Next Article in Journal
Effect of the Soil and Ripening Stage in Capsicum chinense var. Jaguar on the Content of Carotenoids and Vitamins
Next Article in Special Issue
Comparative Transcriptomic Analyses Provide Insights into the Enzymatic Browning Mechanism of Fresh-Cut Sand Pear Fruit
Previous Article in Journal
Influence of Ecklonia maxima Extracts on Growth, Yield, and Postharvest Quality of Hydroponic Leaf Lettuce
Previous Article in Special Issue
Analysis of Light-Independent Anthocyanin Accumulation in Mango (Mangifera indica L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 7
Issue 11
10.3390/horticulturae7110441
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl.

by
Muhammad Moaaz Ali
1,
Shariq Mahmood Alam
2,
Raheel Anwar
3,
Sajid Ali
4,
Meng Shi
1,
Dangdi Liang
1,
Zhimin Lin
5,* and
Faxing Chen
1,*
1
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture & Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, China
3
Institute of Horticulture Sciences, University of Agriculture, Faisalabad 38000, Pakistan
4
Department of Horticulture, Faculty of Agricultural Sciences and Technology, Bahauddin Zakariya University, Multan 60800, Pakistan
5
Institute of Biotechnology, Fujian Academy of Agricultural Sciences, Fuzhou 350003, China
*
Authors to whom correspondence should be addressed.
Horticulturae 2021, 7(11), 441; https://doi.org/10.3390/horticulturae7110441
Submission received: 22 September 2021 / Revised: 27 October 2021 / Accepted: 28 October 2021 / Published: 1 November 2021
(This article belongs to the Special Issue Physiology and Molecular Biology of Flowering, Fruit Setting, Fruit Quality)
Browse Figures
Versions Notes

Abstract

:
Aluminum-activated malate transporters (ALMTs) have multiple potential roles in plant metabolism such as regulation of organic acids in fruits, movement of guard cells and inducing tolerance against aluminum stress. However, the systematic characterization of ALMT genes in loquat is yet to be performed. In the current study, 24 putative ALMT genes were identified in the genome of Eriobotrya japonica Lindl. To further investigate the role of those ALMT genes, comprehensive bioinformatics and expression analysis were performed. In bioinformatics analysis, the physiochemical properties, conserved domains, gene structure, conserved motif, phylogenetic and syntenic analysis of EjALMT genes were conducted. The result revealed that the ALMT superfamily domain was conserved in all EjALMT proteins. EjALMT proteins were predicted to be localized in the plasma membrane. Genomic structural and motif analysis showed that the exon and motif number of each EjALMT gene ranged dramatically, from 5 to 7, and 6 to 10, respectively. Syntenic analysis indicated that the segmental or whole-genome duplication played a vital role in extension of the EjALMT gene family. The Ka and Ks values of duplicated genes depicted that EjALMT genes have undergone a strong purifying selection. Furthermore, the expression analysis of EjALMT genes was performed in the root, mature leaf, stem, full-bloom flower and ripened fruit of loquat. Some genes were expressed differentially in examined loquat tissues, signifying their differential role in plant growth and development. This study provides the first genome-wide identification, characterization, and relative expression of the ALMT gene family in loquat and provides the foundation for further functional analysis.

1. Introduction

Loquat (Eriobotrya japonica Lindl.) is an evergreen fruit tree originating from China, which belongs to the family Rosaceae, subfamily Maloideae. It is a rich source of vitamin A, vitamin B6, potassium, magnesium and dietary fiber [1]. Loquat is a very beautiful orange-colored fruit with a mild sweet and sour taste [2]. It is most widely grown in Japan, Korea, India, Pakistan, and the south-central region of China, and is also grown as an ornamental shrub in California [3]. China is the leading producer and exporter of loquat and grows it on more than 100,000 hectares. The annual production of loquat in China reaches up to 380,000 tons [4]. More than 30 species of loquat are being grown in temperate and subtropical regions of Asia [5].
Aluminum-activated malate transporters (ALMTs) gene family encodes proteins for anion transportation in plants and regulates permeability to organic acids across membranes [6]. Organic acids are involved in the fundamental metabolism of plants and help plants to evolve and adapt according to their environment, such as biological processes (stomatal movement and pH regulation), aluminum tolerance and plant stress responses [7,8,9]. Previous studies have indicated the role of organic acid exudation (particularly malic acid) in regulating plant tolerance against metal toxicity and mineral stress, as well as vacuolar accumulation to define fruit acidity [10,11]. Therefore, elucidating the key mechanism(s) for the transportation of organic acid in fruit plants may help in understanding plant sustainability on the occurrence of stresses.
For acidic soils, aluminum toxicity is an important limiting aspect for crop cultivation and sustainable production. To counter aluminum toxicity, different plant species release organic acids (di-carboxylic or tri-carboxylic) which act as chelating agent and immobilize phytotoxic ions (Al3+). As a result of Al3+ chelation, stable nontoxic complexes are formed which prevent Al3+ to enter into the plant root cells [12,13,14]. Anion channels and proton pumps are vital to support organic acid drive, for example, efflux created by electrochemical gradient across membrane favors transportation of citric and malic acids from cytosol to apoplast. The Al3+ dependent plasma membrane anion channel was first reported in wheat root protoplasts in the Al3+ tolerant line. Moreover, these anion channels can be activated by alteration of extracellular Al3+ [10].
To date, the function of ALMT members varies diversely. ALMT members not only work as root Al3+ resistance responses, but several physiological processes were also regulated by ALMTs. Among 14 reported genes of ALMTs in A. thaliana, ALMT1 is involved in Al3+ plant resistance [15]. Several factors, likewise, such as Hydrogen peroxide (H2O2), Abscisic acid (ABA), Indole-3-acetic acid (IAA) treatment and low pH, can also significantly trigger the activity of these genes [16]. AtALMT6 and AtALMT9 are involved in the transportation of malate contents into the vacuoles and are located in the tonoplast of guard cells [17,18]. AtALMT9 can be influenced by the physical concentration of cytosolic malate, which plays an imperative part in stomatal flexing [19]. Similarly, modifications in cytosolic Ca2+ can regulate the activity and expression of AtALMT6, and investigation indicated that AtALMT6 plants show reduced concentration of malic acid in vacuole as compared to wild-type A. thaliana; however, mutation had no apparent phenotypic dissimilarities [18]. In addition, heterologous overexpression of Ma1 (MdALMT member) in yeast induced the accumulation of malate in vacuole as compared to control [11]. Similarly, electrophysiological studies showed that selective flux was generated by VvALMT9 for the accumulation of malic and tartaric acids into the grapes vacuole [20]. With the previous knowledge, it can be perceived that the functional divergence for ALMTs during genomic advancement among plant species resulted in altered functional constraints, and it is critical to assess evolutionary association among diverse species.
Loquat has its own importance due to its typical flavoring among fruit crops [21,22]. Lately, using 3rd-generation sequencing (Nanopore and Hi-C technologies), genome of loquat was sequenced [23]. As the ALMT gene family in loquat had not yet been studied, availing the opportunity to further analyze and decipher molecular basis, we identified 24 ALMTs in loquat and investigated their phylogenetic relationship, gene duplication, subcellular localization and expression pattern. Our outcomes elaborate molecular features and evolutionary patterns for the EjALMT gene family and deliver a groundwork for future elucidation of ALMTs-mediated plant growth, development and stress mechanisms in loquat.

2. Materials and Methods

2.1. Identification and Characterization of ALMT Genes

The loquat (Eriobotrya japonica) genome sequence was downloaded from the GigaScience Database (http://gigadb.org/dataset/view/id/100711, accessed on 22 December 2020) [23]. The apple genome sequence [24] was downloaded from Phytozome (http://phytozome.jgi.doe.gov/pz/portal.html, accessed on 16 June 2021) and the genome sequences of European pear [25] and peach [26] were downloaded from the Genome Database for Rosaceae (GDR) (http://www.rosaceae.org/, accessed on 16 June 2021). The peptide sequences of ALMT genes in Arabidopsis thaliana [17] were retrieved from TAIR (https://www.arabidopsis.org/, accessed on 22 December 2020), and used as a query sequence to perform BLAST against the genome databases of the aforementioned species. Additionally, the seed alignment file for the ALMT domain (PF11744) obtained from the Pfam database [27] was used to build an HMM file using the HMMER3 software package [28]. HMM searches were then performed against the local protein databases of the aforementioned species using HMMER3. Moreover, we checked the physical locations of all candidate ALMT genes and rejected redundant sequences with the same chromosome location. Furthermore, all obtained ALMT protein sequences were analyzed again in the Pfam database to verify the presence of ALMT domains by the SMART programs (http://smart.embl-heidelberg.de/, accessed on 08 December 2020). The protein sequences lacking the ALMT domain were removed.
The physiochemical properties of EjALMT proteins were calculated using ExPASy Proteomics Server (http://web.expasy.org/compute_pi/, accessed on 15 December 2020). The WoLF PSORT web server (https://wolfpsort.hgc.jp/, accessed on 15 December 2020) and CELLO version 2.5, subcellular localization predictor, (http://cello.life.nctu.edu.tw/, accessed on 15 December 2020) were used to predict EjALMT subcellular localizations. The 3D-structure models of ALMT proteins were predicted through the online tool i-Tasser (https://zhanggroup.org/I-TASSER/, accessed on 26 June 2021).

2.2. Phylogenetic Analyses

Phylogenetic and molecular evolutionary genetics analyses were conducted using Molecular Evolutionary Genetics Analysis X (MEGA-X v10.2.6) [29]. First, coding sequence alignment was performed using MUSCLE (Multiple Sequence Caparison by Log-Expectation) with default parameters in MEGA-X. Then, the neighbor-joining (NJ) method was applied to construct different ALMT trees with a bootstrap of 1000 replicates, p-distance and pairwise deletion using MEGA-X.

2.3. Gene Structure, Conserved Motif and Promoter Region Analyses of ALMT Genes

The exon-intron organization of EjALMT genes was determined by aligning coding sequences with the corresponding genomic sequences. Diagrams were generated using TBtools software package v0.6655 [30]. Conserved motifs of EjALMT genes were identified and analyzed using the online MEME suite server (http://meme-suite.org/, accessed on 25 June 2021). The parameters were set as follows: maximum numbers of different motifs, 10; minimum width, 10; maximum width, 50. The promoter region analysis (cis-regulatory elements) was performed through the online PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 25 June 2021) and visualized through a heat-map using TBtools software package v0.6655 [30].

2.4. Chromosomal Mapping and Syntenic Analysis of ALMTs in Loquat

By using Tbtools software package v0.6655 [30], a gff3-file of the E. japonica genome was used to investigate distribution and mapping of EjALMT genes on all 17 chromosomes. The duplicated ALMT genes in loquat were identified using MCScanX [31]. Briefly, all of the protein sequences from loquat were compared using BLASTP (http://www.ncbi.nlm.nih.gov/blast/blast.cgi, accessed on 23 January 2021) with an e-value less than 1 × 10−5. The BLASTP outputs with gene-location files were used as an input for MCScanX to identify syntenic gene pairs and duplication types with default settings. Circos function in TBtools [30] was used to construct the schematic diagram of the putative duplication of EjALMT genes, and the putative WGD/segmental-duplicated genes or tandem-duplicated genes were connected by links [32].

2.5. Ka and Ks Calculation

MCScanX downstream analysis tools were used to annotate the Ka and Ks substitution rates of syntenic gene pairs. KaKs_Calculator 2.0 was used to determine Ka and Ks with the Nei–Gojobori (NG) method [33,34].

2.6. RNA Isolation and Quantitative RT-PCR Analysis

Five kinds of loquat tissues, i.e., full-bloom flower, root, mature leaf, ripening fruit and stem, were selected for quantitative RT-PCR assay. Total RNA was extracted using a Total RNA kit (TianGen Biotech, Beijing, China). The quantity and quality of RNA were checked using a NanoDrop N-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and agarose gel electrophoresis. Prime Script RT Reagent Kit with a gDNA Eraser (TaKaRa, Dalian, China) was used to synthesize first-strand cDNA from 1 µg of total RNA. Real-time qPCR analysis was carried out using high-performance real-time PCR (LightCycler® 96, Roche Applied Science, Penzberg, Germany). The relative expression level of each gene was measured according to the cycle threshold (Ct), also known as the 2−ΔΔCT method, and all the analyses consisted of 3 biological replicates. An actin gene, described in a previous study [33], was selected as a constitutive control, and all the primers used for qRT-PCR are listed in Table 1.

3. Results

3.1. Identification and Characterization of ALMT Gene Family in Loquat

A total of 24 putative EjALMT genes were identified in the loquat genome. General information about targeted EjALMT genes as well as physico-chemical properties regarding 24 EjALMT proteins are shown in Table 2. Proteins found in the genome of loquat ranged from 318 to 602 amino acids in length, while the molecular weight predicted for these proteins ranged from 34.57 to 67.57 kDa.
Since 5.92 to 9.34 was the range analyzed as the theoretical isoelectric point (pI) for EjALMT proteins, the grand average of hydropathicity (GRAVY) scaled from −0.112 to 0.347. Moreover, the index range for instability and aliphatic index was recorded as 89.07 to 108.97 and 22.76 to 46.41 for EjALMT proteins, respectively.
The protein structures of loquat ALMTs were predicted through the online tool i-Tasser. The predicted models were downloaded to view their 3D structure. All proteins of ALMT genes had flexible structures due to the presence of coils. The highly conserved binding sites are represented by α-helices and β-sheets (Figure 1).
The examined sub-cellular localization validated that all 24 EjALMT proteins were situated at the nucleus, cytonuclear, mitochondria, vacuole, chloroplast, endoplasmic reticulum, plasma membrane, Golgi apparatus and peroxisome (Figure 2A). In addition, 12 putative functional domains within 24 EjALMT proteins were also recognized, while all EjALMT proteins were found to have ALMT superfamily domains (Figure 2B).

3.2. Phylogenetic Analysis of ALMT Genes in Four Rosacea Species and A. thaliana

Utilizing multiple sequence alignment tools, among the protein sequences of E. japonica and four other plant species (A. thaliana, M. domestica, P. cummunis and P. persica), a phylogenetic tree was created by following the neighbor-joining (NJ) method. Results demonstrated that all studied ALMTs, among five species, were clustered into four discrete subgroups (A–D) (Figure 3). Among the EjALMT gene family, six, eight, seven and three genes were allocated in subgroups A, B, C and D, respectively.

3.3. Gene Structure and Conserved Motif Analyses of EjALMT Genes

The genomic structural inquiry revealed that the total number of exons for each EjALMT gene ranged adequately, from five to seven (Figure 4A). The majority of EjALMT genes consisted of six exons, while three EjALMTs, EVM0017192.1, EVM0043758.1 and EVM0012726.1, contained seven exons, whereas EVM0036194.1 and EVM0024781.1 contained five exons. This suggests that loss and gain of exons during evolutionary process happened simultaneously in the ALMT gene family. By utilizing online servers of MEME, distribution of conserved motifs for EjALMTs was thoroughly assessed; a range of 6 to 10 presumed conserved motifs was acknowledged among EjALMT proteins. The majority of EjALMTs contained 9 or 10 motifs, while two EjALMT genes, EVM0037970.1 and EVM0017192.1, contained 8 motifs, one gene, EVM0036194.1, contained 7 motifs and one gene, EVM0024781.1, had 6 conserved motifs. Figure 4B shows the distribution of conserved motifs. Thus, it can be assumed that, during the evolutionary process, EjALMTs evidently exhibited extreme conservation.
The transmembrane structures of EjALMT genes were also predicted, and the result showed that all EjALMT genes had transmembrane helices. The number of transmembrane helices ranged from four to seven, and those transmembrane regions were in N-terminus (Figure S1, Table S1).

3.4. Promoter Region Analysis of ALMTs in Loquat

To further investigate the transcriptional mechanism of EjALMTs, 1000 bps from the upstream region of ALMTs were subjected to promoter analysis (Figure 5). Several plant growth hormone-related cis-elements (i.e., ABRE, AuxRR-core, CGTCA-motif, GARE, TCA-element, TGACG-motif, TGA-element) were detected in the promoter regions of EjALMTs. These cis-elements were responsible for the regulation of abscisic acid, auxins, methyl jasmonate, gibberellins and salicylic acid. Besides, stress response cis-elements, i.e., LTR, MBS, and TC-rich repeats were also identified in several genes. The AE-box, LRE, LTR, and MRE were found as light-responsive cis-elements. Apart from aforementioned cis-elements, ARE, CAT-box and circadian were also identified in 19 EjALMT genes, playing roles in anaerobic induction, meristem expression and circadian control, respectively.

3.5. Chromosomal Mapping and Syntenic Analysis of ALMTs in Loquat

The chromosomal mapping for EjALMTs is presented in Figure 6A. Among these genes, one, four, three, four, one, two, two, four and two genes were located on chromosomes 3, 4, 6, 7, 8, 9, 12, 14 and 17, respectively. The most EjALMT genes (4) were discovered on chromosome 4, 7 and 14, whereas the fewest were found on chromosome 3 and 8 (one per chromosome).
Whole-genome (WGD) and segmental duplication of EjALMTs were analyzed. Figure 6B shows that 22 loquat ALMTs (91.66%) revealed WGD/segmental duplication. By this, it can be proposed that WGD/segmental duplication played an imperative part in the evolution of the loquat ALMT family and for the expansion of the loquat genome. For the estimation of evolution rate and selective pressure, the Ka (nonsynonymous)/Ks(synonymous) ratio (ω) was used [35]. In general, positive selection represented by ω > 1 and ω < 1 represents evidence for purifying selection, while ω = 1 is hypothesized as neutral evolution. Table 3 shows the analyzed evolutionary pattern among the loquat genome, the ω values of gene duplication pairs were calculated to observe and understand selective pressures upon gene duplication, ω value for all EjALMT gene pairs was observed as lower than 1, showing the purifying selection has made a strong influence for EjALMTs evolution occurrence. Thus, it can be determined that the evolutionary pattern of EjALMT genes shows conservation in the process of loquat domestication.

3.6. Expression Patterns of EjALMT Genes

Further, we investigated the relative gene expression of ALMT gene family in different tissues of loquat, i.e., mature leaf, root, stem, full-bloom flower and ripened fruit (Figure 7). The expression of loquat ALMTs revealed noteworthy differences amongst different plant tissues. Among 24 loquat ALMTs, transcript levels of 13 genes were observed to be relatively low in the examined tissues, showing expression levels between 0 to 2.1. One loquat ALMT gene (EVM0012851.1) exhibited higher expression level in root and leaf tissues, while EVM0008731.1 was highly expressed in the stem. However, EVM0022795.1 did not show detectable expression except in roots.

4. Discussion

The functional importance of ALMT genes is well established. ALMTs dynamically participate in several biological processes throughout the plant life cycle, such as fruit acidity, guard-cell movement and mineral-metals toxicity regulation for plant sustainability [17,36]. The characterization of ALMTs has been studied in several plant species including A. thaliana, a model plant for molecular studies. Fourteen ALMT genes have been found which are associated with several molecular processes in A. thaliana [6]. The release of chromosome-level genome assembly of loquat provided an opportunity to undertake a study for ALMT gene family identification in E. japonica. The current study yielded a sum of 24 EjALMTs genes identified in the loquat genome through BLAST search. In addition, the conserved domain inquiry of ALMT proteins showed conserved domains within their sequences (Figure 2).
Phylogenetic analysis showed the evolutionary similarity of 24 EjALMT genes with three Rosaceae species and one A. thaliana, and the tree was classified into four subclasses (Figure 3). EjALMT genes were clustered with ALMTs from apple (M. domestica), which signifies a close relationship between the ALMTs of loquat and apples. Novelty among the functioning of proteins usually arises for the genomic duplication during evolution. More or less, polyploidy-derived duplication maintains protein functioning, whereas few investigations did show a loss of functionality [37]. The evolutionary process of loquat with respect to the ALMT gene family was studied and genomic structure and conserved motifs of the ALMT family were characterized in this study. Most of the EjALMT genes exhibited similar numbers of exons and conserved motifs (Figure 4). Furthermore, it may be deduced that the loquat went through a rather slow evolutionary rate and intense selection evolution, as duplicated EjALMT gene pairs showed ω values lower than 1 (Table 3) [7,38]. However, it has also been proposed earlier that the domestication history of loquat is not so long, or loquat domestication is not yet complete, because there were non-significant differences for physiological and morphological traits between cultivated and wild loquat [39]. The single nucleotide polymorphism (SNP) frequencies in the wild loquat population were only 2.4% higher than those in the cultivated loquat population [40].
The amount of characterized ALMT genes as well as the number of chromosomes among Rosaceae species are diverse and are nearly double in comparison to Chinese plum, peach and strawberry [41]. It can also be assumed that loquat, apple and pear had undergone a relatively recent lineage-specific WGD. Subsequently, recent WGD events augmented the number of ALMTs in Rosaceae fruiting species. Tandem, WGD or segmental, and dispersed duplication are distinctive features in eukaryotic genomes going through evolutionary processes [42]. These features are also responsible for new functional diversity resulting from the evolution of genomes [43]. Alhough segmental duplication is hard to be differentiated from WGD, the Anchor gene’s presence can alter the duplication occurrence [44]. WGD or segmental duplication are likely to have a greater effect on the expansion of gene families such as Hydroxycinnamoyl Transferase (HCT) and Cation Proton Antiporters (CPA) [45,46]. Gene paralogs are also known as tandem duplicates which can be found on adjacent chromosomes and are proposed to be derived from illegitimate chromosomal recombination [47]. WRKY and AP2/ERF are large gene families expanded predominantly from tandem duplication [48,49]. Species such as loquat, pear and apple have been repeatedly reported to undergo genome duplication process at least twice [23,24,50]. The results of the previous studies revealed that the expansion of the ALMT gene family in pear and apple was more likely derived primarily from WGD or segmental duplication. The number of ALMT genes that underwent pear WGD or segmental duplication was much higher than those that underwent other duplication modes, while the number of dispersed duplications composed the majority in peach, Chinese plum and strawberry, because these three species have not experienced the recent WGD [41]. Gene losses, genome rearrangements and RNA- and DNA-based transposed gene duplications may be responsible for the larger proportions of dispersed duplicates in the aforementioned species [51]. Current investigation shows that the ALMT gene family expansion in loquat are likely to be WGD- or segmental duplication-driven as verified through synteny analysis (Figure 6, Table 3). Loquat is a diploid species with a basic chromosome number of n = 17 [23,52,53]. Out of 24 EjALMT genes, 10 genes were found to be located on chromosomes 6–9, one on chromosome 3, four on chromosome 4, two on chromosome 12, another four on chromosome 14 and rest of the two genes on chromosome 17. It is worth noting that no EjALMT gene was found on chromosomes 1 and 2, and chromosomes 11 and 13, which are homologous pairs [23]. Since 20 out of 24 EjALMTs exhibited WGD/segmental duplication in the loquat genome (Figure 6), this indicates that the duplication of EjALMT genes is related to WGD/segmental duplication during the process of loquat speciation and domestication. Similarly, 22 out of 25 MdALMTs showed WGD/segmental duplication in the apple genome [7].
Studies on ALMTs biochemical functional diversification has been determined among several plant species. However, functional characterization for EjALMTs still lacks scientific knowledge. Yet, so far, four ALMTs having critical functional values have been characterized in A. thaliana. AtALMT1 is an important gene that encodes aluminum-activated root malic acid outflow transporter proteins to assist plants under aluminum toxicity [15]. AtALMT6 is localized at guard cells vacuolar membrane and is reported to control activity of stomatal opening and closure for transpiration by controlling malate efflux and influx [18]. Malate responsive vacuolar chloride channel protein AtALMT9 also plays a key part in controlling the stomatal aperture signaling pathway and regulating the transportation of malic acid diagonally through the membrane in plant cells [19,54]. AtALMT12 (R-type anion) is reported to have functional regulation in controlling stomatal guard cells in A. thaliana [55]. Furthermore, it was revealed that two members, BnALMT1 and BnALMT2, from the ALMT gene family, enhanced aluminum tolerance for plant sustainability in Rape [36]. TaALMT1, in wheat (Triticum aestivum), was identified during the selection of aluminum resistant plants, also having homology to AtALMT1 [56]. Several reports show that TaALMT1 is a key protein that takes part in the regulation of malate contents across root cell membranes [15,57]. In the present study, the gene expression profiling of ALMT genes in loquat revealed noteworthy differences amongst different plant tissues (Figure 7). All EjAMLT genes were predicted to be localized in plasma membrane, while the highest genetic expressions of EVM0012851.1, EVM0008191.1, EVM0016148.1, EVM0022757.1, EVM0008737.1, EVM0040195.1 and EVM0021601.1 were recorded in loquat leaves and stems, indicating their possible role in stomatal opening and closure. However, further studies are needed to justify their specific roles in plant growth and the development of loquat. All of these findings indicate that ALMTs have various physiological roles in plant species and it is proposed that members of the loquat ALMT gene family may be considered important factors in regulating a variety of functions in the loquat plant.

5. Conclusions

In the present study, 24 ALMT genes were identified in the loquat genome. All ALMT genes were subjected to conserved domains, gene structure, conserved motif, phylogenetic, syntenic and expression analysis. Based on the subcellular localization analysis, it was predicted that all EjALMT proteins were localized in the plasma membrane. Syntenic analysis revealed that WGD/segmental duplication played an important role in the expansion of the ALMT gene family in loquat. The transmembrane analysis indicated that all EjALMT genes had transmembrane helices with N-terminus. The Ka and Ks values of duplicated genes indicated that EjALMT genes had undergone a strong purifying selection. In addition, as the result of the expression analysis, some genes were differentially expressed in different tissues of loquat, i.e., root, mature leaf, stem, full-bloom flower and ripened fruit. This study provides the basis for further functional analysis of ALMT genes in loquat.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/horticulturae7110441/s1, Figure S1: The predicted transmembrane structures of EjALMT genes, Table S1: Summary of the information about transmembrane helices of EjALMT proteins.

Author Contributions

Conceptualization, M.M.A. and F.C.; methodology, M.M.A., M.S. and D.L.; validation, S.A., Z.L. and F.C.; data curation, M.M.A.; writing—original draft preparation, M.M.A. and S.M.A.; writing—review and editing, R.A., S.A., Z.L. and F.C.; supervision, F.C.; project administration, Z.L. and F.C.; funding acquisition, Z.L. and F.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Plant Biological Seedling Science and Technology Innovation Team (CXTD2021009-03) and Enterprise Technology Development Contract (2020-3501-04-001995).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Badenes, M.L.; Canyamas, T.; Romero, C.; Soriano, J.M.; Martínez, J.; Llácer, G. Genetic diversity in european collection of loquat (Eriobotrya japonica Lindl.). Acta Hortic. 2003, 620, 169–174. [Google Scholar] [CrossRef]
  2. Tian, S.; Qin, G.; Li, B. Loquat. In Postharvest Biology and Technology of Tropical and Subtropical Fruits; Woodhead Publishing Limited: Oxford, UK, 2011; p. 444. [Google Scholar]
  3. LaRue, R.G. Loquat Fact Sheet. Available online: http://fruitsandnuts.ucdavis.edu/dsadditions/Loquat_Fact_Sheet/ (accessed on 30 January 2020).
  4. Tian, S.; Li, B.; Ding, Z. Physiological properties and storage technologies of loquat fruit. Fresh Prod. 2007, 1, 76–81. [Google Scholar]
  5. Lu, Z.M.; Zhang, Z.L.; Wu, W.X.; Li, W.H. Effect of low temperatures on postharvest loquat fruit. Acta Hortic. 2007, 750, 483–486. [Google Scholar] [CrossRef]
  6. Sharma, T.; Dreyer, I.; Kochian, L.; Piñeros, M.A. The ALMT Family of Organic Acid Transporters in Plants and Their Involvement in Detoxification and Nutrient Security. Front. Plant Sci. 2016, 7, 1488. [Google Scholar] [CrossRef] [Green Version]
  7. Ma, B.; Yuan, Y.; Gao, M.; Qi, T.; Li, M.; Ma, F. Genome-Wide Identification, Molecular Evolution, and Expression Divergence of Aluminum-Activated Malate Transporters in Apples. Int. J. Mol. Sci. 2018, 19, 2807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Zhang, X.; Wei, X.; Ali, M.M.; Rizwan, H.M.; Li, B.; Li, H.; Jia, K.; Yang, X.; Ma, S.; Li, S.; et al. Changes in the Content of Organic Acids and Expression Analysis of Citric Acid Accumulation-Related Genes during Fruit Development of Yellow (Passiflora edulis f. flavicarpa) and Purple (Passiflora edulis f. edulis) Passion Fruits. Int. J. Mol. Sci. 2021, 22, 5765. [Google Scholar] [CrossRef]
  9. Meyer, S.; De Angeli, A.; Fernie, A.R.; Martinoia, E. Intra- and extra-cellular excretion of carboxylates. Trends Plant Sci. 2010, 15, 40–47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Ryan, P.R.; Skerrett, M.; Findlay, G.P.; Delhaize, E.; Tyerman, S.D. Aluminum activates an anion channel in the apical cells of wheat roots. Proc. Natl. Acad. Sci. USA 1997, 94, 6547–6552. [Google Scholar] [CrossRef] [Green Version]
  11. Ma, B.; Liao, L.; Zheng, H.; Chen, J.; Wu, B.; Ogutu, C.; Li, S.; Korban, S.S.; Han, Y. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple. Plant Genome 2015, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Delhaize, E.; Craig, S.; Beaton, C.D.; Bennet, R.J.; Jagadish, V.C.; Randall, P.J. Aluminum Tolerance in Wheat (Triticum aestivum L.) (I. Uptake and Distribution of Aluminum in Root Apices). Plant Physiol. 1993, 103, 685–693. [Google Scholar] [CrossRef] [Green Version]
  13. Delhaize, E.; Ryan, P.R.; Randall, P.J. Aluminum Tolerance in Wheat (Triticum aestivum L.) (II. Aluminum-Stimulated Excretion of Malic Acid from Root Apices). Plant Physiol. 1993, 103, 695–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Ma, J.F.; Zheng, S.J.; Matsumoto, H. Specific Secretion of Citric Acid Induced by Al Stress in Cassia tora L. Plant Cell Physiol. 1997, 38, 1019–1025. [Google Scholar] [CrossRef]
  15. Hoekenga, O.A.; Maron, L.G.; Pineros, M.A.; Cancado, G.M.A.; Shaff, J.; Kobayashi, Y.; Ryan, P.R.; Dong, B.; Delhaize, E.; Sasaki, T.; et al. AtALMT1, which encodes a malate transporter, is identified as one of several genes critical for aluminum tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA 2006, 103, 9738–9743. [Google Scholar] [CrossRef] [Green Version]
  16. Kobayashi, Y.; Kobayashi, Y.; Sugimoto, M.; Lakshmanan, V.; Iuchi, S.; Kobayashi, M.; Bais, H.P.; Koyama, H. Characterization of the Complex Regulation of AtALMT1 Expression in Response to Phytohormones and Other Inducers. Plant Physiol. 2013, 162, 732–740. [Google Scholar] [CrossRef] [Green Version]
  17. Kovermann, P.; Meyer, S.; Hörtensteiner, S.; Picco, C.; Scholz-Starke, J.; Ravera, S.; Lee, Y.; Martinoia, E. The Arabidopsis vacuolar malate channel is a member of the ALMT family. Plant J. 2007, 52, 1169–1180. [Google Scholar] [CrossRef]
  18. Meyer, S.; Scholz-Starke, J.; De Angeli, A.; Kovermann, P.; Burla, B.; Gambale, F.; Martinoia, E. Malate transport by the vacuolar AtALMT6 channel in guard cells is subject to multiple regulation. Plant J. 2011, 67, 247–257. [Google Scholar] [CrossRef] [Green Version]
  19. De Angeli, A.; Zhang, J.; Meyer, S.; Martinoia, E. AtALMT9 is a malate-activated vacuolar chloride channel required for stomatal opening in Arabidopsis. Nat. Commun. 2013, 4, 1804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. De Angeli, A.; Baetz, U.; Francisco, R.; Zhang, J.; Chaves, M.M.; Regalado, A. The vacuolar channel VvALMT9 mediates malate and tartrate accumulation in berries of Vitis vinifera. Planta 2013, 238, 283–291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Ali, M.M.; Anwar, R.; Shafique, M.W.; Yousef, A.F.; Chen, F. Exogenous Application of Mg, Zn and B Influences Phyto-Nutritional Composition of Leaves and Fruits of Loquat (Eriobotrya japonica Lindl.). Agronomy 2021, 11, 224. [Google Scholar] [CrossRef]
  22. Ali, M.M.; Li, B.; Zhi, C.; Yousef, A.F.; Chen, F. Foliar-Supplied Molybdenum Improves Phyto-Nutritional Composition of Leaves and Fruits of Loquat (Eriobotrya japonica Lindl.). Agronomy 2021, 11, 892. [Google Scholar] [CrossRef]
  23. Jiang, S.; An, H.; Xu, F.; Zhang, X. Chromosome-level genome assembly and annotation of the loquat (Eriobotrya japonica) genome. Gigascience 2020, 9. [Google Scholar] [CrossRef] [Green Version]
  24. Daccord, N.; Celton, J.-M.; Linsmith, G.; Becker, C.; Choisne, N.; Schijlen, E.; van de Geest, H.; Bianco, L.; Micheletti, D.; Velasco, R.; et al. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 2017, 49, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
  25. Chagné, D.; Crowhurst, R.N.; Pindo, M.; Thrimawithana, A.; Deng, C.; Ireland, H.; Fiers, M.; Dzierzon, H.; Cestaro, A.; Fontana, P.; et al. The Draft Genome Sequence of European Pear (Pyrus communis L. ‘Bartlett’). PLoS ONE 2014, 9, e92644. [Google Scholar] [CrossRef] [PubMed]
  26. Verde, I.; Jenkins, J.; Dondini, L.; Micali, S.; Pagliarani, G.; Vendramin, E.; Paris, R.; Aramini, V.; Gazza, L.; Rossini, L.; et al. The Peach v2.0 release: High-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC Genomics 2017, 18, 225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Finn, R.D.; Mistry, J.; Tate, J.; Coggill, P.; Heger, A.; Pollington, J.E.; Gavin, O.L.; Gunasekaran, P.; Ceric, G.; Forslund, K.; et al. The Pfam protein families database. Nucleic Acids Res. 2010, 38, D211–D222. [Google Scholar] [CrossRef] [PubMed]
  28. Eddy, S.R. Accelerated Profile HMM Searches. PLoS Comput. Biol. 2011, 7, e1002195. [Google Scholar] [CrossRef] [Green Version]
  29. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  30. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  31. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Green Version]
  32. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Gan, X.; Jing, Y.; Shahid, M.Q.; He, Y.; Baloch, F.S.; Lin, S.; Yang, X. Identification, phylogenetic analysis, and expression patterns of the SAUR gene family in loquat (Eriobotrya japonica). Turkish J. Agric. For. 2020, 44, 15–23. [Google Scholar] [CrossRef]
  34. Wang, D.; Zhang, Y.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating Gamma-Series Methods and Sliding Window Strategies. Genomics. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
  35. Akhunov, E.D.; Sehgal, S.; Liang, H.; Wang, S.; Akhunova, A.R.; Kaur, G.; Li, W.; Forrest, K.L.; See, D.; Šimková, H.; et al. Comparative Analysis of Syntenic Genes in Grass Genomes Reveals Accelerated Rates of Gene Structure and Coding Sequence Evolution in Polyploid Wheat. Plant Physiol. 2012, 161, 252–265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Ligaba, A.; Katsuhara, M.; Ryan, P.R.; Shibasaka, M.; Matsumoto, H. The BnALMT1 and BnALMT2 Genes from Rape Encode Aluminum-Activated Malate Transporters That Enhance the Aluminum Resistance of Plant Cells. Plant Physiol. 2006, 142, 1294–1303. [Google Scholar] [CrossRef] [Green Version]
  37. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-Wide Analysis of the ERF Gene Family in Arabidopsis and Rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Green Version]
  38. Wang, W.; Zhou, H.; Ma, B.; Owiti, A.; Korban, S.S.; Han, Y. Divergent Evolutionary Pattern of Sugar Transporter Genes is Associated with the Difference in Sugar Accumulation between Grasses and Eudicots. Sci. Rep. 2016, 6, 29153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Soriano, J.M.; Romero, C.; Vilanova, S.; Llácer, G.; Badenes, M.L. Genetic diversity of loquat germplasm ( Eriobotrya japonica (Thunb) Lindl) assessed by SSR markers. Genome 2005, 48, 108–114. [Google Scholar] [CrossRef] [PubMed]
  40. Wang, Y.; Shahid, M.Q.; Lin, S.; Chen, C.; Hu, C. Footprints of domestication revealed by RAD-tag resequencing in loquat: SNP data reveals a non-significant domestication bottleneck and a single domestication event. BMC Genomics 2017, 18, 354. [Google Scholar] [CrossRef] [Green Version]
  41. Linlin, X.; Xin, Q.; Mingyue, Z.; Shaoling, Z. Genome-Wide analysis of aluminum-activated malate transporter family genes in six rosaceae species, and expression analysis and functional characterization on malate accumulation in Chinese white pear. Plant Sci. 2018, 274, 451–465. [Google Scholar] [CrossRef] [PubMed]
  42. Friedman, R.; Hughes, A.L. Pattern and Timing of Gene Duplication in Animal Genomes. Genome Res. 2001, 11, 1842–1847. [Google Scholar] [CrossRef]
  43. Moore, R.C.; Purugganan, M.D. The early stages of duplicate gene evolution. Proc. Natl. Acad. Sci. USA 2003, 100, 15682–15687. [Google Scholar] [CrossRef] [Green Version]
  44. Wang, Y.; Wang, X.; Paterson, A.H. Genome and gene duplications and gene expression divergence: A view from plants. Ann. N. Y. Acad. Sci. 2012, 1256, 1–14. [Google Scholar] [CrossRef]
  45. Zhou, H.; Qi, K.; Liu, X.; Yin, H.; Wang, P.; Chen, J.; Wu, J.; Zhang, S. Genome-wide identification and comparative analysis of the cation proton antiporters family in pear and four other Rosaceae species. Mol. Genet. Genomics 2016, 291, 1727–1742. [Google Scholar] [CrossRef] [PubMed]
  46. Ma, C.; Zhang, H.; Li, J.; Tao, S.; Qiao, X.; Korban, S.S.; Zhang, S.; Wu, J. Genome-wide analysis and characterization of molecular evolution of the HCT gene family in pear (Pyrus bretschneideri). Plant Syst. Evol. 2017, 303, 71–90. [Google Scholar] [CrossRef]
  47. Freeling, M. Bias in Plant Gene Content Following Different Sorts of Duplication: Tandem, Whole-Genome, Segmental, or by Transposition. Annu. Rev. Plant Biol. 2009, 60, 433–453. [Google Scholar] [CrossRef]
  48. Du, D.; Hao, R.; Cheng, T.; Pan, H.; Yang, W.; Wang, J.; Zhang, Q. Genome-Wide Analysis of the AP2/ERF Gene Family in Prunus mume. Plant Mol. Biol. Report. 2013, 31, 741–750. [Google Scholar] [CrossRef]
  49. Guo, C.; Guo, R.; Xu, X.; Gao, M.; Li, X.; Song, J.; Zheng, Y.; Wang, X. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family. J. Exp. Bot. 2014, 65, 1513–1528. [Google Scholar] [CrossRef] [PubMed]
  50. Wu, J.; Wang, Z.; Shi, Z.; Zhang, S.; Ming, R.; Zhu, S.; Khan, M.A.; Tao, S.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef] [Green Version]
  51. Qiao, X.; Li, M.; Li, L.; Yin, H.; Wu, J.; Zhang, S. Genome-wide identification and comparative analysis of the heat shock transcription factor family in Chinese white pear (Pyrus bretschneideri) and five other Rosaceae species. BMC Plant Biol. 2015, 15, 12. [Google Scholar] [CrossRef] [Green Version]
  52. Guo, Q.G.; Li, X.L.; Xing, W.W.; He, Q.; Liang, G.L. Occurence of natural triploids in loquat. Acta Hortic. 2007, 125–128. [Google Scholar] [CrossRef]
  53. Wen, G.; Dang, J.; Xie, Z.; Wang, J.; Jiang, P.; Guo, Q.; Liang, G. Molecular karyotypes of loquat (Eriobotrya japonica) aneuploids can be detected by using SSR markers combined with quantitative PCR irrespective of heterozygosity. Plant Methods 2020, 16, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Zhang, J.; Martinoia, E.; De Angeli, A. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9. J. Biol. Chem. 2014, 289, 25581–25589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Meyer, S.; Mumm, P.; Imes, D.; Endler, A.; Weder, B.; Al-Rasheid, K.A.S.; Geiger, D.; Marten, I.; Martinoia, E.; Hedrich, R. AtALMT12 represents an R-type anion channel required for stomatal movement in Arabidopsis guard cells. Plant J. 2010, 63, 1054–1062. [Google Scholar] [CrossRef] [Green Version]
  56. Sasaki, T.; Yamamoto, Y.; Ezaki, B.; Katsuhara, M.; Ahn, S.J.; Ryan, P.R.; Delhaize, E.; Matsumoto, H. A wheat gene encoding an aluminum-activated malate transporter. Plant J. 2004, 37, 645–653. [Google Scholar] [CrossRef] [PubMed]
  57. Yamaguchi, M.; Sasaki, T.; Sivaguru, M.; Yamamoto, Y.; Osawa, H.; Ahn, S.J.; Matsumoto, H. Evidence for the Plasma Membrane Localization of Al-activated Malate Transporter (ALMT1). Plant Cell Physiol. 2005, 46, 812–816. [Google Scholar] [CrossRef] [Green Version]
Horticulturae 07 00441 g001 550
Figure 1. The predicted structures (3D) of ALMT proteins in loquat. The protein chains are colored as blue at the N-terminus and red at the C-terminus. The secondary structures in the model are highlighted in green (for α-helices) and yellow (for β-strands).
Figure 1. The predicted structures (3D) of ALMT proteins in loquat. The protein chains are colored as blue at the N-terminus and red at the C-terminus. The secondary structures in the model are highlighted in green (for α-helices) and yellow (for β-strands).
Horticulturae 07 00441 g001
Horticulturae 07 00441 g002 550
Figure 2. (A) Prediction of subcellular localization of EjALMT proteins. Higher signal levels are shown as red, lower signal levels are indicated as blue, while white color indicates no available data. Abbreviations: Nucl–Nucleus; Cyto–Cytonuclear; Mito–Mitochondria; Vacu–vacuole; Chlo–chloroplast; E.R.–endoplasmic reticulum; Plas–plasma membrane; Golgi–golgi apparatus; Pero–peroxisome; Extra–extracellular. (B) Conserved domain analysis of ALMT genes in loquat genome.
Figure 2. (A) Prediction of subcellular localization of EjALMT proteins. Higher signal levels are shown as red, lower signal levels are indicated as blue, while white color indicates no available data. Abbreviations: Nucl–Nucleus; Cyto–Cytonuclear; Mito–Mitochondria; Vacu–vacuole; Chlo–chloroplast; E.R.–endoplasmic reticulum; Plas–plasma membrane; Golgi–golgi apparatus; Pero–peroxisome; Extra–extracellular. (B) Conserved domain analysis of ALMT genes in loquat genome.
Horticulturae 07 00441 g002
Horticulturae 07 00441 g003 550
Figure 3. Phylogenetic tree analysis of ALMT genes in four rosacea species and A. thaliana using neighbor-joining (NJ) method. Numbers near the tree branches indicate bootstrap values per 1000 replicates.
Figure 3. Phylogenetic tree analysis of ALMT genes in four rosacea species and A. thaliana using neighbor-joining (NJ) method. Numbers near the tree branches indicate bootstrap values per 1000 replicates.
Horticulturae 07 00441 g003
Horticulturae 07 00441 g004 550
Figure 4. (A) Gene organization of EjALMTs. Color codes: Green–exons; black–introns; yellow–Untranslated Regions (UTR). (B) Conserved motifs identified by MEME tools.
Figure 4. (A) Gene organization of EjALMTs. Color codes: Green–exons; black–introns; yellow–Untranslated Regions (UTR). (B) Conserved motifs identified by MEME tools.
Horticulturae 07 00441 g004
Horticulturae 07 00441 g005 550
Figure 5. Heatmap of cis-regulatory elements detected in the promoter sequences of EjALMT genes. Maximum number of cis-regulatory elements are denoted by red, medium by yellow, and minimum by blue boxes.
Figure 5. Heatmap of cis-regulatory elements detected in the promoter sequences of EjALMT genes. Maximum number of cis-regulatory elements are denoted by red, medium by yellow, and minimum by blue boxes.
Horticulturae 07 00441 g005
Horticulturae 07 00441 g006 550
Figure 6. (A) Chromosomal mapping of EjALMT genes. (B) Chromosomal distribution and gene duplication of EjALMTs. Gene IDs are labeled as per chromosomal location basis. Whole-genome duplication (WGD)/segmental-duplication genes are denoted as red lines.
Figure 6. (A) Chromosomal mapping of EjALMT genes. (B) Chromosomal distribution and gene duplication of EjALMTs. Gene IDs are labeled as per chromosomal location basis. Whole-genome duplication (WGD)/segmental-duplication genes are denoted as red lines.
Horticulturae 07 00441 g006
Horticulturae 07 00441 g007 550
Figure 7. Expression profiles of loquat ALMTs in loquat plant tissues, i.e., root, mature leaf, stem, full-bloom flower, ripened fruit. Relative expression levels were used to construct heat map. Color codes: red–higher expression; blue–lower expression; white–no detectable expression.
Figure 7. Expression profiles of loquat ALMTs in loquat plant tissues, i.e., root, mature leaf, stem, full-bloom flower, ripened fruit. Relative expression levels were used to construct heat map. Color codes: red–higher expression; blue–lower expression; white–no detectable expression.
Horticulturae 07 00441 g007
Table
Table 1. Primer sequences of EjALMT genes.
Table 1. Primer sequences of EjALMT genes.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
EVM0037970.1TGATGCAGTCGATCGAAGAGTGGTCCAAACTTGGAAGGAG
EVM0000569.1AAAGGGTAGGATGCGAAGGTAATCTCCCAGCTTTCCGAAT
EVM0022757.1GCGGTGATAACCGTGGTAGTAAAGATCCCAAGCACAATGG
EVM0040588.1ATGAGACGATGCAACCAACATCCTTTGCCAATTCTTCCAC
EVM0036194.1GGCTTCAAGGAAATGACCAAAGCAGAAGCGAACCAACTGT
EVM0025487.1GTGGGAGCCTAGACATGGAATTTGTTGCTTTGGATGGTCA
EVM0013481.1CTAGCATCCCTGGCACATTTCGAATTCTCACTTCCGGGTA
EVM0010307.1GCCGCAGAACTGGTAAGAAGGGTGACATCGGAGAAGGTGT
EVM0044994.1AATGCCATGTGGGCAGTTATATCAAATCGGGCTTTCACTG
EVM0024781.1CAAGAGAAGGAAGCGATTGGCCAACTTTGAGGCAATGGAT
EVM0001186.1TGCAGGTATGGAAATGGACACCAACTTTCAAGGCATGGAT
EVM0008191.1GACTTGGGCTTCAACAGCTCTTTTCGAGGATCCGAATGAC
EVM0017192.1ATTTGCAGTCTGGGAACCACTCTCCACTTTCTTGGCGAGT
EVM0037785.1GGAGCTCCAGAGAGTTGGTGTTCCCTGGGACGTACTTCAG
EVM0008737.1AGTACGGCTTTCGGGTTTTTCAGATCCTCTCCCGACCATA
EVM0028408.1TGGGAAAGCATTGAAGGAACGTGTGCCAGGGATGCTAGTT
EVM0021601.1GGAAGGTTTTGGGGATGAATGGTGAGGTTTCCGATCTTGA
EVM0017728.1TGTGATAGTGCCCGAATTGACCAGCAAGCTTTCCAAGTTC
EVM0022795.1AACTATTCCGGCAGATGTGGACTAGGGCAACTCCCACCTT
EVM0016148.1GAAGTTCTTGAGGCCACAGCCAATCCTCCCCAACTCTTCA
EVM0043758.1ACCCGATTAGGACAGCATTGCTATAGGCAGGCTCGTCTGG
EVM0012726.1GGTGCCATGATCTTCATCCTTGAAATAATCCGCCACACAA
EVM0012851.1TATTGAACGCGGATGATGAAAAACACCTGTGGGCAAGTTC
EVM0040195.1CGATGGTATTGGTGTTGCAGAAAGATCCCAAGCACAATGG
Table
Table 2. Physiological and biochemical properties of EjALMT proteins.
Table 2. Physiological and biochemical properties of EjALMT proteins.
GeneAmino AcidsMW (kDa)pIGRAVYInstability IndexAliphatic Index
EVM0037970.138041.996.270.30135.99108.47
EVM0000569.159766.766.82−0.05337.3589.82
EVM0022757.149453.9980.2436.62108.97
EVM0040588.142346.968.050.12839.83105.77
EVM0036194.142646.546.390.24536.49105.96
EVM0025487.148453.458.730.0639.5495.7
EVM0013481.147251.738.590.11146.41101.46
EVM0010307.154460.788.32−0.06635.9292.48
EVM0044994.149754.547.060.1730.7996.38
EVM0024781.131834.579.140.34726.7698.46
EVM0001186.153259.848.230.00533.6496.99
EVM0008191.156863.946.07−0.00137.7693.71
EVM0017192.142847.868.510.03828.9493.41
EVM0037785.156863.995.92−0.03837.8991.81
EVM0008737.152158.578.30.07222.7691.69
EVM0028408.147251.748.650.19843.07101.04
EVM0021601.148553.749.340.05233.3196.72
EVM0017728.143348.098.050.11736.82104.46
EVM0022795.143047.556.290.22536.57107.42
EVM0016148.153259.578.22−0.00832.8195.71
EVM0043758.152558.766.52−0.11239.4392.48
EVM0012726.147251.766.990.21631.9697.94
EVM0012851.160267.577.9−0.08642.2189.07
EVM0040195.149453.737.210.24833.36107.98
MW: molecular weight of amino acid sequence; pI: theoretical isoelectric point; GRAVY: grand average of hydropathicity.
Table
Table 3. Ka (nonsynonymous)/Ks (synonymous) ratio of WGD/segmental duplicated EjALMT genes.
Table 3. Ka (nonsynonymous)/Ks (synonymous) ratio of WGD/segmental duplicated EjALMT genes.
Gene 1Gene 2KaKsKa/Ks (ω)SelectionMode of Duplication
EVM0008191.1EVM0037785.10.0412080.1908420.215929Purifying-selectionSegmental
EVM0017192.1EVM0008737.10.0550980.2120410.259844Purifying-selectionSegmental
EVM0000569.1EVM0012851.10.0391160.1499820.260807Purifying-selectionSegmental
EVM0010307.1EVM0043758.10.0405790.2109390.192371Purifying-selectionSegmental
EVM0001186.1EVM0016148.10.0301890.2295070.131536Purifying-selectionSegmental
EVM0037970.1EVM0022795.10.0022960.0112930.203339Purifying-selectionTandem
EVM0044994.1EVM0012726.10.0678890.2103490.322745Purifying-selectionSegmental
EVM0022757.1EVM0040195.10.0510230.1012090.504133Purifying-selectionSegmental
EVM0025487.1EVM0021601.10.0674610.2051040.328911Purifying-selectionSegmental
EVM0013481.1EVM0028408.10.0641630.173170.370524Purifying-selectionSegmental
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ali, M.M.; Alam, S.M.; Anwar, R.; Ali, S.; Shi, M.; Liang, D.; Lin, Z.; Chen, F. Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl. Horticulturae 2021, 7, 441. https://doi.org/10.3390/horticulturae7110441

AMA Style

Ali MM, Alam SM, Anwar R, Ali S, Shi M, Liang D, Lin Z, Chen F. Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl. Horticulturae. 2021; 7(11):441. https://doi.org/10.3390/horticulturae7110441

Chicago/Turabian Style

Ali, Muhammad Moaaz, Shariq Mahmood Alam, Raheel Anwar, Sajid Ali, Meng Shi, Dangdi Liang, Zhimin Lin, and Faxing Chen. 2021. "Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl." Horticulturae 7, no. 11: 441. https://doi.org/10.3390/horticulturae7110441

APA Style

Ali, M. M., Alam, S. M., Anwar, R., Ali, S., Shi, M., Liang, D., Lin, Z., & Chen, F. (2021). Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl. Horticulturae, 7(11), 441. https://doi.org/10.3390/horticulturae7110441

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop