variation of its permeability [78]. On the contrary, antioxidant mechanisms are key to the bacterial response to oxidative stress, and a range of antioxidant enzymes such as CAT and SOD can mitigate oxidative damage by scavenging free radicals and thereby reducing oxidative damage [79]. We found that the activities of CAT and SOD in V. alginolyticus treated with FPPPs decreased obviously, while the ROS level and MDA content increased substantially. Coincidentally, Li et al. found that the intracellular ROS level and hydrogen peroxide concentration of Vibrio mimicus cultured with high-purity epigallocatechin gallate increased, and SOD activity decreased in a dose-dependent tendency [46]. Likewise, Lan et al. investigated the inhibitory mechanism of chitosan caffeic acid graft (CS-g-CA) against Pseudomonas fluorescens, and they concluded that CS-g-CA exacerbates the production of ROS and lipid peroxides in Pseudomonas fluorescens, which disrupts the respiratory and metabolic systems of the bacteria as well as the membrane integrity [47]. As a consequence, we believe that FPPPs can exert its antibacterial effect by inducing oxidative stress of V. alginolyticus.
The Majority of bacteria are protected from external environmental damage by a robust and elastic cell wall composed of peptidoglycan, but AKP will leak out of the cell after it is damaged [80]. The cell membrane is a natural barrier composed of phospholipids and various proteins to protect cells and participates in basic activities such as material exchange, cell metabolism and protein synthesis [81]. However, when the bacterial membrane is damaged, the permeability will increase, resulting in the leakage of intracellular proteins, nucleic acids, ions and respiratory chain disorder [82]. Now we found that the content of extracellular protein and nucleic acid and the conductivity of extracellular solution in V. alginolyticus increased after being cultured with FPPPs. This indicates that the intracellular proteins, nucleic acids and ions of V. alginolyticus have leaked, which may be related to the damage of bacterial cell membranes. In order to further verify our hypothesis, we also observed V. alginolyticus by SEM. Similarly, SEM images revealed that FPPPs severely damaged the cell wall and membrane of V. alginolyticus and produced cell content leakage, cell distortion, cell aggregation overlap and other phenomena. Similar conclusions were reached by Palamae, who demonstrated that a chitooligosaccharide–catechin conjugate disrupted Vibrio parahaemolyticus cell morphology as well as the integrity of the cell membrane and caused an increase in the conductivity and MDA content of cell cultures, as well as intracellular ion leakage [83]. Our findings were also in agreement with the previous SEM findings of Vibrio parahaemolyticus exposed to linalool and Melissa officinalis L. essential oil, which showed severe cell damage, disruption of the cell membrane and wall integrity, and leakage of intracellular substances [84,85]. Such results implies that FPPPs can inhibit the growth of V. alginolyticus through the mechanism of damaging cell membranes and cell walls as well as disrupting the normal morphology of cells. At the same time, it is precisely because FPPPs has the function of damaging the cell membrane of V. alginolyticus, which further aggravates the oxidative stress of V. alginolyticus and leads to the increase of MDA, a lipid peroxidation product of cell membrane. In summary, the antibacterial mode of FPPPs against V. alginolyticus is not only derived from a single mechanism of action but involves the cascade reaction of the entire bacterial cell.

5. Conclusions

This study demonstrated that FPPPs had a strong antibacterial effect on V. alginolyticus, and the MIC was 2 mg/mL. FPPPs can induce oxidative stress in V. alginolyticus and destroy the integrity of cell membrane and wall, leading to the leakage of intracellular substances such as proteins, nucleic acids and ions. Moreover, FPPPs can reduce the swimming ability and swarming ability of V. alginolyticus by down-regulating the expression of genes involved in flagellar synthesis and inhibit the formation and metabolic activity of biofilm. These findings provide an important foundation for the application of FPPPs as a new and efficient antibacterial agent to control the infection of V. alginolyticus in live shrimp and other seafood.

Author Contributions

Conceptualization, Z.Y., M.Z. and X.T.; Methodology, Z.Y. and X.T.; Software, Y.H. and S.Z.; Validation, Z.Y., M.Z. and X.T.; Formal analysis, Z.Y., S.Z. and X.T.; Investigation, Z.Y.; Resources, Y.H., M.Z. and X.T.; Data curation, Z.Y. and X.T.; Writing—original draft, Z.Y.; Writing—review and editing, Z.Y., M.Z. and X.T.; Visualization, Z.Y.; Supervision, Y.H., M.Z. and X.T.; Project administration, Y.H., S.Z. and M.Z.; Funding acquisition, Y.H., S.Z. and M.Z. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by Jieyang City’s Introduction of Innovative Entrepreneurial Teams and Leading Talents Project: Functional Aquatic Animal Feed Research and Development Team (src003), Guangdong Maoming Binhai New Area Marine Fishery Industrial Park Project (0835-220FA8102621), Research, development and application of quality assurance technology for Lingnan aquatic products prefabricated dishes, and key construction discipline scientific research capacity improvement project in Guangdong Province (2022ZDJS022), Key Realm R&D Program of Guangdong Province (2021B0202050002), Innovative Team Projects of Ordinary Colleges and Universities in Guangdong Province (2020KCXTD019), and Provincial Agricultural Science and Technology Development and Resources Environmental Protection Management Projects (2022KJ115).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The datasets of the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

Authors Yucong Hong and Shuyan Zhao were employed by the company Guangdong Yuequn Biotechnology Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 1–19. [Google Scholar] [CrossRef] [PubMed]
  2. Zhou, K.; Tian, K.-Y.; Liu, X.-Q.; Liu, W.; Zhang, X.-Y.; Liu, J.-Y.; Sun, F. Characteristic and Otopathogenic Analysis of a Vibrio alginolyticus Strain Responsible for Chronic Otitis Externa in China. Front. Microbiol. 2021, 12, 750642. [Google Scholar] [CrossRef] [PubMed]
  3. Ahmed, H.A.; El Bayomi, R.M.; Hussein, M.A.; Khedr, M.H.E.; Abo Remela, E.M.; El-Ashram, A.M.M. Molecular characterization, antibiotic resistance pattern and biofilm formation of Vibrio parahaemolyticus and V. cholerae isolated from crustaceans and humans. Int. J. Food Microbiol. 2018, 274, 31–37. [Google Scholar] [CrossRef] [PubMed]
  4. Lipový, B.; Mager, R.; Raška, F.; Hanslianová, M.; Blažek, J.; Křemečková, H.; Suchánek, I.; Hladík, M. Vibrio vulnificus-Induced Necrotizing Fasciitis Complicated by Multidrug-Resistant Acinetobacter baumannii Infection: Efficacy of Chemical Necrectomy Using 40% Benzoic Acid. Int. J. Low. Extrem. Wounds 2021, 22, 200–207. [Google Scholar] [CrossRef]
  5. Yang, B.; Zhai, S.; Zhang, F.; Wang, H.; Ren, L.; Li, Y.; Li, Q.; Liu, S. Genome-wide association study toward efficient selection breeding of resistance to Vibrio alginolyticus in Pacific oyster, Crassostrea gigas. Aquaculture 2022, 548, 737592. [Google Scholar] [CrossRef]
  6. Mohamad, N.; Mohd Roseli, F.A.; Azmai, M.N.A.; Saad, M.Z.; Md Yasin, I.S.; Zulkiply, N.A.; Nasruddin, N.S. Natural Concurrent Infection of Vibrio harveyi and V. alginolyticus in Cultured Hybrid Groupers in Malaysia. J. Aquat. Anim. Health 2019, 31, 88–96. [Google Scholar] [CrossRef]
  7. Yin, X.; Zhuang, X.; Liao, M.; Huang, L.; Cui, Q.; Liu, C.; Dong, W.; Wang, F.; Liu, Y.; Wang, W. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) hepatopancreas challenged by Vibrio alginolyticus reveals lipid metabolic disturbance. Fish Shellfish Immunol. 2022, 123, 238–247. [Google Scholar] [CrossRef]
  8. Mao, F.; Liu, K.; Wong, N.-K.; Zhang, X.; Yi, W.; Xiang, Z.; Xiao, S.; Yu, Z.; Zhang, Y. Virulence of Vibrio alginolyticus Accentuates Apoptosis and Immune Rigor in the Oyster Crassostrea hongkongensis. Front. Immunol. 2021, 12, 746017. [Google Scholar] [CrossRef]
  9. Jones, E.H.; Feldman, K.A.; Palmer, A.; Butlera, E.; Blythe, D.; Mitchell, C.S. Vibrio Infections and Surveillance in Maryland, 2002–2008. Public Health Rep. 2013, 128, 537–545. [Google Scholar] [CrossRef]
  10. Reilly, G.D.; Reilly, C.A.; Smith, E.G.; Baker-Austin, C. Vibrio alginolyticus-associated wound infection acquired in British waters, Guernsey, July 2011. Eurosurveillance 2011, 16, 19994. [Google Scholar] [CrossRef]
  11. Jacobs Slifka, K.M.; Newton, A.E.; Mahon, B.E. Vibrio alginolyticus infections in the USA, 1988–2012. Epidemiol. Infect. 2017, 145, 1491–1499. [Google Scholar] [CrossRef] [PubMed]
  12. Osunla, C.A.; Okoh, A.I. Vibrio Pathogens: A Public Health Concern in Rural Water Resources in Sub-Saharan Africa. Int. J. Environ. Res. Public Health 2017, 14, 1188. [Google Scholar] [CrossRef] [PubMed]
  13. Kang, C.-H.; Shin, Y.; Jang, S.; Jung, Y.; So, J.-S. Antimicrobial susceptibility of Vibrio alginolyticus isolated from oyster in Korea. Environ. Sci. Pollut. Res. 2016, 23, 21106–21112. [Google Scholar] [CrossRef] [PubMed]
  14. Nurhafizah, W.W.I.; Lee, K.L.; Razak, L.A.A.; Nadirah, M.; Danish-Daniel, M.; Zainathan, S.C.; Najiah, M. Virulence properties and pathogenicity of multidrug-resistant Vibrio harveyi associated with luminescent vibriosis in Pacific white shrimp, Penaeus vannamei. J. Invertebr. Pathol. 2021, 186, 107594. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, H.; Wang, H.; Ma, Z.; Liu, Y.; Wu, Z.; Xu, H.; Qiao, M. Characterization of Proteus vulgaris Strain P3M, a Foodborne Multidrug-Resistant Bacterium Isolated from Penaeus vannamei in China. Microb. Drug Resist. 2021, 27, 1360–1370. [Google Scholar] [CrossRef]
  16. Faleye, O.S.; Sathiyamoorthi, E.; Lee, J.-H.; Lee, J. Inhibitory Effects of Cinnamaldehyde Derivatives on Biofilm Formation and Virulence Factors in Vibrio Species. Pharmaceutics 2021, 13, 2176. [Google Scholar] [CrossRef]
  17. Soowannayan, C.; Boonmee, S.; Puckcharoen, S.; Anatamsombat, T.; Yatip, P.; Ng, W.-K.; Thitamadee, S.; Tuchinda, P.; Munyoo, B.; Chabang, N.; et al. Ginger and its component shogaol inhibit Vibrio biofilm formation in vitro and orally protect shrimp against acute hepatopancreatic necrosis disease (AHPND). Aquaculture 2019, 504, 139–147. [Google Scholar] [CrossRef]
  18. Sun, X.-h.; Hao, L.-r.; Xie, Q.-c.; Lan, W.-q.; Zhao, Y.; Pan, Y.-j.; Wu, V.C.H. Antimicrobial effects and membrane damage mechanism of blueberry (Vaccinium corymbosum L.) extract against Vibrio parahaemolyticus. Food Control 2020, 111, 107020. [Google Scholar] [CrossRef]
  19. Zhang, Z.; Zhao, Y.; Cai, J.; Wang, T.; Song, Y.; Lu, J.; Du, H.; Wang, W.; Zhao, Y.; Guo, L. Optimized Extraction, Identification and Anti-Biofilm Action of Wu Wei Zi (Fructus Schisandrae Chinensis) Extracts against Vibrio parahaemolyticus. Molecules 2023, 28, 2268. [Google Scholar] [CrossRef]
  20. Tan, X.; Sun, Z.; Ye, C.; Lin, H. The effects of dietary Lycium barbarum extract on growth performance, liver health and immune related genes expression in hybrid grouper (Epinephelus lanceolatus♂ × E. fuscoguttatus♀) fed high lipid diets. Fish Shellfish Immunol. 2019, 87, 847–852. [Google Scholar] [CrossRef]
  21. Chen, Z.; Liu, L.; Gao, C.; Chen, W.; Vong, C.T.; Yao, P.; Yang, Y.; Li, X.; Tang, X.; Wang, S.; et al. Astragali Radix (Huangqi): A promising edible immunomodulatory herbal medicine. J. Ethnopharmacol. 2020, 258, 112895. [Google Scholar] [CrossRef] [PubMed]
  22. Jiang, H.; Zhang, W.; Xu, Y.; Chen, L.; Cao, J.; Jiang, W. An advance on nutritional profile, phytochemical profile, nutraceutical properties, and potential industrial applications of lemon peels: A comprehensive review. Trends Food Sci. Technol. 2022, 124, 219–236. [Google Scholar] [CrossRef]
  23. Elumalai, P.; Kurian, A.; Lakshmi, S.; Faggio, C.; Esteban, M.A.; Ringø, E. Herbal Immunomodulators in Aquaculture. Rev. Fish. Sci. Aquac. 2020, 29, 33–57. [Google Scholar] [CrossRef]
  24. Van Hai, N. The use of medicinal plants as immunostimulants in aquaculture: A review. Aquaculture 2015, 446, 88–96. [Google Scholar] [CrossRef]
  25. Shi, H.; Li, X.; Hou, C.; Chen, L.; Zhang, Y.; Li, J. Effects of Pomegranate Peel Polyphenols Combined with Inulin on Gut Microbiota and Serum Metabolites of High-Fat-Induced Obesity Rats. J. Agric. Food Chem. 2023, 71, 5733–5744. [Google Scholar] [CrossRef]
  26. Song, B.; Li, J.; Li, J. Pomegranate peel extract polyphenols induced apoptosis in human hepatoma cells by mitochondrial pathway. Food Chem. Toxicol. 2016, 93, 158–166. [Google Scholar] [CrossRef]
  27. Smaoui, S.; Hlima, H.B.; Mtibaa, A.C.; Fourati, M.; Sellem, I.; Elhadef, K.; Ennouri, K.; Mellouli, L. Pomegranate peel as phenolic compounds source: Advanced analytical strategies and practical use in meat products. Meat Sci. 2019, 158, 107914. [Google Scholar] [CrossRef]
  28. Colantuono, A.; Ferracane, R.; Vitaglione, P. In vitro bioaccessibility and functional properties of polyphenols from pomegranate peels and pomegranate peels-enriched cookies. Food Funct. 2016, 7, 4247–4258. [Google Scholar] [CrossRef]
  29. Suručić, R.; Travar, M.; Petković, M.; Tubić, B.; Stojiljković, M.P.; Grabež, M.; Šavikin, K.; Zdunić, G.; Škrbić, R. Pomegranate peel extract polyphenols attenuate the SARS-CoV-2 S-glycoprotein binding ability to ACE2 Receptor: In silico and in vitro studies. Bioorg. Chem. 2021, 114, 105145. [Google Scholar] [CrossRef]
  30. Chen, X.; Zhang, H.; Li, J.; Chen, L. Analysis of chemical compounds of pomegranate peel polyphenols and their antibacterial action against Ralstonia solanacearum. S. Afr. J. Bot. 2021, 140, 4–10. [Google Scholar] [CrossRef]
  31. Ma, G.-Z.; Wang, C.-M.; Li, L.; Ding, N.; Gao, X.-L. Effect of pomegranate peel polyphenols on human prostate cancer PC-3 cells in vivo. Food Sci. Biotechnol. 2015, 24, 1887–1892. [Google Scholar] [CrossRef]
  32. Saparbekova, A.A.; Kantureyeva, G.O.; Kudasova, D.E.; Konarbayeva, Z.K.; Latif, A.S. Potential of phenolic compounds from pomegranate (Punica granatum L.) by-product with significant antioxidant and therapeutic effects: A narrative review. Saudi J. Biol. Sci. 2023, 30, 103553. [Google Scholar] [CrossRef] [PubMed]
  33. Zhao, R.; Long, X.; Yang, J.; Du, L.; Zhang, X.; Li, J.; Hou, C. Pomegranate peel polyphenols reduce chronic low-grade inflammatory responses by modulating gut microbiota and decreasing colonic tissue damage in rats fed a high-fat diet. Food Funct. 2019, 10, 8273–8285. [Google Scholar] [CrossRef] [PubMed]
  34. Lv, O.; Wang, L.; Li, J.; Ma, Q.; Zhao, W. Effects of pomegranate peel polyphenols on lipid accumulation and cholesterol metabolic transformation in L-02 human hepatic cells via the PPARγ-ABCA1/CYP7A1 pathway. Food Funct. 2016, 7, 4976–4983. [Google Scholar] [CrossRef] [PubMed]
  35. Ruan, J.-H.; Li, J.; Adili, G.; Sun, G.-Y.; Abuduaini, M.; Abdulla, R.; Maiwulanjiang, M.; Aisa, H.A. Phenolic Compounds and Bioactivities from Pomegranate (Punica granatum L.) Peels. J. Agric. Food Chem. 2022, 70, 3678–3686. [Google Scholar] [CrossRef]
  36. Peanparkdee, M.; Iwamoto, S. Encapsulation for Improving in Vitro Gastrointestinal Digestion of Plant Polyphenols and Their Applications in Food Products. Food Rev. Int. 2022, 38, 335–353. [Google Scholar] [CrossRef]
  37. Yang, F.; Chen, C.; Ni, D.; Yang, Y.; Tian, J.; Li, Y.; Chen, S.; Ye, X.; Wang, L. Effects of Fermentation on Bioactivity and the Composition of Polyphenols Contained in Polyphenol-Rich Foods: A Review. Foods 2023, 12, 3315. [Google Scholar] [CrossRef]
  38. Yadav, M.K.; Chae, S.-W.; Im, G.J.; Chung, J.-W.; Song, J.-J. Eugenol: A Phyto-Compound Effective against Methicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Clinical Strain Biofilms. PLoS ONE 2015, 10, e0119564. [Google Scholar] [CrossRef]
  39. García-Heredia, A.; García, S.; Merino-Mascorro, J.Á.; Feng, P.; Heredia, N. Natural plant products inhibits growth and alters the swarming motility, biofilm formation, and expression of virulence genes in enteroaggregative and enterohemorrhagic Escherichia coli. Food Microbiol. 2016, 59, 124–132. [Google Scholar] [CrossRef]
  40. Liu, M.; Yang, K.; Wang, J.; Zhang, J.; Qi, Y.; Wei, X.; Fan, M. Young astringent persimmon tannin inhibits methicillin-resistant Staphylococcus aureus isolated from pork. LWT 2019, 100, 48–55. [Google Scholar] [CrossRef]
  41. Qian, W.; Zhang, J.; Wang, W.; Wang, T.; Liu, M.; Yang, M.; Sun, Z.; Li, X.; Li, Y. Antimicrobial and antibiofilm activities of paeoniflorin against carbapenem-resistant Klebsiella pneumoniae. J. Appl. Microbiol. 2020, 128, 401–413. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, H.; Zhu, W.; Cao, Y.; Gao, J.; Jin, T.; Qin, N.; Xia, X. Punicalagin inhibits biofilm formation and virulence gene expression of Vibrio parahaemolyticus. Food Control 2022, 139, 109045. [Google Scholar] [CrossRef]
  43. An, J.; Ding, N.; Zhang, Z. Mechanical and antibacterial properties of polymethyl methacrylate modified with zinc dimethacrylate. J. Prosthet. Dent. 2022, 128, 100.e1–100.e8. [Google Scholar] [CrossRef] [PubMed]
  44. Vartika; Chaudhary, M.; Bhagyawant, S.S.; Srivastava, N. Effects of Prednisolone Derivative and Panaxydol: Biosurfactants on Cell Wall Integrity of Acne-Causing Resistant Bacteria. Cell Biochem. Biophys. 2022, 80, 229–243. [Google Scholar] [CrossRef]
  45. Shivaprasad, D.P.; Taneja, N.K.; Lakra, A.; Sachdev, D. In vitro and in situ abrogation of biofilm formation in E. coli by vitamin C through ROS generation, disruption of quorum sensing and exopolysaccharide production. Food Chem. 2021, 341, 128171. [Google Scholar] [CrossRef]
  46. Li, R.; Lu, J.; Duan, H.; Yang, J.; Tang, C. Biofilm inhibition and mode of action of epigallocatechin gallate against Vibrio mimicus. Food Control 2020, 113, 107148. [Google Scholar] [CrossRef]
  47. Lan, W.; Du, J.; Sun, Y.; Xie, J. Insight into the antibacterial activity and mechanism of chitosan caffeic acid graft against Pseudomonas fluorescens. Int. J. Food Sci. Technol. 2023, 58, 1317–1325. [Google Scholar] [CrossRef]
  48. Liu, M.; Guo, W.; Feng, M.; Bai, Y.; Huang, J.; Cao, Y. Antibacterial, anti-biofilm activity and underlying mechanism of garlic essential oil in water nanoemulsion against Listeria monocytogenes. LWT 2024, 196, 115847. [Google Scholar] [CrossRef]
  49. Lee, H.J.; Choi, G.J.; Cho, K.Y. Correlation of Lipid Peroxidation in Botrytis cinerea Caused by Dicarboximide Fungicides with Their Fungicidal Activity. J. Agric. Food Chem. 1998, 46, 737–741. [Google Scholar] [CrossRef]
  50. Wang, L.; Ling, Y.; Jiang, H.; Qiu, Y.; Qiu, J.; Chen, H.; Yang, R.; Zhou, D. AphA is required for biofilm formation, motility, and virulence in pandemic Vibrio parahaemolyticus. Int. J. Food Microbiol. 2013, 160, 245–251. [Google Scholar] [CrossRef]
  51. Zhu, Z.; Yang, L.; Yu, P.; Wang, Y.; Peng, X.; Chen, L. Comparative Proteomics and Secretomics Revealed Virulence and Antibiotic Resistance-Associated Factors in Vibrio parahaemolyticus Recovered From Commonly Consumed Aquatic Products. Front. Microbiol. 2020, 11, 1453. [Google Scholar] [CrossRef] [PubMed]
  52. Garzoli, S.; Maggio, F.; Vinciguerra, V.; Rossi, C.; Donadu, M.G.; Serio, A. Chemical Characterization and Antimicrobial Properties of the Hydroalcoholic Solution of Echinacea purpurea (L.) Moench. and Propolis from Northern Italy. Molecules 2023, 28, 1380. [Google Scholar] [CrossRef] [PubMed]
  53. Cao, X.; Wang, Q.; Liu, Q.; Rui, H.; Liu, H.; Zhang, Y. Identification of a luxO-regulated extracellular protein Pep and its roles in motility in Vibrio alginolyticus. Microb. Pathog. 2011, 50, 123–131. [Google Scholar] [CrossRef] [PubMed]
  54. Wang, X.; Cheng, H.; Lu, M.; Fang, Y.; Jiao, Y.; Li, W.; Zhao, G.; Wang, S. Dextranase from Arthrobacter oxydans KQ11-1 inhibits biofilm formation by polysaccharide hydrolysis. Biofouling 2016, 32, 1223–1233. [Google Scholar] [CrossRef]
  55. Krupesha Sharma, S.R.; Shankar, K.M.; Sathyanarayana, M.L.; Patil, R.R.; Narayana Swamy, H.D.; Rao, S. Development of biofilm of Vibrio alginolyticus for oral immunostimulation of shrimp. Aquac. Int. 2011, 19, 421–430. [Google Scholar] [CrossRef]
  56. Yildiz, F.H.; Visick, K.L. Vibrio biofilms: So much the same yet so different. Trends in Microbiology 2009, 17, 109–118. [Google Scholar] [CrossRef]
  57. Kumar, S.; Lekshmi, M.; Stephen, J.; Ortiz-Alegria, A.; Ayitah, M.; Varela, M.F. Dynamics of efflux pumps in antimicrobial resistance, persistence, and community living of Vibrionaceae. Arch. Microbiol. 2023, 206, 7. [Google Scholar] [CrossRef]
  58. Lee, Y.; Choi, Y.; Lee, S.; Lee, H.; Kim, S.; Ha, J.; Lee, J.; Oh, H.; Kim, Y.; Yoon, Y. Occurrence of pathogenic Vibrio parahaemolyticus in seafood distribution channels and their antibiotic resistance profiles in S. Korea. Lett. Appl. Microbiol. 2019, 68, 128–133. [Google Scholar] [CrossRef]
  59. Zhao, Y.; Li, H.; Zhang, Z.; Ren, Z.; Yang, F. Extraction, preparative monomer separation and antibacterial activity of total polyphenols from Perilla frutescens. Food Funct. 2022, 13, 880–890. [Google Scholar] [CrossRef]
  60. Wang, N.; Liu, X.; Ma, Y.; Huang, X.; Song, L.; Guo, H.; Sun, X.; Sun, X.; Hai, D.; Zhao, P.; et al. Identification of polyphenol extracts from flaxseed and study on its bacteriostatic mechanism. Food Biosci. 2024, 58, 103618. [Google Scholar] [CrossRef]
  61. Belgacem, I.; Schena, L.; Teixidó, N.; Romeo, F.V.; Ballistreri, G.; Abadias, M. Effectiveness of a pomegranate peel extract (PGE) in reducing Listeria monocytogenes in vitro and on fresh-cut pear, apple and melon. Eur. Food Res. Technol. 2020, 246, 1765–1772. [Google Scholar] [CrossRef]
  62. Yemis, G.P.; Bach, S.; Delaquis, P. Antibacterial activity of polyphenol-rich pomegranate peel extract against Cronobacter sakazakii. Int. J. Food Prop. 2019, 22, 985–993. [Google Scholar] [CrossRef]
  63. Liu, H.; Xiao, M.; Zuo, J.; He, X.; Lu, P.; Li, Y.; Zhao, Y.; Xia, F. Vanillic acid combats Vibrio alginolyticus by cell membrane damage and biofilm reduction. J. Fish Dis. 2021, 44, 1799–1809. [Google Scholar] [CrossRef] [PubMed]
  64. Yi, X.; Xu, X.; Chen, Y.; Xu, G.; Zhu, Z.; Li, H.; Shen, H.; Lin, M.; Zhao, W.; Zheng, J.; et al. Genetic analysis of Vibrio alginolyticus challenged by Fructus schisandrae reveals the mechanism of virulence genes. Gene 2023, 870, 147421. [Google Scholar] [CrossRef] [PubMed]
  65. Zhu, Z.; Xu, X.; Huang, J.; Xu, G.; Liu, S.; Hong, F.; Chen, Y.; Yi, X.; Li, H.; Li, J. Transcriptomic analysis of Vibrio alginolyticus challenged by Rhizoma coptidis reveals mechanisms of virulence genes. Gene 2024, 905, 148188. [Google Scholar] [CrossRef]
  66. Liu, H.; Wang, Y.; Cao, J.; Jiang, H.; Yao, J.; Gong, G.; Chen, X.; Xu, W.; He, X. Antimicrobial activity and virulence attenuation of citral against the fish pathogen Vibrio alginolyticus. Aquaculture 2020, 515, 734578. [Google Scholar] [CrossRef]
  67. Gatto, L.J.; Veiga, A.; Gribner, C.; Moura, P.F.; Rech, K.S.; Murakami, F.S.; Dias, J.d.F.G.; Miguel, O.G.; Miguel, M.D. Myrcia hatschbachii: Antifungal activity and structural elucidation of ellagic and 3-O-methyl ellagic acids. Nat. Prod. Res. 2021, 35, 5540–5543. [Google Scholar] [CrossRef]
  68. Gomes, F.M.S.; da Cunha Xavier, J.; dos Santos, J.F.S.; de Matos, Y.M.L.S.; Tintino, S.R.; de Freitas, T.S.; Coutinho, H.D.M. Evaluation of antibacterial and modifying action of catechin antibiotics in resistant strains. Microb. Pathog. 2018, 115, 175–178. [Google Scholar] [CrossRef]
  69. Yang, L.; Zhang, C.; Su, Z.; Zhao, L.; Wu, J.; Sun, X.; Zhang, X.; Hu, X. Inactivation of Salmonella typhimurium SL1344 by Chlorogenic Acid and the Impairment of Cellular Integrity. Front. Microbiol. 2022, 13, 887950. [Google Scholar] [CrossRef]
  70. Huang, B.; Zhang, Z.; Ding, N.; Wang, B.; Zhang, G.; Fei, P. Investigation of the pectin grafting with gallic acid and propyl gallate and their antioxidant activities, antibacterial activities and fresh keeping performance. Int. J. Biol. Macromol. 2021, 190, 343–350. [Google Scholar] [CrossRef]
  71. Echazarreta, M.A.; Klose, K.E. Vibrio Flagellar Synthesis. Front. Cell. Infect. Microbiol. 2019, 9, 131. [Google Scholar] [CrossRef] [PubMed]
  72. Ono, H.; Takashima, A.; Hirata, H.; Homma, M.; Kojima, S. The MinD homolog FlhG regulates the synthesis of the single polar flagellum of ibrio alginolyticus. Mol. Microbiol. 2015, 98, 130–141. [Google Scholar] [CrossRef] [PubMed]
  73. Borges, A.; Saavedra, M.J.; Simões, M. The activity of ferulic and gallic acids in biofilm prevention and control of pathogenic bacteria. Biofouling 2012, 28, 755–767. [Google Scholar] [CrossRef] [PubMed]
  74. Kang, J.; Jin, W.; Wang, J.; Sun, Y.; Wu, X.; Liu, L. Antibacterial and anti-biofilm activities of peppermint essential oil against Staphylococcus aureus. LWT 2019, 101, 639–645. [Google Scholar] [CrossRef]
  75. Cao, J.; Liu, H.; Wang, Y.; He, X.; Jiang, H.; Yao, J.; Xia, F.; Zhao, Y.; Chen, X. Antimicrobial and antivirulence efficacies of citral against foodborne pathogen Vibrio parahaemolyticus RIMD2210633. Food Control 2021, 120, 107507. [Google Scholar] [CrossRef]
  76. Gupta, A.; Imlay, J.A. How a natural antibiotic uses oxidative stress to kill oxidant-resistant bacteria. Proc. Natl. Acad. Sci. USA 2023, 120, e2312110120. [Google Scholar] [CrossRef]
  77. Vatansever, F.; de Melo, W.C.M.A.; Avci, P.; Vecchio, D.; Sadasivam, M.; Gupta, A.; Chandran, R.; Karimi, M.; Parizotto, N.A.; Yin, R.; et al. Antimicrobial strategies centered around reactive oxygen species—Bactericidal antibiotics, photodynamic therapy, and beyond. FEMS Microbiol. Rev. 2013, 37, 955–989. [Google Scholar] [CrossRef]
  78. Wu, Y.; Duan, X.; Jing, G.; OuYang, Q.; Tao, N. Cinnamaldehyde inhibits the mycelial growth of Geotrichum citri-aurantii and induces defense responses against sour rot in citrus fruit. Postharvest Biol. Technol. 2017, 129, 23–28. [Google Scholar] [CrossRef]
  79. Farooqui, A.; Suhail, S.; Zeeshan, M. Cadmium induced oxidative stress and biochemical responses in cyanobacterium Nostoc muscorum. Russ. J. Plant Physiol. 2017, 64, 124–132. [Google Scholar] [CrossRef]
  80. Alvarez, L.; Hernandez, S.B.; Cava, F. Cell Wall Biology of Vibrio cholerae. Annu. Rev. Microbiol. 2021, 75, 151–174. [Google Scholar] [CrossRef]
  81. Nguyen, A.H.; Hood, K.S.; Mileykovskaya, E.; Miller, W.R.; Tran, T.T. Bacterial cell membranes and their role in daptomycin resistance: A review. Front. Mol. Biosci. 2022, 9, 1035574. [Google Scholar] [CrossRef] [PubMed]
  82. Zhang, D.; Zou, L.; Wu, D.-T.; Zhuang, Q.-G.; Li, H.-B.; Mavumengwana, V.; Corke, H.; Gan, R.-Y. Discovery of 1′-acetoxychavicol acetate (ACA) as a promising antibacterial compound from galangal (Alpinia galanga (Linn.) Willd). Ind. Crops Products 2021, 171, 113883. [Google Scholar] [CrossRef]
  83. Palamae, S.; Mittal, A.; Buatong, J.; Zhang, B.; Hong, H.; Benjakul, S. Chitooligosaccharide-catechin conjugate: Antimicrobial mechanisms toward Vibrio parahaemolyticus and its use in shucked Asian green mussel. Food Control 2023, 151, 109794. [Google Scholar] [CrossRef]
  84. Ren, F.; Li, Y.; Chen, W.; Chen, W.; Chen, H.; Zhang, M. Antimicrobial mechanism of linalool against Vibrio parahaemolyticus and its application in black tiger shrimp (Penaeus monodon). Food Biosci. 2024, 60, 104283. [Google Scholar] [CrossRef]
  85. Yu, H.; Pei, J.; Qiu, W.; Mei, J.; Xie, J. The Antimicrobial Effect of Melissa officinalis L. Essential Oil on Vibrio parahaemolyticus: Insights Based on the Cell Membrane and External Structure. Front. Microbiol. 2022, 13, 812792. [Google Scholar] [CrossRef]
Biology 13 00934 g001
Figure 1. Growth curve of V. alginolyticus in LB under different concentrations of FPPPs. FPPPs concentration: control (0), 1/8MIC (0.25 mg/mL), 1/4MIC (0.5 mg/mL), 1/2MIC (1 mg/mL) and MIC (2 mg/mL). Error bars represent the mean ± SD of three replicates.
Figure 1. Growth curve of V. alginolyticus in LB under different concentrations of FPPPs. FPPPs concentration: control (0), 1/8MIC (0.25 mg/mL), 1/4MIC (0.5 mg/mL), 1/2MIC (1 mg/mL) and MIC (2 mg/mL). Error bars represent the mean ± SD of three replicates.
Biology 13 00934 g001
Biology 13 00934 g002
Figure 2. The effects of different concentrations of FPPPs on biofilm formation ability (A), biofilm metabolic activity (B) and extracellular AKP activity (C) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicated significant differences (p < 0.05, Duncan’s test).
Figure 2. The effects of different concentrations of FPPPs on biofilm formation ability (A), biofilm metabolic activity (B) and extracellular AKP activity (C) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicated significant differences (p < 0.05, Duncan’s test).
Biology 13 00934 g002
Biology 13 00934 g003
Figure 3. The effects of different concentrations of FPPPs on the intracellular CAT activity (A), intracellular SOD activity (B), intracellular ROS level (C) and extracellular MDA content (D) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Figure 3. The effects of different concentrations of FPPPs on the intracellular CAT activity (A), intracellular SOD activity (B), intracellular ROS level (C) and extracellular MDA content (D) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Biology 13 00934 g003
Biology 13 00934 g004
Figure 4. Effects of different concentrations of FPPPs on the extracellular DNA (OD260 nm) content (A) extracellular protein (OD280 nm) content (B), protein (detecting using BCA protein quantification kit) content (C) and extracellular conductivity (D) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Figure 4. Effects of different concentrations of FPPPs on the extracellular DNA (OD260 nm) content (A) extracellular protein (OD280 nm) content (B), protein (detecting using BCA protein quantification kit) content (C) and extracellular conductivity (D) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Biology 13 00934 g004
Biology 13 00934 g005
Figure 5. The effects of different concentrations of FPPPs on the swimming ability (A), swarming ability (B) and flagella formation related genes (C) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Figure 5. The effects of different concentrations of FPPPs on the swimming ability (A), swarming ability (B) and flagella formation related genes (C) of V. alginolyticus. Error bars represent the mean ± SD of three replicates. Different lowercase letters indicate significant differences (p < 0.05, Duncan’s test).
Biology 13 00934 g005
Biology 13 00934 g006
Figure 6. Effect of different concentrations ((A), (B) and (C): control, 1/2MIC and MIC, respectively) of FPPPs on cell morphology of V. alginolyticus under scanning electron microscope (SEM).
Figure 6. Effect of different concentrations ((A), (B) and (C): control, 1/2MIC and MIC, respectively) of FPPPs on cell morphology of V. alginolyticus under scanning electron microscope (SEM).
Biology 13 00934 g006
Table 1. Primer sequences of genes used in real-time quantitative PCR.
Table 1. Primer sequences of genes used in real-time quantitative PCR.
Primer NameForward Primers (5′-3′)Reverse Primers (5′-3′)Source
16sAAAGCACTTTCAGTCGTGAGGAATGCGCTTTACGCCCAGTAAT[45]
lafACGCAGGTATCGGTGAAATCACCGAAGTCTGCACGAGAGCTA[45]
lafKGAATCGGGAACGGGTAAAGAAGGTGAACGCGCCTTTTACAT[45]
fliSCTGGTGCGATTGAGCGCCTTATTCACGTCGATCAGCTGAGGCTCATTTTG[45]
flaKGTATCAAACACGGAAGCAAACGTTCTAGGAGCTCAGGCGGTATT[45]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, Z.; Hong, Y.; Zhao, S.; Zhou, M.; Tan, X. Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology 2024, 13, 934. https://doi.org/10.3390/biology13110934

AMA Style

Yu Z, Hong Y, Zhao S, Zhou M, Tan X. Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology. 2024; 13(11):934. https://doi.org/10.3390/biology13110934

Chicago/Turabian Style

Yu, Zhoulin, Yucong Hong, Shuyan Zhao, Meng Zhou, and Xiaohong Tan. 2024. "Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism" Biology 13, no. 11: 934. https://doi.org/10.3390/biology13110934

APA Style

Yu, Z., Hong, Y., Zhao, S., Zhou, M., & Tan, X. (2024). Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology, 13(11), 934. https://doi.org/10.3390/biology13110934

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop